CA2478081C - Multiple and multivalent dna vaccines in ovo - Google Patents

Abstract

The present invention provides a multiple DNA vaccine and/or a multivalent DNA
vaccine for use in acquiring embryonic immunity in fowl eggs. The multiple DNA
vaccine contains two or more DNA constructs, each containing a DNA molecule encoding an avian viral protein or a fragment thereof capable of inducing a protective immune response against the avian viral disease in fowl. The multivalent DNA vaccine contains one DNA construct which contains two or more DNA molecules, each representing an avian viral gene or a fragment thereof.
The multivalent DNA vaccine is capable of expressing two or more viral antigens and inducing protective immune responses against the avian viral diseases in fowl.

Description

MULTIPLE AND MULTIVALENT DNA VACCINES IN OVO

FIELD OF THE INVENTION:

The present invention relates to either a muliple DNA vaccine or a multivalent DNA vaccine for use in aquiring embroyonic immunity in fowl eggs and methods for preparing and using the same. The multiple DNA vaccine contains two or more DNA
constructs, each containing a DNA molecule encoding an avian viral protein or a fragment thereof capable of inducing a protective immune response against an avian viral disease in fowl. The multivalent DNA vaccine contains a DNA construct which contains two or more DNA molecules. Each of the DNA molecules represents an avian viral gene or a fragment thereof. The multivalent DNA vaccine is capable of expressing two or more viral antigens and inducing protective immune responses against two or more of the avian viral diseases in fowl. Both the multiple DNA vaccine and the multivalent DNA vaccine are preferred to be injected into the amniotic fluid of the fowl egg after being fertilized for about 18 days.
BACKGROUND OF THE INVENTION:

In ovo vaccination of virus-containing vaccines was extensively described by Sharma et al. (U.S. Pat. No. 4,458,630). In particular, it teaches that live Marek's disease virus can be injected into amniotic fluid within the egg, whereafter the embryo is infected and the vaccine virus replicates to a high titer which induces the formation of protective antibodies in the treated embryo. See Sharma (1985), Avian Diseases 29, 1155, 1167-68).

It is well-known in the worldwide poultry business that certain viral diseases, such as Marek's disease virus (MDV), infectious bursal disease virus (IBDV), Newcastle disease virus (NDV), infectious bronchitis virus (IBV), infectious laryngotracheitis virus (ILTV), avian encephalomyelitis (AEV), chick anemia virus (CAV), Fowlpox virus (FPV), avian influenza virus (AIV), reovirus, avian leukosis virus (ALV), reticuloendotheliosis virus (REV), avian adenovirus and hemorrhagic enteritis virus (HEV), may cause major outbreak and result in significant economic losses in the commercial poultry industry.
Among them, MDV, IBDV, NDV and IBV, are particularly important due to their virulent nature.

Marek's Disease (MD) is a malignant, lymphoproliferative disorder disease that occurs naturally in chickens. The disease is caused by a herpesvirus: Marek's Disease Virus (MDV). MD is ubiquitous, occurring in poultry-producing countries throughout the world.
Chickens raised under intensive production systems will inevitably suffer losses from MD.
The symptoms of MD appear widely in the nerves, genital organs, internal organs, eyes and skin of the infected birds, causing motor trouble (due to paralysis when the nerves have been affected), functional trouble of the internal organs (due to tumors), and chronic undernourishment (if the internal organs are attacked by the virus). MD
affects chickens from about 6 weeks of age, occurring most frequently between ages of 12 and 24 weeks.

At of this time, there are no methods of treating MD. The control of the disease is based primarily on management methods such as insolating growing chickens from sources of infection, the use of genetically resistant stock, and vaccination.
However, management procedures are normally not cost-effective and the progress has been disappointing with respect to the selection of poultry stock with increased genetically controlled resistance.
Nowadays, control of MD is almost entirely based on vaccination.

