CA2146063C - Use of alkaline proteases in industrial textile washing processes - Google Patents
Use of alkaline proteases in industrial textile washing processes Download PDFInfo
- Publication number
- CA2146063C CA2146063C CA002146063A CA2146063A CA2146063C CA 2146063 C CA2146063 C CA 2146063C CA 002146063 A CA002146063 A CA 002146063A CA 2146063 A CA2146063 A CA 2146063A CA 2146063 C CA2146063 C CA 2146063C
- Authority
- CA
- Canada
- Prior art keywords
- amino
- ala
- ser
- dsm
- bacillus
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Lifetime
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
- C12N9/50—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
- C12N9/52—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from bacteria or Archaea
- C12N9/54—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from bacteria or Archaea bacteria being Bacillus
-
- C—CHEMISTRY; METALLURGY
- C11—ANIMAL OR VEGETABLE OILS, FATS, FATTY SUBSTANCES OR WAXES; FATTY ACIDS THEREFROM; DETERGENTS; CANDLES
- C11D—DETERGENT COMPOSITIONS; USE OF SINGLE SUBSTANCES AS DETERGENTS; SOAP OR SOAP-MAKING; RESIN SOAPS; RECOVERY OF GLYCEROL
- C11D3/00—Other compounding ingredients of detergent compositions covered in group C11D1/00
- C11D3/16—Organic compounds
- C11D3/38—Products with no well-defined composition, e.g. natural products
- C11D3/386—Preparations containing enzymes, e.g. protease or amylase
-
- C—CHEMISTRY; METALLURGY
- C11—ANIMAL OR VEGETABLE OILS, FATS, FATTY SUBSTANCES OR WAXES; FATTY ACIDS THEREFROM; DETERGENTS; CANDLES
- C11D—DETERGENT COMPOSITIONS; USE OF SINGLE SUBSTANCES AS DETERGENTS; SOAP OR SOAP-MAKING; RESIN SOAPS; RECOVERY OF GLYCEROL
- C11D3/00—Other compounding ingredients of detergent compositions covered in group C11D1/00
- C11D3/39—Organic or inorganic per-compounds
Abstract
The use of alkaline bacillus proteases in commercial laundry methods and compositions containing these proteases for commercial laundering are described. The alkaline bacillus proteases are obtained from Bacillus alcalophilus HA1(DSM 5466) and have an amino-acid sequence which differs from the amino-acid sequence of SEQ ID No:1 (Figure 1) by at least one amino-acid replacement selected from the group consisting of Q12R, N74R, M216Q; N237P and T249R.
Description
.~'1 ~~~~4~
r USE OF ALKALINE PROTEASES IN INDUSTRIAL .
TEXTT_LE LAUNDERING PROCESSES
Background of the Invention This invention relates to the use of alkaline proteases in commercial laundry methods and to compositions for use in commercial laundry methods which contain alkaline proteases.
The textile detergents used in commercial laundries differ in many ways from the detergents normally used domestically.' Commercial laundries employ large washer systems which operate either cyclically in -response to a timer or continuously and have a very high laundry throughput. These commercial washer systems use different detergent combinations depending on the type of textile and the degree o= soiling with the detergent being dispensed in measured amcunts _nto the washing solution in various washing stages such as wetting; prewashing, clear washing and rinsing. The need to utilize water and energy economically has made it necessary to develop for commercial laundering special partly formulated detergent combinations which can be adjusted optimally for the particular washing stage depend_ng on'the type and soil~.ng of the textiles to 2p be washed.
It has long been known to use protease-containing detergent corlpositions in commercial laundries, for example for cleaning hospital laundry contaminated with blood or protective clothing from meat-processing operations.
Because the conditions in commercial laundry methods are more severe than ir_ domestic washing machines, particularly high demands are made of the proteases used therein. In addition to good stability and activity at highly alkaline pH values, proteases to be used in commercial laundry systems should have a temperature stability which is sufficiently high to produce good washing results for the particular laundering cycle at low concentration for the maximum length of time at the high temperatures which prevail in commercial laundry methods. In addition, the alkaline protease used should have minimum sensitivity to the detergent ingredients customary in commercial laundry methods, such as, for example, surfactants, bleaches or disinfectants. Thus, there has remained a need for alkaline proteases which are suitable for commercial laundry methods.
Summary of the Invention The present invention seeks to provide a textile laundering method which employs new alkaline proteases particularly suitable for use under the conditions encountered in commercial laundry systems.
The invention also seeks to provide detergent compositions which comprise new alkaline proteases particularly suitable for use under the conditions encountered in commercial laundry systems.
Broadly stated, the invention provides a method of laundering a soiled textile comprising washing the textile in the presence of a detergent formulation comprising at least one conventional detergent ingredient and at least one alkaline protease selected from the group consisting of a) protease secreted by the Bacillus strain DSM 6845, and b) protease secreted by the Bacillus strain DSM 5466 and having an amino-acid sequence which differs from the amino-acid sequence of Fig. 1 by at least one amino-acid replacement selected from the group consisting of Q12R, N42R, N74R, N114R, N115R, Q135R, M216Q, N237P, and T249R.
The invention also relates to a composition suitable for commercial laundry methods comprising at least one conventional detergent ingredient and at least one alkaline protease selected from the group consisting of a) alkaline Bacillus protease from Bacillus strain DSM 6845, and b) alkaline Bacillus protease from Bacillus strain DSM 5466 having an amino-acid sequence which differs from the amino-acid sequence of Fig. 1 by at least one amino-acid substitution selected from the group consisting of Q12R, N42R, N74R, N114R, N115R, Q135R, M216Q, N237P and T249R.
It has now been found that the alkaline bacillus proteases described hereinafter can be used with high wash efficiency in commercial laundry methods. The invention therefore relates to the use of alkaline proteases in compositions for commercial laundry methods, wherein at least one alkaline protease selected from the group of alkaline bacillus proteases from a) the Bacillus strain DSM 6845 and/or b) the Bacillus strain DSM 5466 with an amino-acid sequence which differs from the amino-acid sequence of Fig. 1 by at least one of the amino-acid replacements Q12R, N42R, N74R, N114R, N115R, Q135R, M216Q, N237P, T249R is used.
According to one aspect of the present invention there is provided a method of laundering a soiled textile comprising washing said textile under laundry conditions in the presence of a detergent formulation comprising at least one detergent ingredient and an alkaline protease obtained from Bacillus alcalophilus HA1 (DSM 5466) and having an amino-acid sequence which differs from the amino-acid sequence of SEQ ID No:l by at least one amino-acid replacement selected from the group consisting of Q12R, N74R, M216Q, N237P, and T249R.
According to a further aspect of the present invention there is provided a detergent composition suitable for laundry methods comprising at least one detergent ingredient and a bacillus protease obtained from Bacillus alcalophilus HA1 (DSM 5466) having an amino-acid sequence which differs from the amino-acid sequence of SEQ ID No: 1 by at least one amino-acid substitution selected from the group consisting of Q12R, N74R, M216Q, N237P and T249R.
These alkaline bacillus proteases have molecular weights in the range from 26,000 to 28,000 g/mole, measured by SDS polyacrylamide gel electrophoresis comparing with reference proteins of known molecular weight. Their pH
optimum is in the range from 8 to 13Ø As used herein, the term "pH optimum" refers to the pH range in which the proteases display maximum proteolytic activity. These alkaline bacillus proteases also exhibit good pH stability.
Alkaline bacillus proteases from the bacillus strain deposited in the Deutsche Sammlung von Mikroorganismen on December 16, 1991 under the number DSM 6845 can be obtained by cultivation of this strain from the culture supernatant.
An alkaline bacillus protease from the bacillus strain deposited in the Deutsche Sammlung von Mikroorganismen on July 28, 1989 under the number DSM No. 5466, which protease has an amino-acid sequence which differs from the amino-acid sequence of Fig. 1 at the indicated positions, can be obtained in a known manner by point mutation in the amino-acid sequence as described, for example, in U. S . Patent No .
5,352,603.
An alkaline bacillus protease from the strain DSM 6845 has the following properties:
(1) activity: breakdown of proteins and peptides;
r USE OF ALKALINE PROTEASES IN INDUSTRIAL .
TEXTT_LE LAUNDERING PROCESSES
Background of the Invention This invention relates to the use of alkaline proteases in commercial laundry methods and to compositions for use in commercial laundry methods which contain alkaline proteases.
The textile detergents used in commercial laundries differ in many ways from the detergents normally used domestically.' Commercial laundries employ large washer systems which operate either cyclically in -response to a timer or continuously and have a very high laundry throughput. These commercial washer systems use different detergent combinations depending on the type of textile and the degree o= soiling with the detergent being dispensed in measured amcunts _nto the washing solution in various washing stages such as wetting; prewashing, clear washing and rinsing. The need to utilize water and energy economically has made it necessary to develop for commercial laundering special partly formulated detergent combinations which can be adjusted optimally for the particular washing stage depend_ng on'the type and soil~.ng of the textiles to 2p be washed.
It has long been known to use protease-containing detergent corlpositions in commercial laundries, for example for cleaning hospital laundry contaminated with blood or protective clothing from meat-processing operations.
Because the conditions in commercial laundry methods are more severe than ir_ domestic washing machines, particularly high demands are made of the proteases used therein. In addition to good stability and activity at highly alkaline pH values, proteases to be used in commercial laundry systems should have a temperature stability which is sufficiently high to produce good washing results for the particular laundering cycle at low concentration for the maximum length of time at the high temperatures which prevail in commercial laundry methods. In addition, the alkaline protease used should have minimum sensitivity to the detergent ingredients customary in commercial laundry methods, such as, for example, surfactants, bleaches or disinfectants. Thus, there has remained a need for alkaline proteases which are suitable for commercial laundry methods.
Summary of the Invention The present invention seeks to provide a textile laundering method which employs new alkaline proteases particularly suitable for use under the conditions encountered in commercial laundry systems.
The invention also seeks to provide detergent compositions which comprise new alkaline proteases particularly suitable for use under the conditions encountered in commercial laundry systems.
Broadly stated, the invention provides a method of laundering a soiled textile comprising washing the textile in the presence of a detergent formulation comprising at least one conventional detergent ingredient and at least one alkaline protease selected from the group consisting of a) protease secreted by the Bacillus strain DSM 6845, and b) protease secreted by the Bacillus strain DSM 5466 and having an amino-acid sequence which differs from the amino-acid sequence of Fig. 1 by at least one amino-acid replacement selected from the group consisting of Q12R, N42R, N74R, N114R, N115R, Q135R, M216Q, N237P, and T249R.
The invention also relates to a composition suitable for commercial laundry methods comprising at least one conventional detergent ingredient and at least one alkaline protease selected from the group consisting of a) alkaline Bacillus protease from Bacillus strain DSM 6845, and b) alkaline Bacillus protease from Bacillus strain DSM 5466 having an amino-acid sequence which differs from the amino-acid sequence of Fig. 1 by at least one amino-acid substitution selected from the group consisting of Q12R, N42R, N74R, N114R, N115R, Q135R, M216Q, N237P and T249R.
It has now been found that the alkaline bacillus proteases described hereinafter can be used with high wash efficiency in commercial laundry methods. The invention therefore relates to the use of alkaline proteases in compositions for commercial laundry methods, wherein at least one alkaline protease selected from the group of alkaline bacillus proteases from a) the Bacillus strain DSM 6845 and/or b) the Bacillus strain DSM 5466 with an amino-acid sequence which differs from the amino-acid sequence of Fig. 1 by at least one of the amino-acid replacements Q12R, N42R, N74R, N114R, N115R, Q135R, M216Q, N237P, T249R is used.
According to one aspect of the present invention there is provided a method of laundering a soiled textile comprising washing said textile under laundry conditions in the presence of a detergent formulation comprising at least one detergent ingredient and an alkaline protease obtained from Bacillus alcalophilus HA1 (DSM 5466) and having an amino-acid sequence which differs from the amino-acid sequence of SEQ ID No:l by at least one amino-acid replacement selected from the group consisting of Q12R, N74R, M216Q, N237P, and T249R.
According to a further aspect of the present invention there is provided a detergent composition suitable for laundry methods comprising at least one detergent ingredient and a bacillus protease obtained from Bacillus alcalophilus HA1 (DSM 5466) having an amino-acid sequence which differs from the amino-acid sequence of SEQ ID No: 1 by at least one amino-acid substitution selected from the group consisting of Q12R, N74R, M216Q, N237P and T249R.
These alkaline bacillus proteases have molecular weights in the range from 26,000 to 28,000 g/mole, measured by SDS polyacrylamide gel electrophoresis comparing with reference proteins of known molecular weight. Their pH
optimum is in the range from 8 to 13Ø As used herein, the term "pH optimum" refers to the pH range in which the proteases display maximum proteolytic activity. These alkaline bacillus proteases also exhibit good pH stability.
Alkaline bacillus proteases from the bacillus strain deposited in the Deutsche Sammlung von Mikroorganismen on December 16, 1991 under the number DSM 6845 can be obtained by cultivation of this strain from the culture supernatant.
An alkaline bacillus protease from the bacillus strain deposited in the Deutsche Sammlung von Mikroorganismen on July 28, 1989 under the number DSM No. 5466, which protease has an amino-acid sequence which differs from the amino-acid sequence of Fig. 1 at the indicated positions, can be obtained in a known manner by point mutation in the amino-acid sequence as described, for example, in U. S . Patent No .
5,352,603.
An alkaline bacillus protease from the strain DSM 6845 has the following properties:
(1) activity: breakdown of proteins and peptides;
(2) pH optimum: approximately at pH values of 8.5-13.0, (3) pH stability: the protease provides to be completely stable at pH values of 9.5-11.0, where "completely stable" means a remaining activity of at least 90%;-(4) temperature optimum: about 64°C;
(5) temperature stability: the activity of the protease is not significantly impaired by incubation of the protease at temperatures up to 30°C for 15 minutes; the remaining activity of the protease after incubation at 40°C for 15 minutes is at least 75%.
The foregoing statement that the activity of the protease is not significantly impaired by incubation at temperatures up to 30°C for 15 minutes is understood to mean that in comparison to the original activity of the protease, it retains a residual proteolytic activity of at least 92%
after the incubation.
In another preferred variant, an alkaline bacillus protease from the strain DSM 5466 is used which has an amino-acid sequence which differs from the amino-acid sequence of Fig. 1 by at least one of the amino-acid replacements Q12R, M216Q, N237P or T249R, preferably the amino-acid substitutions.
-4a-~~46~1~~3 N42R/N114R/N115R or N42R/N114R/M216Q. The numerical values in these notations refer to the positions in the amino-acid sequence. The amino acids are identified by the one-letter codes, with the original amino acid preceding the position indicator and the inserted amino acid following the position indicator. These amino-acid replacements can be obtained in a known manner by point mutation in the amino-acid sequence as described, for example, in 'U. S. Patent No. 5,352,603.
These alkaline bacillus proteases show unusually good washing performance under the conditions customary in commercial laundries, such as high pH values, short washing times and high washing temperatures. Commercial laundry processes are typically carried out at temperatures between .
30°C and 70°C and at p~ values above 11.0, particularly at pH values between 11:0 and 13Ø These proteases also show a surprisingly high =esistance to inactivation by the detergent constituents customary in commercial laundry methods. Thus, these alkaline bacillus proteases can advantageously be used according to the invention in commercial large-capacity drum-type washing machines or countercurrent.batch washing machines operating cyclically in response to a timer or continuously., Moreover, it is particularly advantageous =or the alkaline bacillus proteases to be added to the washing solution in the prewash step in so-called multi-solution methods, for example dual wash cycles-composed o='prewash step and clear-wash step.
The prewashing can moreover be carried out under the conditions customary ,in commercial laundry methods, for example at temperatures from 30 to 70°C in a known manner's with the detergent 'ingredier_ts customarily used in this laundering cycle. Wrere the contaminants have a high protein content, for example heavily blood-spotted laundry from hospitals; large kitchens or meat-processing operations, the proteases of the invention optionally can be used very successfully in a prerinse step; which precedes the prewash step; with clear cold or recycled hot water and the other detergent ingredients customary for this purpose.
It is, of course, also possible for these alkaline bacillus proteases to be used according to the invention in all other commercial laundry methods, for example in commercial laundry methods suited to particular types of textiles and soils, such as, for example, in the disinfecting laundering of textiles form the hospital sector.
Compositions for commercial laundry methods may contain at least one alkaline bacillus protease from a) the Bacillus strain DSM 6845 and/or b) the Bacillus strain DSM 5466 with an amino-acid sequence which differs from the amino-acid sequence of Fig.
1 by at least one of the amino-acid substitutions Q12R, N42R, N74R, N114R, N115R, Q135R, M216Q, N237P or T249R.
The compositions may contain an alkaline bacillus protease from the Bacillus strain DSM 6845 which is characterized by the properties described above.
The composition according to the invention preferably contain an alkaline bacillus protease from the strain DSM
5466 with an amino-acid sequence which differs from the amino-acid sequence of Fig. 1 by at least one of the amino-acid substitutions Q12R, M216Q, N237P, T249R, in particular by the amino-acid replacements N42R/N114R/N115R or N42R/N114R/M216Q.
The alkaline bacillus proteases which should preferably be used in the compositions according to the invention are those which have an enzyme activity of 50,000 to 1,000,000 DU per gram of enzyme preparation. As used herein, the term "DU" refers to the enzymatic activity in Delft units, where 1000 DU correspond to the proteolytic activity which, with a volume of 1 ml of a 2% (W/W) strength enzyme solution, gives after breakdown of casein an extinction difference (1 cm path length; 275 nm; determination with blank sample test as reference) of 0.4000. Moreover, these alkaline ~14~0~~
bacillus proteases can be used in the formulations customary for commercial laundry methods either individually or in combination with one another, and optionally also in combination with conventional detergent proteases or other detergent enzymes customary in commercial laundry formulations, such as, for example, amylases, lipases, pectinases, nucleases, oxidoreductases etc. In the detergent formulations according to the invention, the content of these bacillus proteases should preferably be O.Z
to 5o by weight, in particular 0.2 to 2.0% by weight, with ..
respect to the dry matter of the overall composition.
The compositions according to the invention may take the form of complete heavy duty detergents, individual , detergents, and/or prewash or prerinse compositions, which are conventional for commercial laundry methods. It is moreover possible, depending on the type of detergent, for all the detergent ingredients customary in the state of the art, such as surfactants, bleaches, builders, laundry aids, optical brighteners and other customary components such as, for example, sodium carbonate, metasilicate., orthophosphate or sodium triphosphate, to be present in customary amounts.
Other examples of possible detergent ingredients include boosters, enzyme stabilizers, soil suspending agents and/or compatibilizers, complexing and chelating agents, foam regulators and additives such as corrosion inhibitors, anti-static agents, perfumes, disinfectants, bleach activators, peraeid bleach precursors and anti-greying agents.
The detergent compositions according to the invention are. preferably prewash compositions as are used in commercial laundry'methods in the temperature range from a to 70C in so-called multi-solution methods, for example in dual wash cycles comprising a prewash step and a clear-wash step. In addition to these alkaline bacillus proteases, the prewash compositions according to the invention can contain all ingredients customary for this purpose in the commercial sector, such as, for example, nonionic surfactants, phosphates, carbonates, silicates, and if desired perborates _ 7 _ ~1~5~~~
and/or bleach activators, anti-greying agents, polycarboxylates, optical br_ighteners and, optionally further buffer substances and auxiliaries. It is also possible to use commercially obtainable detergent formulations to which the alkaline bacillus proteases of the invention have been added in the stated amounts. If desired, these commercially obtainable formulations may also contain oxygen-based bleaches. Examples of suitable commercially available detergent formulations for the commercial sector include the products sold under the designations TEN-COLORS or TENAX CONC.TT''.
The detergent compositions according to the invention can be formulated in a known manner in powder form, for example in the form of granules, prills or pellets, and if desired also p=ovidea with surface coatings. Because of their good stability, the bacillus proteases of the invention can also be used in liquid formulations.
Under the cor_ditions customary in commercial laundry methods, such as highly alkalins poi values, for example pH
values above 1_.O, ar_d high washing temperatures of up to 70°C, the alkalise aacillus aroteases of the invention exhibit surprising-y good washing properties. This is all the more surprising since, in cor...~arison to conventional household washing machines, the countercurrent laundry systems used in commercial laundries often operate completely continuously, which usually means that only relatively short wash_ng times are available. Besides high temperature reuistance, the alkaline bacillus proteases of _ the present inver_ticn additionally exhibit high enzyme stability it t~e presence of the customary ingredients of commercial detergents, When used in accordance with the invention, these alkali bacillus proteases are also stable with respect ~o the bleaches customarily used in the commercial sector, for example, in commercial disinfecting detergents for tk~e hospital sector, in particular with respect to oxycan bleach concentrates, for erample based on perborate or hydrogen peroxide.
_ g _ The following Examples are intended to illustrate the invention in further detail without restricting its scope.
Brief Description of the Drawinas The invention will be described in further detail hereinafter with reference to the accompanying drawings in which:
Figure 1 is a listing of the amino-acid sequence (SEQ
ID NO1) of the alkaline protease from Bacillus alcalophilus HA1 (DSM 5466).
Figure 2 is graph of the temperature optimum of the protease from Bacillus sp. MFI2 (DSM 6845).
Figure 3 is a graph showing the temperature stability of the protease from Bacillus sp. MF12 (DSM 6845).
Figure 4 is a graph showing the pH 'optimum of the protease from Bac?llus sp. MFI2 (DSM 6845).
Figure 5 is a graph showing the pH stability of the protease from Bac_llus sp. MF12 (DSM 6845).
Examples The sequencing of the amino-acid sequence, shown in Fig. 1, of the alkaline protease from Bacillus alcalophilus HA1 (DSM 5466) via determination of the correspcnding nucleotide sequence is described W Examples 1 to 4 ir_ U.S.
Patent No. 5,352,603, The bacterial strain named Bacillus sp. MF12 strain was deposited at the Deutsche Sammlung von Mikroorganismen (DSM) on December 16, 1991 under the number DSM 6845. The Bacillus alcalophilus strain named Bacillus al calophilus HA1 was deposited at the Deutsche Sammlung von Mikroorganismen (DSM) on July 28, 1989 under the number DSM 5466.
Example 1: Preparation of alkaline proteases modified by mutations in the amino-acid sequence.
The preparation of alkaline proteases which differ from the amino-acid sequence shown in Fig. 1, of the alkaline protease from Bacillus alcalophilus HA1 (DSM 5466) by at least one of the amino-acid substitutions Q12R, N42R;' N74R, N114R, N115R, Q135R, M216Q, N237P or T249R was carried out in a known manner by directed mutagenesis in partial DNA
sequences of the corresponding protease gene. The nufi~erical values in this notation system refer to the corresponding amino-acid position in the amino-acid sequence shown in Fig.
1, with the position indicator being preceded by the one letter code for the original amino acid and followed by the l0 one letter code for the inserted amino acid. The method of directed mutagenesis for the aforementioned mutations is described in detail in Hxamples 5 to 18 of U.S. Patent No.
5,352,603. With regard to the amino-acid replacements in positions 42, 114, 216 and 249, additional reference may also be made to p~.zblishe~ German Patent Application No.
DE 4 , 304 , 16 3 [corresponding to published Canadian Patent "
Application 2,115,465).
In principle, the method comprised the following known method steps : Chrorr~osomal DNA was isolated from the natural isolate Bacillus alcalophilus HAl (DSM 5466) by the method of Saito et al. [Biochim. Biophys. Acta 72:619-629 (1963)]
and was partially hycrolyzed with the restriction endonuclease Sau3A. The restriction fragments were fractionated by electrophoresis, and the fragments with a size of 3 to 8 kilobases (kb7 were isolated. The isolated and size-selected DNA fragments from Bacillus alcalophilus ' HA1 were recombined in vitro in a known manner with vector DNA of the known plasmid pUB 110. Protoplasts of the strain Bacillus subtilis BD224 (Bacillus Genetic Stock Center 1A46) '~
were transformed with the resulting in vitro recombinant DNA
by the method described by S. Chang and N. Cohen [Mol. Gen.
Genet. 168:111-115 (1979)]. The transformants were selected on plates with neomycin. The plasmid DNA was isolated from a clone as described in Maniatis et al. [Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory (1982)].
The fragment, contained in this plasmid, from the B. alcalo-philus DNA had a size of c.1 kb and contained the complete ~14~~1 ~~
DNA sequence fox the highly alkaline protease from Bacillus al calophilus HA:L (DSM 5466) (compare Examples 1 and ..-2 of U.S. 5,352,603).
The plasmid containing the complete DNA sequence for the highly alkaline protease from Bacillus alcalophilus HA1 (DSM 5466) was restricted with AvaI. The protruding ends were filled in in a known manner (see Maniatis et al. , p.
114) to give the DNA double strand. After subsequent restriction of this DNA with ~baI, the N-terminal fragmentv comprising 1618 base pairs (bp) was isolated and cloned into ~~
the vector pBS in a known manner. The resulting vector contained the N-terminal end of the DNA coding for the amino-acid sequence depicted in Fig. 1 (compare Example 5 of U.S. 5,352,603) .
A vector which contained a DNA fragment comprising 658 by and coding for the C-terminal end of the corresponding protease was produced in an analogous manner: For this purpose, the plasmid containing the complete DNA sequence was cut with the restriction endonucleases XbaI and Asp718 and cloned into the appropriate cleavage site of the known vector pBS (compare Example 7 of U.S: 5,352,603).
The directed mutations were carried' out in the DNA
partial sequences containing the C-terminal or the N-terminal end by the pr?mer extension technique described by Kunkel, T. A: (Proe. Natl. Acad. Sci. USA 82:488-492 (1985)]. For this purpose, the apprcpriate vectors were first converted in a known manner ir_t:o their uracilated single-stranded analogues by cultivating E: coli CJ236 bacteria -which had' been transformed w ith one ' of the two -vectors and'which wereadditionally'?ofected with the helper phage M13 K07 (purchased from Bio-Rad Laboratories, Richmond; California). The bacterium E. coli CJ236 is a known uracil N-glycosylase-deficient mutant which on replication of the vectors incorporGtes the nucleotide uracil in place of thymidine into the DNA sequence of the vector. Uracilated vectors can be advantageously used in a known manner for in vitro reactions of 3irected mutagenesis ~\
because, after termination of the reactions, the uracil-containing DNA single strand wk~ich was used as template to generate mutated DNA strands can be eliminated by treatment with uracil N-glycosylase. The use of these helper phages was necessary for the synthesis of the coat proteins for the resulting uracilated single-stranded vector. DNA. Coated uracilated single-stranded vector DNA was secreted from the transformed host organism E. coli CJ236 and subsequently.
isolated from the culture medium. ~~
The isolated, uracilated DNA single strand, vectors of the respective C-terminal or N-terminal end were hybridized with synthetic oligonucleotides which contained a mutation .
site and were simultaneously used as primers for the subsequent completion to the complete DNA double strand with mutation. The synthetic oligonucleotides used in this case were prepared in a known manner by the method of Beaucage, S. L, and Caruthers, M. H. [Tetrahedron Letters 22:1859-52 (1981)1. The second DNA strand was synthesized in a known manner using T4 DNA polymerase and subsequent ligation with T4 DNA ligase [Kunkel et al., Methods in Enzymol. 154:367-82 (1987)]. The resulting double-stranded vector DNA was transformed into E. cali MC 1061, and the mutated vectors were identified by checking the appropriate unicrae restriction_ endonuclease recognition sites which had been introduced or deleted with the synthetic oligonucleotides.
To produce, for example, two mutations either in the N-terminal or in the C-terminal part of the protease DNA, the first mutation was produced as'described above and then the method was repeated in an analogous manner using another , synthetic oligonucleotide to introduce a second mutation.
Expression vectors with mutations in the C-terminal part or N-terminal part of the protease DNA sequence were prepared by cutting the DNA sequences obtained by the directed mutagenesis with restriction endonucleases and ligating them to vector DNA which contained the corresponding other terminal part of the DNA sequence and 21~~O~a all the elements necessary for expression. The resrzlting vectors represented complete expression vectors with a suitable reading frame for expressing the appropriately mutated mutase. The preparation of the expression vectors is described in detail in Example 16 of U.S. Patent No.
5,352,603. Expression vectors were prepared for the following mutations:
DSM 5466 Mut. N114R/M216Q -DSM 5466 Mut. N115R/Q135R
to DSM 5466 Mut. N42R/N114R/M216Q
DSM 5466 Mut. N42R/N114Q/N115Q
DSM 5466 Matt: N114R/N237P
DSM 5466 Mut. N42R/N114R
DSM 5466 Mut. Q12R/N42R/N114R
DSM 5466 Mut. N114R/N237P/T249R
DSM 5466 Mut. Q12R/N42R/N114R
The mutated highly alkaline proteases were obtained by transforming B. subtilis BD 224 with a respective one of the aforementioned expression vectors in a known manner. The mutated highly alkaline proteases were isolated by known methods from the culaure supernatants from these transformed strains. Detailed information on the isolation of the mutated proteases is found in Examples 16 and 18 of U.S.
Patent No. 5352,603.
The alkaline proteases obtained by mutating the amino acid sequence of the protease from Bacillus al caloph.ilus HA1 (DSM 5466) were used in washing tests described in Example ,Example 2: Isolation of an alkaline protease from Bacillus sp. MF12 DSM 6845.
50 ml of- Luria broth pH 9.5 (10 g of, yeast extract, 5 g of Tryptone, 5 g of NaCl and 50 ml of carbonate buffer ad 1000 ml of double-distilled water) in a 500 ml Erlenmeyer flask with 3 baffles were inoculated with a single colony of the strain Bacillus sp. MF12 DSM 6845 (grown on PBA agar plates) and incubated at 37°C and 240 rpm for 16 -hours.
50 ml of main culture medium (soya 2%; starch 50; corn steep liquor l%, carbonate buffer 50 ml (Na2CQ3 4.2%)) in a 500 ml Erlenmeyer flask with 3 baffles were inoculated with 2.5 ml of this culture and incubated at 37°C and 240 rpm for 48 hours.
The activity of the protease was determined in Delft units (DU). 1000 DU is the proteolytic activity which, with.
a volume of 1 ml of a 2% (w/w) strength enzyme solution, gives after breakdown of casein an extinction difference (1 cm path length; 275 nm; determination with blank sample test as reference) of 0.4000.
The proteolytic activity in the culture supernatant obtained by centrifugation at 27,000 x g for l5 minutes was 5000 DU/ml after 48 hours.
The temperature optimum of the proteases contained in the culture supernatants was determined in the range from 40 to 72°C. The results are shown in Table l and in Figure 2.
The temperature optimum of the protease from Bacillus sp. MF12 DSM 6845 is at 64°C.
Table 1 Temperature optimum of the alkaline protease from Bacillus sp: MF12 DSM 6845 % Activity as a function of the temperature in °C
40°C 50°C 55°C 60°C 64°C 72°C
180 370 530 740 100% 760 To determine the temperature stability, the protease-containing supernatant was incubated at various temperatures for 15 minutes and subsequently the remaining activity was determined. The results are shown in Table 2 arid in Fig. 3.
i\
The protease from Baczllus sp. MF12 DSM 6845 is stable up to 31°C (remaining activity > 90%) and still shows a remaining activity of 58% after incubation at 50°C for 15 minutes. ' Table 2 Temperature Remaining proteolytic activity in (C] after incubation at various , temperatures for 15 minutes 31. 92 40 '79 To determine the pH
optimum of the protease from Bacillus sp.
DSM
6845, the activity was determined at various pH
values.
The pH
was adjusted with phosphate buffer (0.1 M) in the pH
range 5.0 to 7.0, with tris-HC1 buffer (0.1 M) in the pH
range 7.0 to 9.0, and with glycine-NaOH
buffer (0:1 M) in the pH
range 9:0 to 13Ø
The activity values determined are shown in Fig.
4.
The pH
optimum of the alkaline protease from Bacillus sp.
DSM
is around pH
12, The activity is still ,greater than 90%
at pH
13.
To investigate the pH
stability, the protease from Bacillus sp.
DSM
was incubated in buffers having ,various pH
values at for hours.
The remaining activity of the proteases was then determined.
Phosphate 30' buffer (0.1 M) was used for the pH
range from to 7.1, tris-HC1 buffer (tris(hydroxymethyl)aminomethane buffer) (0.1 M) was used for the pH
range from 7.5 to 9, and glycine/sodium hydroxide buffer (0.1 M) was used for the pH
range from to 12.1.
The result is shown in Fig.
5.
X146(16 The alkaline protease from Bacillus sp. MF~2 DSM 6845 still has a minimum of 70% activity remaining after the 24-hour incubation in the entire pH range, and is completely stable around pH 11.
Example 3: Washing tests under conditions customary in commercial laundry methods.
Washing tests were carried out with soiled test fabric under conditions customary in commercial methods. The test' fabrics used were a polyester/cotton blend fabric purchased from the eidgenossische Materialpru.fungsanstalt, St . Gallen, Switzerland (EMPA117) soiled with blood, milk and India ink, a polyester/cotton blend fabric of our own manufacture (EY-PC) soiled with egg yolk and India ink, and a polyester/cotton blend fabric of our own manufacture (M-PC) soiled with milk and India ink. Washing was carried out in Zelltex Polycolor laboratory washing machines using as basic detergent formulations the prewash compositions which are customary in the commercial sector and are obtainable under ..
the proprietary names TEN COLOR' and TENAX CO\C.T"
(manufactured by J: P. Haas, Steinau, Germany). Washinc was carried out in the temperature range from 15C to 60C for 45 minutes (temperature increased from l5C to 60C at a rate of 2C/min. and then maintained at 60C for 22.5 ;-in) or in the temperature range from l5C to 65C for 25 mir~utes (temperature increased from 15C to 65C' at a rate of 5C/min. and then maintained at 65C for l5 min). The water hardness was l5 German hardness; the enzyme concentration was 0.71 mg of pure protease per liter of washing solut_on.
T:~e test fabric was exposed to the enzyme-containing detergent solution in a; rotating sample vessel chamber wi~.ich was controlled by a water bath in accordance with the t=mperature program. After the vaashing process the test fabric was rinsed twice with deionized water and then ironed.
The washing performance of the proteases was determined by measuring the reflectance of the washed test fabric using ~~~~~e~
a reflectance photometer. The reflectance of the test fabric washed only with the basic detergent formulation was likewise measured. The difference between these two reflectance values is called the DR value and is a measure of the washing performance of the particular protease. For comparison with proteases heretofore used in detergent formulations for commercial laundry systems, all the washing tests were likewise carried out under identical conditions with the protease which is commercially available under the proprietary name Opticlean'~''.
Table 3 shows the washing pe=formances of the proteases used according to the invention with a bleach-tree detergent formulation for commercial laundry methods commercially available under the proprietary name TENAX CONC.='"' Table 3 Washing performance of proteas~s used according to the invention on test fabric EMPA117 asing a bleach-free prewash formulation for commercial laund-_y methods.
Washing conditions: 15-60°C (2°C/min, kept at 60°C
for 22.5 min), wash time 45 min, pH 11.5 Enzvme-dosage: 0.71 mg/1 EMPA117EY-PC hi-PC Total Protease 0R with egg wits ~R
yolk milk' c~R ~R
Opticlean~'t' 13.43 3.41 4.21 21:05 100%
DSM5466 Mut. 12.07 6.15 4.97 23.19 110%
DSM5466 Mut. 14.12' 3.38 5.77 23.27 111%
3 0 DSM5466 Mut. 13.14 6. B1 7.66 27.61 131%
DSM5466 Mut. 13.92 8.01 5.22 28.15 134%
MF12 DSM 6845 17.31 9.32 5.27 31.90 152%
_ 17 _ Table 4 shows the washing performance of the proteases used according to the invention with-a detergent formulation for commercial laundry methods.commercially available under the proprietary name TEN-COLOR'"' which contains oxpgen-based bleach (perborate) .
'Table 4 Washing performance of proteases according to the invention.
used on test fabric EMPA117 using a detergent formulation for commercial textile laundry methods with bleach.
Washing conditions: 15-60°C (2°C/min, kept at 60°C for 22.5 min), wash time 45 min, pH 11.5 Enzyme dosage: 0.71 mg/1 EMPAlI7EY-PC . Total 1 5 Protease D3 with egg DR
yolk Opticlean~" 12.35' 5.09 17.44 100%
DSM 5466 tdut.12.92 5.55 18.47 106%
N114R/N237P, DSM 5466 Mut. 13.49 5.12 18.61 107%
DSM 5466 Mut. 13.65 5.04 18.70 107%
DSM 5466 Mut. 14.32 4.69 19.01 109%
N114T_2/N237P/T249R
2 5 DSM 5466 Mut. 11:65 7.40 19.06 109%
' t~5216Q
DSM 5466 Mut. 18.44 6.7 25.14 144%
MF12 DSM 6845 13.15 7.72 20.88 120%
The reflectance high values of the proteases used according to the 'invention demonstrate their high washing performance protein-soiled the on fabric conditions under customary in commercial laundry methods (high alkaline pH
35 values, high kept temperatures at for long times).
_ 1g . ~ ~~~sos~
In addition to the tests of washing efficiency on the test fabric EMPA117, washing tests were also carried out with the test fabric EY-PC soiled with egg yolk/Tndia ink and with the test fabric M-PC soiled with milk/Tndia ink.
The washing test conditions also were made more severe in that the heating rate was increased to 5°C/min and the wash:
solution was then maintained at a temperature of 65°C for min. The bleach-containing detergent formulation TEN-.-COLORT" for commercial laundry methods was likewise used in 10 these washing tests. Table 9 shows the results obtained in these tests.
Table 5 Washir_g performance of proteases according to the invention 15 used on test fabrics EMPA117, EY-PC and M-PC with a bleach containing commercial,laundry detergent formulation.
Washir_a conditions:
(5C/min, kept at for min), washing time min Enzyme dosage ;
:
rrig/1 2 0 EMPA117EY-PC M-PC' Total Protease DR ~R DR aR
ppticiean~'' 9.10 3.46 1.82 14'.38100%
DSM 5456 Mut.-14.84 ' S.13 2.85' 22:82 159%
N42R/\114R/N115R
25 DSM S~'6 Mut.9:10 6.48 4.56' 20..14140%
MF12 T'SM 9:51 7:33 3.45 20:29 141% ..
t can be seen from Tables 'thraugh that the .; 30 ~proteGses used according to the invention exhibit very good washing performance on various types of fabric soiled with different protein contaminants:
Moreover;
there is virtually no detectable impairment, of the enzyme stability by the highly alkaline medium of the washing solution, by the nigh washing temperature and/or by the bleach.
~~~sss~
Furthermore, exceptionally good washing performance is obtained with a short washing time of only 25 min. These results show the particularly high suitability of the proteases of the present invention for use in commercial laundry methods.
The foregoing description and examples.have been set forth merely to illustrate the invention and are not intended to be limiting. Since modifications of the.
disclosed embodiments incorporating the spirit and substance '~
of the invention may occur to persons skilled in the art, the invention should be construed to include everything within the scope of the appended claims and equivalents thereof.
21~60~e~
SEQUENCE LISTING
(1) GENERAL INFORMATION:
(i) APPLICANT: Amory, Antoine Clippe, Andre ..
Konieczny-Janda, Gerhard (ii) TITLE OF INVENTION: USE OF ALKALINE PROTEASE$ IN
COMMERCIAL LAUNDRY METHODS
(iii) NUMBER OF SEQUENCES: 2 (iv) CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: Evenson; McKeown, Edwards & Lenahan (B) STREET: Suite 700, r200 G Street; N.W.
(C) CITY: Washington (D) STATE: Washington, D.C.
(E) COUNTRY: USA
(F) ZIP: 20005 (v) 'COMPUTER READABLE FORM:
(A) MEDIUM TYPE: Floppy d-sk (B) COMPUTER: IBM PC compatible (C) OPERATING SYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: PatentIn Re?ease #1.0, Version #1.25 (EPO) (vii) PRIOR APPLICATION DATA:
(A) APPLICATION NUMBER:: DE 4411223.8 (B) FILING DATE: 31-MAR-199 (viii) ATTORNEY/AGENT INFORMATION:
(A) NAME Evans, J.D.
(B) REGISTRATION NUMBER: 26,269 (C) REFERENCE/DOCKET NUMB~R: 183/42062' (ix) TELECOMMUNICATION INFORMAT_ON:
(A) Telephone: (202) 628-8800 (B) Telefax: (202) 628-8344 (C) TELEX: 6731278 (2) INFORMATION FOR SEQ ID NO: 1:
'(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH.~ 2280 base pairs (By TYPE: nucleic'acid (C) ,STRANDEL7NESS: ;si.ngle (D) TOPOLOGY: linear ~(ii) MOLECULE TYKE: DNA (genomic) '(iii) HYPOTHETICAL: NO,' (iii) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Bacillus alcalophilus (B) STRAIDT: HA1, DSM 5466 2~~~f~~
(viii) POSITION IN GENUME:
(B) MAP POSITION: 1192 to 1998 mature peptide (C) UNITS: by (ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 859..1998 --(ix) FEATURE:
(A) NAME/KEY: mat~eptide (B) LOCATION: 1192..1998 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 1:
GTGAAAGACG
AAGC-GCTTGA
ATCTGTTCAT
TTATTTAP_~1C P.ACCATGCCC ATGTCCACAC ACAGCGTGCT GAGGAGGACG GCTGGCATAT 360 CGTTGCCGAT TTGCATGPAC GAG=_CTTAAA 420 ACGGGTTGAA AGCTACTGTG TTTCAAAAGA
TAGACAGATG P~CACTTGTT TCGCTGTTTT ACGACAAAGA TCATCTTGCC TGTTACGCGT540 TTTT2'AAATC CGTTTTCGCA CGT~CAATTGTCGCCGAGTC GTACCAGTCG CTGTAAGTGA600 GAATATGTTT AGAAAGCCGC GTA'=TTA~1GCGCAGTCTTTT TCGTTCTGTA CTGGCTGGTT660 TGTC-~ACAGT TTCCATACCC ATC_~1CCTCCTTTTATTTGT AGCTTTCCCC ACTTGAAACC720 GTTTTAATCA AAAACGA.GT GAG_'-_~GATTC'AGTTAACTTA ACGTTAATAT TTGTTTCCCA780 ATAG~vCAAn.T CTTTCTA~CT TTGATACGTTTAAACTACCA GCTTGGACAA GTTGGTATAA840 P~1ATGAGGAG GGAACCGA ATG AAG'AAA CCG TTG GGG AAA ATT GTC 891 GCA AGC
Met Lys Lys; Pro Leu Gly Lys Ile Val Ala Ser 'ACC GCA CTA CTC ATT TCT G~T GCT TTT AGT TCA TCG ATC GCA 939 TCG GCT .
'Thr Ala Leu Leu Ile Ser Val Ala Phe Ser Ser Ser Ile Ala Ser Ala -100 -95 -90 -g5 GCT GAA GAA GCA AA'i GAA A~=.A TTA ATT GGC TTT AAT GAG 987 TAT CAG GAA
Ala Glu Glu Ala Lys Glu Lys Tyr' Leu Ile Gly Phe Asn Glu Gln Glu -80 -75 -7p GCT GTC AGT GAG TTT GTA GA.A CAA GTA GAG GCA AAT GAC GAG 1035 GTC GCC
Ala Val Ser Glu Phe Val Glu Gln Val Glu Ala Asn Asp Glu Val Ala ATT CTC TCT GAG GAS GAG G_~A GTC GAA ATT GAA TTG CTT CAT 1083 GAA TTT
_1e Leu Ser Glu Glu Glu Glu Val Glu Ile Glu Leu Leu His Glu Phe 214b~1~fi Glu Thr Ile Pro Val Leu Ser Val Glu Leu Ser Pro Glu Asp Val Asp Ala Leu Glu Leu Asp Pro Ala Ile Ser Tyr Ile Glu Glu Asp A1a Glu Val Thr Thr Met Ala Gln Ser Val Pro Trp Gly Ile Ser Arg Val Gln A1a Pro Ala Ala His Asn Arg Gly Leu Thr G1y Ser Gly Val Lys Va1 ATT CGT
Ala Val Leu Asp Thr Gly Ile Ser Thr His Pro Asp Leu Asn Ile Arg GGT,GGC GCT AGC TTT GTA CCA GGG GAA CCA TCC ACT CAA GAT 1371 GGG AAT
Gly Gly Ala Ser Phe Val Pro Gly Glu Pro Ser Thr Gln Asp Gly Asn 45 50 55. 60 AAT TCG
Gly His Gly Thr His Val Ala Gly Thr Ile Ala Ala Leu Asn Asn Ser 65 7p 75 GTT AAA
Ile Gly Val Leu Gly Val.Ala Pro Ser Ala Glu Leu Tyr Ala Val Lys GTA.TTA GGG GCG AGC GGT TCA GGT TCG GTC AGC TCG ATT GCC 1515 CAA GGA
Val Leu Gly Ala Ser Gly Ser Gly Ser Val Ser her Ile Ala Gln Gly 95 100 ' 105 TTG GAA TGG GCA GGG AAC AAT GGC ATG CAC GTT'GCT AAT TTG 1563 AGT TTA
Leu Glu Trp Ala Gly Asn Asn Gly Met'His Val'Ala Asn Leu Ser Leu 110' 115 12 0 GGA AGC'CCT TCG CCA AGT GCC ACA CTT GAG CAA GCT GTT AAT 1611 AGC GCG
Gly Ser Pro Ser Pro Ser Ala Thr Leu Glu Gln Ala Val ASn Ser Ala 125 130 135 ' 140 ACT TCT AGA GGC GTT CTT GTT GTA GCG GCA TCT'GGG AAT TCA 1659 GGT GCA
Thr Ser Arg Gly Val Leu. Val Val Ala Ala Ser Gly Asn Ser Gly Ala GGC TCA ATC AGC TAT CCG GCC CGT TAT GCG AAC GCA ATG GCA' 1707 GTC GGA
Gly Ser Ile Ser 2'yr Pro Ala Arg T'yr Ala Asn Ala Met Ala Val G1y 160 '165 1.70.
GGC GCA
AIa Thr Asp Gln Asn Asn Asn Arg'Ala Ser Phe Ser Gln Tyr Gly Ala TAC CCA
Gly Leu Asg Ile Val Ala Pro Gly Val Asn Val G1n Ser Thr Tyr Pra CCT CAT
Gly Ser Thr Tyr Ala Ser Leu Asn Gly Thr Ser Met Ala Thr Pro His 214~~fi;:~
Val Ala Gly Ala Ala Ala Leu Val Lys Gln Lys Asn Pro Ser Trp Ser Asn Val GIn Ile Arg Asn His Leu Lys Asn Thr AIa Thr Ser Leu GIy Ser Thr Asn Leu Tyr Gly Ser Gly Leu Val Asn Ala Glu Ala Ala Thr Arg AAAAGAGAAC GGGCTGTTTA
AGATCGCAGG
CGCTCGCAGG CTTTTGACTT
TCTTATCGCT
TTTATTTAAG TTCTG
TATTCGTTTG
TT
(2) INFORMATTON FOR SEQ :
ID N0: 2 (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 380 amino acids (B) TYPE: amino- acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE:
protein (xi) SEQUENCE DESCRIPTION:EQ
S ID
NO:
2:
Met Lys Lys Pro Leu Gly Val SerThr LeuLeu Ile Lys Ile Ala Ala Ser Val Ala Phe Ser Ser Ala AlaAla GluAla Lys Ser Ile Ser Glu -95 -90 - _g5 .80 Glu Lys Tyr Leu Ile Gly Glu GluAla SexGlu Phe Phe Asn Gln Val Val Glu Gln Va1 Glu Ala Glu AlaIle SerGlu Glu Asn ASp Va1 Leu -60 -55 -50 .
Glu Glu Val Glu Ile Glu His PheGlu IlePro Val Leu Leu Glu Thr _45 -40 _35 Leu Ser Val Glu Leu Ser ASp AspAla GluLeu Asp Pro Glu Val Leu Pro Ala Ile Ser Tyr Ile Asp GluVal ThrMet Ala - Glu Glu Ala Thr _15 _10 _5 1 Gln Ser Val Pro Trp Gly Arg GlnAla AlaAla His Ile Ser Val Pro Asn Arg Gly Leu Thr Gly Val ValAla LeuAsp Thr Ser Gly Lys Val ~~~~~il Gly Ile Ser Thr His Pro Asp Leu Asn Ile Arg Gly Gly Ala Ser Phe r Val Pro Gly Glu Pro Ser Thr Gln Asp Gly Asn Gly His G1y Thr His Val Ala Gly Thr Ile Ala Ala Leu Asn Asn Ser Ile Gly Val Leu Gly Val Ala Pro Ser Ala Glu Leu Tyr Ala Val Lys Val Leu Gly Ala Ser Gly Ser Gly Ser Val' Ser Ser Ile Ala Gln Gly Leu Glu Trp A1a Gly 100 105 110 .
Asn Asn Gly Met His Val Ala Asn Leu Ser Leu Gly Sex Pro Ser Pro Ser Ala Thr Leu Glu Gln Ala Val Asn Ser Ala Thr Ser Arg Gly Val Leu Val Val Ala Ala Ser G1y Asn Ser Gly A1a Gly Ser Ile Ser Tyr 150 155 ' 160 Pro Ala Arg~Tyr Ala Asr_ Ala Met Ala Val Gly Ala Thr Asp Gln Asn Asn Asn Arg Ala Ser Phe Ser ~ln Tyr Gly Ala Gly Leu Asp Ile Val Ala Pro Gly Val Asn Val Gln Ser Thr Tyr Pro Gly Ser Thr Tyr Ala Ser Leu Asn Gly Thr Ser Met Ala Thr Pro His Val Ala Gly Ala Ala Ala Leu Val Lys Gln Lys Asn Pro Ser Trp Ser Asn Val Gln Ile Arg Asn His Leu Lys Asn Thr Ala Thr Ser Leu Gly Ser Thr Asn Leu Tyr Gly Ser Gly Leu Val'Asn Ala Glu-Ala Ala Thr Arg
The foregoing statement that the activity of the protease is not significantly impaired by incubation at temperatures up to 30°C for 15 minutes is understood to mean that in comparison to the original activity of the protease, it retains a residual proteolytic activity of at least 92%
after the incubation.
In another preferred variant, an alkaline bacillus protease from the strain DSM 5466 is used which has an amino-acid sequence which differs from the amino-acid sequence of Fig. 1 by at least one of the amino-acid replacements Q12R, M216Q, N237P or T249R, preferably the amino-acid substitutions.
-4a-~~46~1~~3 N42R/N114R/N115R or N42R/N114R/M216Q. The numerical values in these notations refer to the positions in the amino-acid sequence. The amino acids are identified by the one-letter codes, with the original amino acid preceding the position indicator and the inserted amino acid following the position indicator. These amino-acid replacements can be obtained in a known manner by point mutation in the amino-acid sequence as described, for example, in 'U. S. Patent No. 5,352,603.
These alkaline bacillus proteases show unusually good washing performance under the conditions customary in commercial laundries, such as high pH values, short washing times and high washing temperatures. Commercial laundry processes are typically carried out at temperatures between .
30°C and 70°C and at p~ values above 11.0, particularly at pH values between 11:0 and 13Ø These proteases also show a surprisingly high =esistance to inactivation by the detergent constituents customary in commercial laundry methods. Thus, these alkaline bacillus proteases can advantageously be used according to the invention in commercial large-capacity drum-type washing machines or countercurrent.batch washing machines operating cyclically in response to a timer or continuously., Moreover, it is particularly advantageous =or the alkaline bacillus proteases to be added to the washing solution in the prewash step in so-called multi-solution methods, for example dual wash cycles-composed o='prewash step and clear-wash step.
The prewashing can moreover be carried out under the conditions customary ,in commercial laundry methods, for example at temperatures from 30 to 70°C in a known manner's with the detergent 'ingredier_ts customarily used in this laundering cycle. Wrere the contaminants have a high protein content, for example heavily blood-spotted laundry from hospitals; large kitchens or meat-processing operations, the proteases of the invention optionally can be used very successfully in a prerinse step; which precedes the prewash step; with clear cold or recycled hot water and the other detergent ingredients customary for this purpose.
It is, of course, also possible for these alkaline bacillus proteases to be used according to the invention in all other commercial laundry methods, for example in commercial laundry methods suited to particular types of textiles and soils, such as, for example, in the disinfecting laundering of textiles form the hospital sector.
Compositions for commercial laundry methods may contain at least one alkaline bacillus protease from a) the Bacillus strain DSM 6845 and/or b) the Bacillus strain DSM 5466 with an amino-acid sequence which differs from the amino-acid sequence of Fig.
1 by at least one of the amino-acid substitutions Q12R, N42R, N74R, N114R, N115R, Q135R, M216Q, N237P or T249R.
The compositions may contain an alkaline bacillus protease from the Bacillus strain DSM 6845 which is characterized by the properties described above.
The composition according to the invention preferably contain an alkaline bacillus protease from the strain DSM
5466 with an amino-acid sequence which differs from the amino-acid sequence of Fig. 1 by at least one of the amino-acid substitutions Q12R, M216Q, N237P, T249R, in particular by the amino-acid replacements N42R/N114R/N115R or N42R/N114R/M216Q.
The alkaline bacillus proteases which should preferably be used in the compositions according to the invention are those which have an enzyme activity of 50,000 to 1,000,000 DU per gram of enzyme preparation. As used herein, the term "DU" refers to the enzymatic activity in Delft units, where 1000 DU correspond to the proteolytic activity which, with a volume of 1 ml of a 2% (W/W) strength enzyme solution, gives after breakdown of casein an extinction difference (1 cm path length; 275 nm; determination with blank sample test as reference) of 0.4000. Moreover, these alkaline ~14~0~~
bacillus proteases can be used in the formulations customary for commercial laundry methods either individually or in combination with one another, and optionally also in combination with conventional detergent proteases or other detergent enzymes customary in commercial laundry formulations, such as, for example, amylases, lipases, pectinases, nucleases, oxidoreductases etc. In the detergent formulations according to the invention, the content of these bacillus proteases should preferably be O.Z
to 5o by weight, in particular 0.2 to 2.0% by weight, with ..
respect to the dry matter of the overall composition.
The compositions according to the invention may take the form of complete heavy duty detergents, individual , detergents, and/or prewash or prerinse compositions, which are conventional for commercial laundry methods. It is moreover possible, depending on the type of detergent, for all the detergent ingredients customary in the state of the art, such as surfactants, bleaches, builders, laundry aids, optical brighteners and other customary components such as, for example, sodium carbonate, metasilicate., orthophosphate or sodium triphosphate, to be present in customary amounts.
Other examples of possible detergent ingredients include boosters, enzyme stabilizers, soil suspending agents and/or compatibilizers, complexing and chelating agents, foam regulators and additives such as corrosion inhibitors, anti-static agents, perfumes, disinfectants, bleach activators, peraeid bleach precursors and anti-greying agents.
The detergent compositions according to the invention are. preferably prewash compositions as are used in commercial laundry'methods in the temperature range from a to 70C in so-called multi-solution methods, for example in dual wash cycles comprising a prewash step and a clear-wash step. In addition to these alkaline bacillus proteases, the prewash compositions according to the invention can contain all ingredients customary for this purpose in the commercial sector, such as, for example, nonionic surfactants, phosphates, carbonates, silicates, and if desired perborates _ 7 _ ~1~5~~~
and/or bleach activators, anti-greying agents, polycarboxylates, optical br_ighteners and, optionally further buffer substances and auxiliaries. It is also possible to use commercially obtainable detergent formulations to which the alkaline bacillus proteases of the invention have been added in the stated amounts. If desired, these commercially obtainable formulations may also contain oxygen-based bleaches. Examples of suitable commercially available detergent formulations for the commercial sector include the products sold under the designations TEN-COLORS or TENAX CONC.TT''.
The detergent compositions according to the invention can be formulated in a known manner in powder form, for example in the form of granules, prills or pellets, and if desired also p=ovidea with surface coatings. Because of their good stability, the bacillus proteases of the invention can also be used in liquid formulations.
Under the cor_ditions customary in commercial laundry methods, such as highly alkalins poi values, for example pH
values above 1_.O, ar_d high washing temperatures of up to 70°C, the alkalise aacillus aroteases of the invention exhibit surprising-y good washing properties. This is all the more surprising since, in cor...~arison to conventional household washing machines, the countercurrent laundry systems used in commercial laundries often operate completely continuously, which usually means that only relatively short wash_ng times are available. Besides high temperature reuistance, the alkaline bacillus proteases of _ the present inver_ticn additionally exhibit high enzyme stability it t~e presence of the customary ingredients of commercial detergents, When used in accordance with the invention, these alkali bacillus proteases are also stable with respect ~o the bleaches customarily used in the commercial sector, for example, in commercial disinfecting detergents for tk~e hospital sector, in particular with respect to oxycan bleach concentrates, for erample based on perborate or hydrogen peroxide.
_ g _ The following Examples are intended to illustrate the invention in further detail without restricting its scope.
Brief Description of the Drawinas The invention will be described in further detail hereinafter with reference to the accompanying drawings in which:
Figure 1 is a listing of the amino-acid sequence (SEQ
ID NO1) of the alkaline protease from Bacillus alcalophilus HA1 (DSM 5466).
Figure 2 is graph of the temperature optimum of the protease from Bacillus sp. MFI2 (DSM 6845).
Figure 3 is a graph showing the temperature stability of the protease from Bacillus sp. MF12 (DSM 6845).
Figure 4 is a graph showing the pH 'optimum of the protease from Bac?llus sp. MFI2 (DSM 6845).
Figure 5 is a graph showing the pH stability of the protease from Bac_llus sp. MF12 (DSM 6845).
Examples The sequencing of the amino-acid sequence, shown in Fig. 1, of the alkaline protease from Bacillus alcalophilus HA1 (DSM 5466) via determination of the correspcnding nucleotide sequence is described W Examples 1 to 4 ir_ U.S.
Patent No. 5,352,603, The bacterial strain named Bacillus sp. MF12 strain was deposited at the Deutsche Sammlung von Mikroorganismen (DSM) on December 16, 1991 under the number DSM 6845. The Bacillus alcalophilus strain named Bacillus al calophilus HA1 was deposited at the Deutsche Sammlung von Mikroorganismen (DSM) on July 28, 1989 under the number DSM 5466.
Example 1: Preparation of alkaline proteases modified by mutations in the amino-acid sequence.
The preparation of alkaline proteases which differ from the amino-acid sequence shown in Fig. 1, of the alkaline protease from Bacillus alcalophilus HA1 (DSM 5466) by at least one of the amino-acid substitutions Q12R, N42R;' N74R, N114R, N115R, Q135R, M216Q, N237P or T249R was carried out in a known manner by directed mutagenesis in partial DNA
sequences of the corresponding protease gene. The nufi~erical values in this notation system refer to the corresponding amino-acid position in the amino-acid sequence shown in Fig.
1, with the position indicator being preceded by the one letter code for the original amino acid and followed by the l0 one letter code for the inserted amino acid. The method of directed mutagenesis for the aforementioned mutations is described in detail in Hxamples 5 to 18 of U.S. Patent No.
5,352,603. With regard to the amino-acid replacements in positions 42, 114, 216 and 249, additional reference may also be made to p~.zblishe~ German Patent Application No.
DE 4 , 304 , 16 3 [corresponding to published Canadian Patent "
Application 2,115,465).
In principle, the method comprised the following known method steps : Chrorr~osomal DNA was isolated from the natural isolate Bacillus alcalophilus HAl (DSM 5466) by the method of Saito et al. [Biochim. Biophys. Acta 72:619-629 (1963)]
and was partially hycrolyzed with the restriction endonuclease Sau3A. The restriction fragments were fractionated by electrophoresis, and the fragments with a size of 3 to 8 kilobases (kb7 were isolated. The isolated and size-selected DNA fragments from Bacillus alcalophilus ' HA1 were recombined in vitro in a known manner with vector DNA of the known plasmid pUB 110. Protoplasts of the strain Bacillus subtilis BD224 (Bacillus Genetic Stock Center 1A46) '~
were transformed with the resulting in vitro recombinant DNA
by the method described by S. Chang and N. Cohen [Mol. Gen.
Genet. 168:111-115 (1979)]. The transformants were selected on plates with neomycin. The plasmid DNA was isolated from a clone as described in Maniatis et al. [Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory (1982)].
The fragment, contained in this plasmid, from the B. alcalo-philus DNA had a size of c.1 kb and contained the complete ~14~~1 ~~
DNA sequence fox the highly alkaline protease from Bacillus al calophilus HA:L (DSM 5466) (compare Examples 1 and ..-2 of U.S. 5,352,603).
The plasmid containing the complete DNA sequence for the highly alkaline protease from Bacillus alcalophilus HA1 (DSM 5466) was restricted with AvaI. The protruding ends were filled in in a known manner (see Maniatis et al. , p.
114) to give the DNA double strand. After subsequent restriction of this DNA with ~baI, the N-terminal fragmentv comprising 1618 base pairs (bp) was isolated and cloned into ~~
the vector pBS in a known manner. The resulting vector contained the N-terminal end of the DNA coding for the amino-acid sequence depicted in Fig. 1 (compare Example 5 of U.S. 5,352,603) .
A vector which contained a DNA fragment comprising 658 by and coding for the C-terminal end of the corresponding protease was produced in an analogous manner: For this purpose, the plasmid containing the complete DNA sequence was cut with the restriction endonucleases XbaI and Asp718 and cloned into the appropriate cleavage site of the known vector pBS (compare Example 7 of U.S: 5,352,603).
The directed mutations were carried' out in the DNA
partial sequences containing the C-terminal or the N-terminal end by the pr?mer extension technique described by Kunkel, T. A: (Proe. Natl. Acad. Sci. USA 82:488-492 (1985)]. For this purpose, the apprcpriate vectors were first converted in a known manner ir_t:o their uracilated single-stranded analogues by cultivating E: coli CJ236 bacteria -which had' been transformed w ith one ' of the two -vectors and'which wereadditionally'?ofected with the helper phage M13 K07 (purchased from Bio-Rad Laboratories, Richmond; California). The bacterium E. coli CJ236 is a known uracil N-glycosylase-deficient mutant which on replication of the vectors incorporGtes the nucleotide uracil in place of thymidine into the DNA sequence of the vector. Uracilated vectors can be advantageously used in a known manner for in vitro reactions of 3irected mutagenesis ~\
because, after termination of the reactions, the uracil-containing DNA single strand wk~ich was used as template to generate mutated DNA strands can be eliminated by treatment with uracil N-glycosylase. The use of these helper phages was necessary for the synthesis of the coat proteins for the resulting uracilated single-stranded vector. DNA. Coated uracilated single-stranded vector DNA was secreted from the transformed host organism E. coli CJ236 and subsequently.
isolated from the culture medium. ~~
The isolated, uracilated DNA single strand, vectors of the respective C-terminal or N-terminal end were hybridized with synthetic oligonucleotides which contained a mutation .
site and were simultaneously used as primers for the subsequent completion to the complete DNA double strand with mutation. The synthetic oligonucleotides used in this case were prepared in a known manner by the method of Beaucage, S. L, and Caruthers, M. H. [Tetrahedron Letters 22:1859-52 (1981)1. The second DNA strand was synthesized in a known manner using T4 DNA polymerase and subsequent ligation with T4 DNA ligase [Kunkel et al., Methods in Enzymol. 154:367-82 (1987)]. The resulting double-stranded vector DNA was transformed into E. cali MC 1061, and the mutated vectors were identified by checking the appropriate unicrae restriction_ endonuclease recognition sites which had been introduced or deleted with the synthetic oligonucleotides.
To produce, for example, two mutations either in the N-terminal or in the C-terminal part of the protease DNA, the first mutation was produced as'described above and then the method was repeated in an analogous manner using another , synthetic oligonucleotide to introduce a second mutation.
Expression vectors with mutations in the C-terminal part or N-terminal part of the protease DNA sequence were prepared by cutting the DNA sequences obtained by the directed mutagenesis with restriction endonucleases and ligating them to vector DNA which contained the corresponding other terminal part of the DNA sequence and 21~~O~a all the elements necessary for expression. The resrzlting vectors represented complete expression vectors with a suitable reading frame for expressing the appropriately mutated mutase. The preparation of the expression vectors is described in detail in Example 16 of U.S. Patent No.
5,352,603. Expression vectors were prepared for the following mutations:
DSM 5466 Mut. N114R/M216Q -DSM 5466 Mut. N115R/Q135R
to DSM 5466 Mut. N42R/N114R/M216Q
DSM 5466 Mut. N42R/N114Q/N115Q
DSM 5466 Matt: N114R/N237P
DSM 5466 Mut. N42R/N114R
DSM 5466 Mut. Q12R/N42R/N114R
DSM 5466 Mut. N114R/N237P/T249R
DSM 5466 Mut. Q12R/N42R/N114R
The mutated highly alkaline proteases were obtained by transforming B. subtilis BD 224 with a respective one of the aforementioned expression vectors in a known manner. The mutated highly alkaline proteases were isolated by known methods from the culaure supernatants from these transformed strains. Detailed information on the isolation of the mutated proteases is found in Examples 16 and 18 of U.S.
Patent No. 5352,603.
The alkaline proteases obtained by mutating the amino acid sequence of the protease from Bacillus al caloph.ilus HA1 (DSM 5466) were used in washing tests described in Example ,Example 2: Isolation of an alkaline protease from Bacillus sp. MF12 DSM 6845.
50 ml of- Luria broth pH 9.5 (10 g of, yeast extract, 5 g of Tryptone, 5 g of NaCl and 50 ml of carbonate buffer ad 1000 ml of double-distilled water) in a 500 ml Erlenmeyer flask with 3 baffles were inoculated with a single colony of the strain Bacillus sp. MF12 DSM 6845 (grown on PBA agar plates) and incubated at 37°C and 240 rpm for 16 -hours.
50 ml of main culture medium (soya 2%; starch 50; corn steep liquor l%, carbonate buffer 50 ml (Na2CQ3 4.2%)) in a 500 ml Erlenmeyer flask with 3 baffles were inoculated with 2.5 ml of this culture and incubated at 37°C and 240 rpm for 48 hours.
The activity of the protease was determined in Delft units (DU). 1000 DU is the proteolytic activity which, with.
a volume of 1 ml of a 2% (w/w) strength enzyme solution, gives after breakdown of casein an extinction difference (1 cm path length; 275 nm; determination with blank sample test as reference) of 0.4000.
The proteolytic activity in the culture supernatant obtained by centrifugation at 27,000 x g for l5 minutes was 5000 DU/ml after 48 hours.
The temperature optimum of the proteases contained in the culture supernatants was determined in the range from 40 to 72°C. The results are shown in Table l and in Figure 2.
The temperature optimum of the protease from Bacillus sp. MF12 DSM 6845 is at 64°C.
Table 1 Temperature optimum of the alkaline protease from Bacillus sp: MF12 DSM 6845 % Activity as a function of the temperature in °C
40°C 50°C 55°C 60°C 64°C 72°C
180 370 530 740 100% 760 To determine the temperature stability, the protease-containing supernatant was incubated at various temperatures for 15 minutes and subsequently the remaining activity was determined. The results are shown in Table 2 arid in Fig. 3.
i\
The protease from Baczllus sp. MF12 DSM 6845 is stable up to 31°C (remaining activity > 90%) and still shows a remaining activity of 58% after incubation at 50°C for 15 minutes. ' Table 2 Temperature Remaining proteolytic activity in (C] after incubation at various , temperatures for 15 minutes 31. 92 40 '79 To determine the pH
optimum of the protease from Bacillus sp.
DSM
6845, the activity was determined at various pH
values.
The pH
was adjusted with phosphate buffer (0.1 M) in the pH
range 5.0 to 7.0, with tris-HC1 buffer (0.1 M) in the pH
range 7.0 to 9.0, and with glycine-NaOH
buffer (0:1 M) in the pH
range 9:0 to 13Ø
The activity values determined are shown in Fig.
4.
The pH
optimum of the alkaline protease from Bacillus sp.
DSM
is around pH
12, The activity is still ,greater than 90%
at pH
13.
To investigate the pH
stability, the protease from Bacillus sp.
DSM
was incubated in buffers having ,various pH
values at for hours.
The remaining activity of the proteases was then determined.
Phosphate 30' buffer (0.1 M) was used for the pH
range from to 7.1, tris-HC1 buffer (tris(hydroxymethyl)aminomethane buffer) (0.1 M) was used for the pH
range from 7.5 to 9, and glycine/sodium hydroxide buffer (0.1 M) was used for the pH
range from to 12.1.
The result is shown in Fig.
5.
X146(16 The alkaline protease from Bacillus sp. MF~2 DSM 6845 still has a minimum of 70% activity remaining after the 24-hour incubation in the entire pH range, and is completely stable around pH 11.
Example 3: Washing tests under conditions customary in commercial laundry methods.
Washing tests were carried out with soiled test fabric under conditions customary in commercial methods. The test' fabrics used were a polyester/cotton blend fabric purchased from the eidgenossische Materialpru.fungsanstalt, St . Gallen, Switzerland (EMPA117) soiled with blood, milk and India ink, a polyester/cotton blend fabric of our own manufacture (EY-PC) soiled with egg yolk and India ink, and a polyester/cotton blend fabric of our own manufacture (M-PC) soiled with milk and India ink. Washing was carried out in Zelltex Polycolor laboratory washing machines using as basic detergent formulations the prewash compositions which are customary in the commercial sector and are obtainable under ..
the proprietary names TEN COLOR' and TENAX CO\C.T"
(manufactured by J: P. Haas, Steinau, Germany). Washinc was carried out in the temperature range from 15C to 60C for 45 minutes (temperature increased from l5C to 60C at a rate of 2C/min. and then maintained at 60C for 22.5 ;-in) or in the temperature range from l5C to 65C for 25 mir~utes (temperature increased from 15C to 65C' at a rate of 5C/min. and then maintained at 65C for l5 min). The water hardness was l5 German hardness; the enzyme concentration was 0.71 mg of pure protease per liter of washing solut_on.
T:~e test fabric was exposed to the enzyme-containing detergent solution in a; rotating sample vessel chamber wi~.ich was controlled by a water bath in accordance with the t=mperature program. After the vaashing process the test fabric was rinsed twice with deionized water and then ironed.
The washing performance of the proteases was determined by measuring the reflectance of the washed test fabric using ~~~~~e~
a reflectance photometer. The reflectance of the test fabric washed only with the basic detergent formulation was likewise measured. The difference between these two reflectance values is called the DR value and is a measure of the washing performance of the particular protease. For comparison with proteases heretofore used in detergent formulations for commercial laundry systems, all the washing tests were likewise carried out under identical conditions with the protease which is commercially available under the proprietary name Opticlean'~''.
Table 3 shows the washing pe=formances of the proteases used according to the invention with a bleach-tree detergent formulation for commercial laundry methods commercially available under the proprietary name TENAX CONC.='"' Table 3 Washing performance of proteas~s used according to the invention on test fabric EMPA117 asing a bleach-free prewash formulation for commercial laund-_y methods.
Washing conditions: 15-60°C (2°C/min, kept at 60°C
for 22.5 min), wash time 45 min, pH 11.5 Enzvme-dosage: 0.71 mg/1 EMPA117EY-PC hi-PC Total Protease 0R with egg wits ~R
yolk milk' c~R ~R
Opticlean~'t' 13.43 3.41 4.21 21:05 100%
DSM5466 Mut. 12.07 6.15 4.97 23.19 110%
DSM5466 Mut. 14.12' 3.38 5.77 23.27 111%
3 0 DSM5466 Mut. 13.14 6. B1 7.66 27.61 131%
DSM5466 Mut. 13.92 8.01 5.22 28.15 134%
MF12 DSM 6845 17.31 9.32 5.27 31.90 152%
_ 17 _ Table 4 shows the washing performance of the proteases used according to the invention with-a detergent formulation for commercial laundry methods.commercially available under the proprietary name TEN-COLOR'"' which contains oxpgen-based bleach (perborate) .
'Table 4 Washing performance of proteases according to the invention.
used on test fabric EMPA117 using a detergent formulation for commercial textile laundry methods with bleach.
Washing conditions: 15-60°C (2°C/min, kept at 60°C for 22.5 min), wash time 45 min, pH 11.5 Enzyme dosage: 0.71 mg/1 EMPAlI7EY-PC . Total 1 5 Protease D3 with egg DR
yolk Opticlean~" 12.35' 5.09 17.44 100%
DSM 5466 tdut.12.92 5.55 18.47 106%
N114R/N237P, DSM 5466 Mut. 13.49 5.12 18.61 107%
DSM 5466 Mut. 13.65 5.04 18.70 107%
DSM 5466 Mut. 14.32 4.69 19.01 109%
N114T_2/N237P/T249R
2 5 DSM 5466 Mut. 11:65 7.40 19.06 109%
' t~5216Q
DSM 5466 Mut. 18.44 6.7 25.14 144%
MF12 DSM 6845 13.15 7.72 20.88 120%
The reflectance high values of the proteases used according to the 'invention demonstrate their high washing performance protein-soiled the on fabric conditions under customary in commercial laundry methods (high alkaline pH
35 values, high kept temperatures at for long times).
_ 1g . ~ ~~~sos~
In addition to the tests of washing efficiency on the test fabric EMPA117, washing tests were also carried out with the test fabric EY-PC soiled with egg yolk/Tndia ink and with the test fabric M-PC soiled with milk/Tndia ink.
The washing test conditions also were made more severe in that the heating rate was increased to 5°C/min and the wash:
solution was then maintained at a temperature of 65°C for min. The bleach-containing detergent formulation TEN-.-COLORT" for commercial laundry methods was likewise used in 10 these washing tests. Table 9 shows the results obtained in these tests.
Table 5 Washir_g performance of proteases according to the invention 15 used on test fabrics EMPA117, EY-PC and M-PC with a bleach containing commercial,laundry detergent formulation.
Washir_a conditions:
(5C/min, kept at for min), washing time min Enzyme dosage ;
:
rrig/1 2 0 EMPA117EY-PC M-PC' Total Protease DR ~R DR aR
ppticiean~'' 9.10 3.46 1.82 14'.38100%
DSM 5456 Mut.-14.84 ' S.13 2.85' 22:82 159%
N42R/\114R/N115R
25 DSM S~'6 Mut.9:10 6.48 4.56' 20..14140%
MF12 T'SM 9:51 7:33 3.45 20:29 141% ..
t can be seen from Tables 'thraugh that the .; 30 ~proteGses used according to the invention exhibit very good washing performance on various types of fabric soiled with different protein contaminants:
Moreover;
there is virtually no detectable impairment, of the enzyme stability by the highly alkaline medium of the washing solution, by the nigh washing temperature and/or by the bleach.
~~~sss~
Furthermore, exceptionally good washing performance is obtained with a short washing time of only 25 min. These results show the particularly high suitability of the proteases of the present invention for use in commercial laundry methods.
The foregoing description and examples.have been set forth merely to illustrate the invention and are not intended to be limiting. Since modifications of the.
disclosed embodiments incorporating the spirit and substance '~
of the invention may occur to persons skilled in the art, the invention should be construed to include everything within the scope of the appended claims and equivalents thereof.
21~60~e~
SEQUENCE LISTING
(1) GENERAL INFORMATION:
(i) APPLICANT: Amory, Antoine Clippe, Andre ..
Konieczny-Janda, Gerhard (ii) TITLE OF INVENTION: USE OF ALKALINE PROTEASE$ IN
COMMERCIAL LAUNDRY METHODS
(iii) NUMBER OF SEQUENCES: 2 (iv) CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: Evenson; McKeown, Edwards & Lenahan (B) STREET: Suite 700, r200 G Street; N.W.
(C) CITY: Washington (D) STATE: Washington, D.C.
(E) COUNTRY: USA
(F) ZIP: 20005 (v) 'COMPUTER READABLE FORM:
(A) MEDIUM TYPE: Floppy d-sk (B) COMPUTER: IBM PC compatible (C) OPERATING SYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: PatentIn Re?ease #1.0, Version #1.25 (EPO) (vii) PRIOR APPLICATION DATA:
(A) APPLICATION NUMBER:: DE 4411223.8 (B) FILING DATE: 31-MAR-199 (viii) ATTORNEY/AGENT INFORMATION:
(A) NAME Evans, J.D.
(B) REGISTRATION NUMBER: 26,269 (C) REFERENCE/DOCKET NUMB~R: 183/42062' (ix) TELECOMMUNICATION INFORMAT_ON:
(A) Telephone: (202) 628-8800 (B) Telefax: (202) 628-8344 (C) TELEX: 6731278 (2) INFORMATION FOR SEQ ID NO: 1:
'(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH.~ 2280 base pairs (By TYPE: nucleic'acid (C) ,STRANDEL7NESS: ;si.ngle (D) TOPOLOGY: linear ~(ii) MOLECULE TYKE: DNA (genomic) '(iii) HYPOTHETICAL: NO,' (iii) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Bacillus alcalophilus (B) STRAIDT: HA1, DSM 5466 2~~~f~~
(viii) POSITION IN GENUME:
(B) MAP POSITION: 1192 to 1998 mature peptide (C) UNITS: by (ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 859..1998 --(ix) FEATURE:
(A) NAME/KEY: mat~eptide (B) LOCATION: 1192..1998 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 1:
GTGAAAGACG
AAGC-GCTTGA
ATCTGTTCAT
TTATTTAP_~1C P.ACCATGCCC ATGTCCACAC ACAGCGTGCT GAGGAGGACG GCTGGCATAT 360 CGTTGCCGAT TTGCATGPAC GAG=_CTTAAA 420 ACGGGTTGAA AGCTACTGTG TTTCAAAAGA
TAGACAGATG P~CACTTGTT TCGCTGTTTT ACGACAAAGA TCATCTTGCC TGTTACGCGT540 TTTT2'AAATC CGTTTTCGCA CGT~CAATTGTCGCCGAGTC GTACCAGTCG CTGTAAGTGA600 GAATATGTTT AGAAAGCCGC GTA'=TTA~1GCGCAGTCTTTT TCGTTCTGTA CTGGCTGGTT660 TGTC-~ACAGT TTCCATACCC ATC_~1CCTCCTTTTATTTGT AGCTTTCCCC ACTTGAAACC720 GTTTTAATCA AAAACGA.GT GAG_'-_~GATTC'AGTTAACTTA ACGTTAATAT TTGTTTCCCA780 ATAG~vCAAn.T CTTTCTA~CT TTGATACGTTTAAACTACCA GCTTGGACAA GTTGGTATAA840 P~1ATGAGGAG GGAACCGA ATG AAG'AAA CCG TTG GGG AAA ATT GTC 891 GCA AGC
Met Lys Lys; Pro Leu Gly Lys Ile Val Ala Ser 'ACC GCA CTA CTC ATT TCT G~T GCT TTT AGT TCA TCG ATC GCA 939 TCG GCT .
'Thr Ala Leu Leu Ile Ser Val Ala Phe Ser Ser Ser Ile Ala Ser Ala -100 -95 -90 -g5 GCT GAA GAA GCA AA'i GAA A~=.A TTA ATT GGC TTT AAT GAG 987 TAT CAG GAA
Ala Glu Glu Ala Lys Glu Lys Tyr' Leu Ile Gly Phe Asn Glu Gln Glu -80 -75 -7p GCT GTC AGT GAG TTT GTA GA.A CAA GTA GAG GCA AAT GAC GAG 1035 GTC GCC
Ala Val Ser Glu Phe Val Glu Gln Val Glu Ala Asn Asp Glu Val Ala ATT CTC TCT GAG GAS GAG G_~A GTC GAA ATT GAA TTG CTT CAT 1083 GAA TTT
_1e Leu Ser Glu Glu Glu Glu Val Glu Ile Glu Leu Leu His Glu Phe 214b~1~fi Glu Thr Ile Pro Val Leu Ser Val Glu Leu Ser Pro Glu Asp Val Asp Ala Leu Glu Leu Asp Pro Ala Ile Ser Tyr Ile Glu Glu Asp A1a Glu Val Thr Thr Met Ala Gln Ser Val Pro Trp Gly Ile Ser Arg Val Gln A1a Pro Ala Ala His Asn Arg Gly Leu Thr G1y Ser Gly Val Lys Va1 ATT CGT
Ala Val Leu Asp Thr Gly Ile Ser Thr His Pro Asp Leu Asn Ile Arg GGT,GGC GCT AGC TTT GTA CCA GGG GAA CCA TCC ACT CAA GAT 1371 GGG AAT
Gly Gly Ala Ser Phe Val Pro Gly Glu Pro Ser Thr Gln Asp Gly Asn 45 50 55. 60 AAT TCG
Gly His Gly Thr His Val Ala Gly Thr Ile Ala Ala Leu Asn Asn Ser 65 7p 75 GTT AAA
Ile Gly Val Leu Gly Val.Ala Pro Ser Ala Glu Leu Tyr Ala Val Lys GTA.TTA GGG GCG AGC GGT TCA GGT TCG GTC AGC TCG ATT GCC 1515 CAA GGA
Val Leu Gly Ala Ser Gly Ser Gly Ser Val Ser her Ile Ala Gln Gly 95 100 ' 105 TTG GAA TGG GCA GGG AAC AAT GGC ATG CAC GTT'GCT AAT TTG 1563 AGT TTA
Leu Glu Trp Ala Gly Asn Asn Gly Met'His Val'Ala Asn Leu Ser Leu 110' 115 12 0 GGA AGC'CCT TCG CCA AGT GCC ACA CTT GAG CAA GCT GTT AAT 1611 AGC GCG
Gly Ser Pro Ser Pro Ser Ala Thr Leu Glu Gln Ala Val ASn Ser Ala 125 130 135 ' 140 ACT TCT AGA GGC GTT CTT GTT GTA GCG GCA TCT'GGG AAT TCA 1659 GGT GCA
Thr Ser Arg Gly Val Leu. Val Val Ala Ala Ser Gly Asn Ser Gly Ala GGC TCA ATC AGC TAT CCG GCC CGT TAT GCG AAC GCA ATG GCA' 1707 GTC GGA
Gly Ser Ile Ser 2'yr Pro Ala Arg T'yr Ala Asn Ala Met Ala Val G1y 160 '165 1.70.
GGC GCA
AIa Thr Asp Gln Asn Asn Asn Arg'Ala Ser Phe Ser Gln Tyr Gly Ala TAC CCA
Gly Leu Asg Ile Val Ala Pro Gly Val Asn Val G1n Ser Thr Tyr Pra CCT CAT
Gly Ser Thr Tyr Ala Ser Leu Asn Gly Thr Ser Met Ala Thr Pro His 214~~fi;:~
Val Ala Gly Ala Ala Ala Leu Val Lys Gln Lys Asn Pro Ser Trp Ser Asn Val GIn Ile Arg Asn His Leu Lys Asn Thr AIa Thr Ser Leu GIy Ser Thr Asn Leu Tyr Gly Ser Gly Leu Val Asn Ala Glu Ala Ala Thr Arg AAAAGAGAAC GGGCTGTTTA
AGATCGCAGG
CGCTCGCAGG CTTTTGACTT
TCTTATCGCT
TTTATTTAAG TTCTG
TATTCGTTTG
TT
(2) INFORMATTON FOR SEQ :
ID N0: 2 (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 380 amino acids (B) TYPE: amino- acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE:
protein (xi) SEQUENCE DESCRIPTION:EQ
S ID
NO:
2:
Met Lys Lys Pro Leu Gly Val SerThr LeuLeu Ile Lys Ile Ala Ala Ser Val Ala Phe Ser Ser Ala AlaAla GluAla Lys Ser Ile Ser Glu -95 -90 - _g5 .80 Glu Lys Tyr Leu Ile Gly Glu GluAla SexGlu Phe Phe Asn Gln Val Val Glu Gln Va1 Glu Ala Glu AlaIle SerGlu Glu Asn ASp Va1 Leu -60 -55 -50 .
Glu Glu Val Glu Ile Glu His PheGlu IlePro Val Leu Leu Glu Thr _45 -40 _35 Leu Ser Val Glu Leu Ser ASp AspAla GluLeu Asp Pro Glu Val Leu Pro Ala Ile Ser Tyr Ile Asp GluVal ThrMet Ala - Glu Glu Ala Thr _15 _10 _5 1 Gln Ser Val Pro Trp Gly Arg GlnAla AlaAla His Ile Ser Val Pro Asn Arg Gly Leu Thr Gly Val ValAla LeuAsp Thr Ser Gly Lys Val ~~~~~il Gly Ile Ser Thr His Pro Asp Leu Asn Ile Arg Gly Gly Ala Ser Phe r Val Pro Gly Glu Pro Ser Thr Gln Asp Gly Asn Gly His G1y Thr His Val Ala Gly Thr Ile Ala Ala Leu Asn Asn Ser Ile Gly Val Leu Gly Val Ala Pro Ser Ala Glu Leu Tyr Ala Val Lys Val Leu Gly Ala Ser Gly Ser Gly Ser Val' Ser Ser Ile Ala Gln Gly Leu Glu Trp A1a Gly 100 105 110 .
Asn Asn Gly Met His Val Ala Asn Leu Ser Leu Gly Sex Pro Ser Pro Ser Ala Thr Leu Glu Gln Ala Val Asn Ser Ala Thr Ser Arg Gly Val Leu Val Val Ala Ala Ser G1y Asn Ser Gly A1a Gly Ser Ile Ser Tyr 150 155 ' 160 Pro Ala Arg~Tyr Ala Asr_ Ala Met Ala Val Gly Ala Thr Asp Gln Asn Asn Asn Arg Ala Ser Phe Ser ~ln Tyr Gly Ala Gly Leu Asp Ile Val Ala Pro Gly Val Asn Val Gln Ser Thr Tyr Pro Gly Ser Thr Tyr Ala Ser Leu Asn Gly Thr Ser Met Ala Thr Pro His Val Ala Gly Ala Ala Ala Leu Val Lys Gln Lys Asn Pro Ser Trp Ser Asn Val Gln Ile Arg Asn His Leu Lys Asn Thr Ala Thr Ser Leu Gly Ser Thr Asn Leu Tyr Gly Ser Gly Leu Val'Asn Ala Glu-Ala Ala Thr Arg
Claims (10)
1. A method of laundering a soiled textile comprising washing said textile under laundry conditions in the presence of a detergent formulation comprising at least one detergent ingredient and an alkaline protease obtained from Bacillus alcalophilus HA1 (DSM 5466) and having an amino-acid sequence which differs from the amino-acid sequence of SEQ ID No:1 by at least one amino-acid replacement selected from the group consisting of Q12R, N74R, M216Q, N237P, and T249R.
2. A method according to claim 1, wherein said amino-acid replacement comprises N42R/N114R/M216Q.
3. A method according to claim 1, wherein said amino-acid replacement comprises Q12R/N42R/N114R.
4. A method according to claim 1, wherein said amino-acid replacement comprises M216Q.
5. A detergent composition for laundry methods comprising at least one detergent ingredient and a bacillus protease obtained from Bacillus alcalophilus HA1 (DSM 5466) having an amino-acid sequence which differs from the amino-acid sequence of SEQ ID No: 1 by at least one amino-acid substitution selected from the group consisting of Q12R, N74R, M216Q, N237P and T249R.
6. A composition according to claim 5, wherein said protease has an activity of from 50,000 to 1,000,000 DU per gram.
7. A composition according to claim 5 or 6, comprising from 0.1 to 5.0 wt-% of said protease.
8. A composition according to claim 5, wherein said amino-acid replacement comprises N42R/N114R/M216Q.
9. A composition according to claim 5, wherein said amino-acid replacement comprises Q12R/N42R/N114R.
10. A composition according to claim 5, wherein said amino-acid replacement comprises M216Q.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| DEP4411223.8 | 1994-03-31 | ||
| DE4411223A DE4411223A1 (en) | 1994-03-31 | 1994-03-31 | Use of alkaline proteases in commercial textile washing processes |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CA2146063A1 CA2146063A1 (en) | 1995-10-01 |
| CA2146063C true CA2146063C (en) | 2006-03-21 |
Family
ID=6514333
Family Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CA002186764A Expired - Lifetime CA2186764C (en) | 1994-03-31 | 1995-03-27 | High-alkaline protease and its use |
| CA002146063A Expired - Lifetime CA2146063C (en) | 1994-03-31 | 1995-03-31 | Use of alkaline proteases in industrial textile washing processes |
Family Applications Before (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CA002186764A Expired - Lifetime CA2186764C (en) | 1994-03-31 | 1995-03-27 | High-alkaline protease and its use |
Country Status (13)
| Country | Link |
|---|---|
| US (3) | US6190904B1 (en) |
| EP (2) | EP0753058B1 (en) |
| JP (2) | JPH10505741A (en) |
| CN (1) | CN1148406A (en) |
| AT (2) | ATE269404T1 (en) |
| AU (2) | AU710223B2 (en) |
| BR (2) | BR9507237A (en) |
| CA (2) | CA2186764C (en) |
| DE (3) | DE4411223A1 (en) |
| DK (2) | DK0753058T3 (en) |
| FI (2) | FI116681B (en) |
| NZ (1) | NZ282821A (en) |
| WO (1) | WO1995027049A1 (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7569226B2 (en) | 2001-12-22 | 2009-08-04 | Henkel Kommanditgesellschaft Auf Aktien (Henkel Kgaa) | Alkaline protease from Bacillus sp. (DSM 14392) and washing and cleaning products comprising said alkaline protease |
Families Citing this family (65)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| DE4411223A1 (en) * | 1994-03-31 | 1995-10-05 | Solvay Enzymes Gmbh & Co Kg | Use of alkaline proteases in commercial textile washing processes |
| DE19535082A1 (en) | 1995-09-21 | 1997-03-27 | Henkel Ecolab Gmbh & Co Ohg | Paste-like detergent and cleaning agent |
| JP4030603B2 (en) * | 1995-11-02 | 2008-01-09 | ノボザイムス アクティーゼルスカブ | Alkaline protease, method for producing the same, use and microorganism producing the protease |
| DE19615776A1 (en) | 1996-04-20 | 1997-10-23 | Henkel Kgaa | Solubility-enhanced enzyme granules |
| DE19636035A1 (en) | 1996-09-05 | 1998-03-12 | Henkel Ecolab Gmbh & Co Ohg | Paste-like detergent and cleaning agent |
| JP2001503269A (en) | 1996-11-04 | 2001-03-13 | ノボ ノルディスク アクティーゼルスカブ | Subtilase variants and compositions |
| BR9712473B1 (en) | 1996-11-04 | 2009-08-11 | subtilase variants and compositions. | |
| ATE371052T1 (en) * | 1996-12-04 | 2007-09-15 | Novozymes North America Inc | ALKALINE ENZYMATIC BOILING OF COTTON TEXTILES |
| DE19703364A1 (en) | 1997-01-30 | 1998-08-06 | Henkel Ecolab Gmbh & Co Ohg | Paste-like detergent and cleaning agent |
| EP1009815B1 (en) | 1997-08-29 | 2008-01-30 | Novozymes A/S | Protease variants and compositions |
| BR9811412A (en) | 1997-08-29 | 2000-08-22 | Novo Nordisk As | Subtilase enzyme variant having improved detergent washing performance, isolated DNA sequence, expression vector, microbial host cell, processes for producing a variant and for identifying a protease variant, composition, and, use of a subtilase variant |
| ES2367505T3 (en) * | 1997-10-23 | 2011-11-04 | Danisco Us Inc. | PROTEASE VARIANTS WITH MULTIPLE SUBSTITUTIONS WITH ALTERED NET LOAD FOR USE IN DETERGENTS. |
| US6773907B2 (en) | 1997-11-21 | 2004-08-10 | Peter Kamp Hansen | Subtilase enzymes |
| US6780629B2 (en) | 1997-11-21 | 2004-08-24 | Novozymes A/S | Subtilase enzymes |
| WO1999027082A1 (en) | 1997-11-21 | 1999-06-03 | Novo Nordisk A/S | Protease variants and compositions |
| DE19857687A1 (en) | 1998-12-15 | 2000-06-21 | Henkel Ecolab Gmbh & Co Ohg | Pasty detergent |
| EP1803817B1 (en) | 1998-12-18 | 2011-04-06 | Novozymes A/S | Subtilase enzymes of the I-S1 and I-S2 sub-groups having an additional amino acid residue in an active site loop region |
| DE19904512A1 (en) | 1999-02-04 | 2000-08-17 | Henkel Ecolab Gmbh & Co Ohg | Method for cleaning refillable bottles |
| EP1183342B2 (en) | 1999-05-20 | 2012-06-13 | Novozymes A/S | Subtilase enzymes of the i-s1 and i-s2 sub-groups having at least one additional amino acid residue between positions 128 and 129 |
| AU4392500A (en) | 1999-05-20 | 2000-12-12 | Novozymes A/S | Subtilase enzymes of the i-s1 and i-s2 sub-groups having at least one additionalamino acid residue between positions 132 and 133 |
| DE60040284D1 (en) | 1999-05-20 | 2008-10-30 | Novozymes As | SUBTILASE ENZYMES OF I-S1 AND I-S2 SUB-GROUPS WITH AT LEAST ONE ADDITIONAL AMINO ACID BETWEEN POSITIONS 129 AND 130 |
| ATE407201T1 (en) | 1999-05-20 | 2008-09-15 | Novozymes As | SUBTILASE ENZYMES OF THE I-S1 AND I-S2 SUBGROUPS WITH AT LEAST ONE ADDITIONAL AMINO ACID RESIDUE BETWEEN POSITIONS 126 AND 127 |
| WO2000071691A1 (en) | 1999-05-20 | 2000-11-30 | Novozymes A/S | Subtilase enzymes of the i-s1 and i-s2 sub-groups having at least one additional amino acid residue between positions 125 and 126 |
| DE60040285D1 (en) | 1999-05-20 | 2008-10-30 | Novozymes As | SUBTILASE ENZYMES OF I-S1 AND I-S2 SUB-GROUPS WITH AT LEAST ONE ADDITIONAL AMINO ACID BETWEEN ITEM 127 AND 128 |
| US6727085B2 (en) | 1999-12-15 | 2004-04-27 | Fanoe Tina Sejersgaard | Subtilase variants having an improved wash performance on egg stains |
| US6777218B1 (en) | 2000-03-14 | 2004-08-17 | Novozymes A/S | Subtilase enzymes having an improved wash performance on egg stains |
| CA2406607C (en) * | 2000-04-26 | 2011-08-02 | Land O'lakes, Inc. | A method of treating soy proteins and a soy protein product produced by this method |
| CN1303210C (en) * | 2000-12-29 | 2007-03-07 | 四川大学 | Detersile proteinase and its production process and usage and microbe producing the said proteinase |
| US7183248B2 (en) * | 2001-08-23 | 2007-02-27 | Treyco Supply Co. | Enzymatic cleaner having high pH stability |
| EP1448836A4 (en) * | 2001-11-02 | 2008-01-02 | Novozymes North America Inc | Modification of printed and dyed materials |
| DE10162727A1 (en) * | 2001-12-20 | 2003-07-10 | Henkel Kgaa | New alkaline protease from Bacillus gibsonii (DSM 14391) and washing and cleaning agents containing this new alkaline protease |
| DE10162728A1 (en) | 2001-12-20 | 2003-07-10 | Henkel Kgaa | New alkaline protease from Bacillus gibsonii (DSM 14393) and washing and cleaning agents containing this new alkaline protease |
| DE10163883A1 (en) * | 2001-12-22 | 2003-07-10 | Henkel Kgaa | New alkaline protease from Bacillus sp. (DSM 14390) and detergents and cleaning agents containing this new alkaline protease |
| EP2341070A3 (en) | 2002-03-29 | 2011-10-19 | Genencor International, Inc. | Ehanced protein expression in bacillus |
| BRPI0313080A2 (en) | 2002-07-30 | 2017-05-23 | Genencor Int | formulations with reduced aerosol generation |
| DE10262050A1 (en) * | 2002-09-05 | 2004-09-23 | Technische Universität Dresden | Genetic variants in the MMP-2 gene as etiological factors of various diseases |
| CN102766545B (en) | 2003-05-07 | 2014-08-06 | 诺维信公司 | Variant subtilisin enzymes (subtilases) |
| EP1678296B1 (en) | 2003-10-23 | 2011-07-13 | Novozymes A/S | Protease with improved stability in detergents |
| CA2562208A1 (en) * | 2004-04-09 | 2006-03-30 | Genencor International, Inc. | Pcka modifications and enhanced protein expression in bacillus |
| US20070010416A1 (en) * | 2004-10-22 | 2007-01-11 | Novozymes A/S | Protease with improved stability in detergents |
| US8137477B2 (en) * | 2005-03-22 | 2012-03-20 | Gumlink A/S | Method of cleaning a surface attached with at least one chewing gum lump |
| EP2013339B1 (en) | 2006-04-20 | 2013-09-11 | Novozymes A/S | Savinase variants having an improved wash performance on egg stains |
| US20080090745A1 (en) * | 2006-10-13 | 2008-04-17 | Fox Bryan P | Expression of Streptomyces subtilism inhibitor (SSI) proteins in Bacillus and Streptomyces sp. |
| AU2008226792B2 (en) | 2007-03-12 | 2013-06-06 | Danisco Us Inc. | Modified proteases |
| DK2147098T3 (en) | 2007-04-30 | 2013-10-14 | Danisco Us Inc | Use of protein hydrolysates for stabilizing metalloprotease detergent formulations |
| DK2460823T3 (en) * | 2007-05-10 | 2014-05-05 | Danisco Us Inc | MODIFIED SECRETION SYSTEM FOR INCREASED EXPRESSION OF POLYPEPTIDES IN BACTERIA |
| CN101903519B (en) | 2007-12-21 | 2013-07-31 | 丹尼斯科美国公司 | Enhanced protein production in bacillus |
| JP5659143B2 (en) * | 2008-03-28 | 2015-01-28 | ダニスコ・ユーエス・インク | A method for amplifying a genetic locus in bacterial cells |
| AR076941A1 (en) | 2009-06-11 | 2011-07-20 | Danisco Us Inc | BACILLUS CEPA FOR A GREATER PROTEIN PRODUCTION |
| DK3095861T3 (en) * | 2010-05-06 | 2019-09-23 | Procter & Gamble | CONSUMER PRODUCTS WITH PROTEASE VARIETIES |
| JP5829844B2 (en) * | 2011-06-24 | 2015-12-09 | 太邦株式会社 | Method for producing water-soluble elastin peptide |
| TWI586629B (en) * | 2012-10-01 | 2017-06-11 | 羅格斯新澤西州立大學 | Precursors and transport methods for hydrothermal liquid phase sintering (hlps) |
| US10179892B2 (en) | 2013-11-11 | 2019-01-15 | Ecolab Usa Inc. | Multiuse, enzymatic detergent and methods of stabilizing a use solution |
| WO2015102814A1 (en) | 2013-12-31 | 2015-07-09 | Danisco Us Inc. | Enhanced protein expression |
| CN107250371B (en) | 2014-12-16 | 2021-11-30 | 丹尼斯科美国公司 | Enhanced protein expression |
| KR20170093247A (en) | 2014-12-19 | 2017-08-14 | 다니스코 유에스 인크. | Enhanced protein expression |
| CA3035451C (en) | 2016-09-07 | 2022-06-28 | Ecolab Usa Inc. | Detergent compositions containing an enzyme stabilized by phosphonates |
| CN110520520B (en) | 2017-02-24 | 2024-03-22 | 丹尼斯科美国公司 | Compositions and methods for increasing protein production in bacillus licheniformis |
| EP3655537A1 (en) | 2017-08-23 | 2020-05-27 | Danisco US Inc. | Methods and compositions for efficient genetic modifications of bacillus licheniformis strains |
| EP3682010A1 (en) | 2017-09-13 | 2020-07-22 | Danisco US Inc. | Modified 5'-untranslated region (utr) sequences for increased protein production in bacillus |
| WO2019089898A1 (en) | 2017-11-02 | 2019-05-09 | Danisco Us Inc | Freezing point depressed solid matrix compositions for melt granulation of enzymes |
| FI3735478T3 (en) | 2018-01-03 | 2023-10-26 | Danisco Us Inc | Mutant and genetically modified bacillus cells and methods thereof for increased protein production |
| KR20220127844A (en) | 2020-01-15 | 2022-09-20 | 다니스코 유에스 인크. | Compositions and methods for enhancing protein production in Bacillus licheniformis |
| CN117881772A (en) | 2021-08-20 | 2024-04-12 | 丹尼斯科美国公司 | Polynucleotides encoding novel nucleases, compositions thereof and methods for eliminating DNA from protein preparations |
| WO2023225459A2 (en) | 2022-05-14 | 2023-11-23 | Novozymes A/S | Compositions and methods for preventing, treating, supressing and/or eliminating phytopathogenic infestations and infections |
Family Cites Families (25)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| GB1234445A (en) * | 1967-10-03 | 1971-06-03 | ||
| US4594362A (en) * | 1983-07-06 | 1986-06-10 | Creative Products Resource Associates, Ltd. | Friable foam textile cleaning stick |
| US4980288A (en) * | 1986-02-12 | 1990-12-25 | Genex Corporation | Subtilisin with increased thermal stability |
| US5324653A (en) * | 1988-02-11 | 1994-06-28 | Gist-Brocades N.V. | Recombinant genetic means for the production of serine protease muteins |
| PT89702B (en) * | 1988-02-11 | 1994-04-29 | Gist Brocades Nv | PROCESS FOR PREPARING NEW PROTEOLITIC ENZYMES AND DETERGENTS THAT CONTAINS THEM |
| US5116741A (en) * | 1988-04-12 | 1992-05-26 | Genex Corporation | Biosynthetic uses of thermostable proteases |
| JPH03505976A (en) * | 1989-05-17 | 1991-12-26 | アムジエン・インコーポレーテツド | Multiple mutant subtilisin |
| US5665587A (en) * | 1989-06-26 | 1997-09-09 | Novo Nordisk A/S | Modified subtilisins and detergent compositions containing same |
| ES2227508T3 (en) * | 1989-06-26 | 2005-04-01 | Unilever N.V. | ENZYMATIC DETERGENT COMPOSITIONS. |
| DE69033388T2 (en) * | 1989-08-25 | 2000-05-11 | Henkel Research Corp | ALKALINE PROTEOLYTIC ENZYME AND METHOD FOR PRODUCING THE SAME |
| DK164074C (en) * | 1989-08-25 | 1992-09-28 | Poul Ole Fanger | METHOD OF ASSESSING AIR POLLUTION AND APPARATUS FOR EXERCISING THE PROCEDURE |
| DE4023458A1 (en) * | 1989-08-31 | 1991-03-07 | Kali Chemie Ag | NEW HIGH ALKALINE PROTEASES |
| US5352603A (en) * | 1989-08-31 | 1994-10-04 | Kali-Chemie Ag | Highly alkaline proteases |
| DK246290D0 (en) * | 1990-10-12 | 1990-10-12 | Novo Nordisk As | NEW ENZYM |
| DE4106525A1 (en) * | 1991-03-01 | 1992-09-10 | Solvay Enzymes Gmbh & Co Kg | METHOD FOR IMPROVING THE STABILITY OF HIGH ALKALINE PROTEASES |
| DK58591D0 (en) * | 1991-04-03 | 1991-04-03 | Novo Nordisk As | HIS UNKNOWN PROTEAS |
| EP0995801A1 (en) * | 1991-07-27 | 2000-04-26 | Genencor International GmbH | Process for increasing the stability of enzymes and stabilized enzymes |
| JPH0763368B2 (en) * | 1991-10-09 | 1995-07-12 | 大阪府 | Heat-resistant alkaline protease and method for producing the same |
| DE69333463D1 (en) * | 1992-05-18 | 2004-05-06 | Genencor Int | Bacteria producing alkaline proteases, and process for producing these alkaline proteases |
| DE4218448A1 (en) * | 1992-06-04 | 1993-12-09 | Solvay Enzymes Gmbh & Co Kg | Alkaline proteases from Bacillus pumilus |
| DE4219104A1 (en) * | 1992-06-11 | 1993-12-16 | Solvay Enzymes Gmbh & Co Kg | Alkaline protease from Bacillus sp. MF12, a process for their preparation and their use |
| AU682314B2 (en) * | 1992-07-17 | 1997-10-02 | Genencor International, Inc. | High alkaline serine proteases |
| DE4304161A1 (en) * | 1993-02-12 | 1994-08-25 | Solvay Enzymes Gmbh & Co Kg | Improved highly alkaline proteases |
| DE4411223A1 (en) * | 1994-03-31 | 1995-10-05 | Solvay Enzymes Gmbh & Co Kg | Use of alkaline proteases in commercial textile washing processes |
| US6599730B1 (en) * | 1994-05-02 | 2003-07-29 | Procter & Gamble Company | Subtilisin 309 variants having decreased adsorption and increased hydrolysis |
-
1994
- 1994-03-31 DE DE4411223A patent/DE4411223A1/en not_active Withdrawn
-
1995
- 1995-03-27 AT AT95913164T patent/ATE269404T1/en not_active IP Right Cessation
- 1995-03-27 EP EP95913164A patent/EP0753058B1/en not_active Expired - Lifetime
- 1995-03-27 DE DE59510341T patent/DE59510341D1/en not_active Expired - Lifetime
- 1995-03-27 EP EP95104454A patent/EP0686692B1/en not_active Expired - Lifetime
- 1995-03-27 DK DK95913164T patent/DK0753058T3/en active
- 1995-03-27 BR BR9507237A patent/BR9507237A/en not_active Application Discontinuation
- 1995-03-27 US US08/716,293 patent/US6190904B1/en not_active Expired - Lifetime
- 1995-03-27 JP JP7525398A patent/JPH10505741A/en active Pending
- 1995-03-27 AU AU20731/95A patent/AU710223B2/en not_active Ceased
- 1995-03-27 DK DK95104454T patent/DK0686692T3/en active
- 1995-03-27 CA CA002186764A patent/CA2186764C/en not_active Expired - Lifetime
- 1995-03-27 WO PCT/EP1995/001141 patent/WO1995027049A1/en active IP Right Grant
- 1995-03-27 CN CN95193076A patent/CN1148406A/en active Pending
- 1995-03-27 DE DE59510914T patent/DE59510914D1/en not_active Expired - Lifetime
- 1995-03-27 AT AT95104454T patent/ATE222947T1/en not_active IP Right Cessation
- 1995-03-27 NZ NZ282821A patent/NZ282821A/en unknown
- 1995-03-29 AU AU16175/95A patent/AU705385B2/en not_active Ceased
- 1995-03-30 FI FI951520A patent/FI116681B/en not_active IP Right Cessation
- 1995-03-31 CA CA002146063A patent/CA2146063C/en not_active Expired - Lifetime
- 1995-03-31 US US08/413,724 patent/US5880080A/en not_active Expired - Lifetime
- 1995-03-31 JP JP7076618A patent/JPH07286194A/en active Pending
- 1995-03-31 BR BR9501401A patent/BR9501401A/en not_active Application Discontinuation
-
1996
- 1996-09-25 FI FI963829A patent/FI120739B/en not_active IP Right Cessation
-
1997
- 1997-05-08 US US08/853,494 patent/US6165960A/en not_active Expired - Lifetime
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7569226B2 (en) | 2001-12-22 | 2009-08-04 | Henkel Kommanditgesellschaft Auf Aktien (Henkel Kgaa) | Alkaline protease from Bacillus sp. (DSM 14392) and washing and cleaning products comprising said alkaline protease |
Also Published As
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CA2146063C (en) | Use of alkaline proteases in industrial textile washing processes | |
| US5453372A (en) | Stabilized enzymes and process for preparing them | |
| EP0396608B1 (en) | Mutated subtilisin genes | |
| KR970005249B1 (en) | Novel proteolytic enzymes and their use in detergents | |
| FI112500B (en) | Mutated subtilisin protease | |
| KR100720594B1 (en) | Protease variants and compositions | |
| US5352603A (en) | Highly alkaline proteases | |
| US6271012B1 (en) | Protease muteins and their use in detergents | |
| EP0416967A1 (en) | Novel alkaline protease | |
| EP0506448A1 (en) | Alpha-lytic protease cleaning compositions | |
| JPH06296487A (en) | Highly alkaline protease, purification of said protease, dna sequence for coding dish washing composition and preparation of highly alkaline protease | |
| JP4050654B6 (en) | Stabilizing enzymes and detergents | |
| JP2003289891A (en) | Stabilized enzyme and detergent |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| EEER | Examination request | ||
| MKEX | Expiry |
Effective date: 20150331 |