Infectious bursal disease virus (IBDV) is responsible for a highly contagious immunosuppressive disease in young chickens which causes significant losses to the poultry

2

3 PCT/US03/06811 industry worldwide (See Kibenge (1988), J. Gen. Virol., 69:1757-1775).
Infection of susceptible chickens with virulent IBDV strains can lead to a highly contagious immunosuppressive condition known as infectious bursal disease (IBD). Damage caused to the lymphoid follicles of the bursa of Fabricius and spleen can exacerbate infections caused by other agents and reduce a chicken's ability to respond to vaccination as well (See Cosgrove (1962), Avian Dis., 6:385-3894).

IBDV is a member of the Birnaviridae family and its genome consists of two segments of double-stranded RNA (See Dobos et al (1979), J. Virol., 32:593-605). The smaller segment B (about 2800 bp) encodes VP1, the dsRNApolymerase. The larger genomic segment A (about 3000 bp) encodes a 110 kDa precursor polypeptide in a single open reading frame (ORF) that is processed into mature VP2, VP3 and VP4 (See Azad et al (1985), Virology, 143:35-44). From a small ORF partly overlapping with the polypeptide ORF, segment A can also encode VP5, a 17-kDa protein of unknown function See Kibenge et al (1991), J. Gen. Virol. 71:569-577).

While VP2 and VP3 are the major structural proteins of the virion, VP2 is the major host-protective immunogen and causes induction of neutralizing antibodies See Becht et al.
(1988), J. Gen. Virol., 69:631-640; Fahey et al. (1989), J. Gen. Virol., 70:1473-1481). VP3 is considered to be a group-specific antigen because it is recognized by monoclonal antibodies (Mabs) directed against VP3 from strains of both serotype 1 and 2 See Becht et al (1988), J. Gen. Virol., 69:631-640). VP4 is a virus-coded protease and is involved in the processing of the precursor protein See Jagadish et al. (1988), J. Virol., 62:1084-1087).

In the past, control of IBDV infection in young chickens has been achieved by live vaccination with avirulent strains, or principally by the transfer of maternal antibody induced by the administration of live and killed IBDV vaccines to breeder hens.

Unfortunately, in recent years, virulent variant strains of IBDV have been isolated from vaccinated flocks in the United States (See , Snyder et al. (1988), Avian Dis., 32:535-539; Van der Marel et al. (1990), Dtsch. Tierarztl. Wschr., 97:81-83), which drastically undermine the effectiveness of using live vaccination for IBDV.

Efforts to develop a recombinant vaccine for IBDV have also been made, and the genoine of IBDV has been cloned (See Azad et al (1985) "Virology", 143:35-44).
The VP2 gene of IBDV has been cloned and expressed in yeast (See Macreadie et al.
(1990), Vaccine, 8:549-552), as well as in recombinant fowlpox virus See Bayliss et al (1991), Arch. Virol., 120:193-205). When chickens were immunized with the VP2 antigen expressed from yeast, antisera afforded passive protection in chickens against IBDV infection. When used in active immunization studies, the fowlpox virus-vectored VP2 antigen afforded protection against mortality, but not against damage to the bursa of Fabricius.

Newcastle disease virus (NDV) is an enveloped virus containing a linear, single-strand, nonsegmented, negative sense RNA genome. Typically, virus families containing enveloped single-stranded RNA of the negative-sense genome are classified into groups having non-segmented genomes (ems, Paramyxoviridae and Rhabdoviridae) or those having , Orthomyxoviridae, Bunyaviridae and Arenaviridae). NDV, segmented genomes (g .g together with parainfluenza virus, Sendai virus, simian virus 5, and mumps virus, belongs to the Paramyxoviridae family.

The structural elements of the NDV include the virus envelope which is a lipid bilayer derived from the cell plasma membrane. The glycoprotein, hemagglutinin-neuraminidase (HN) protrude from the envelope allowing the virus to contain both hemagglutinin and neuraminidase activities. The fusion glycoprotein (F), which also interacts with the viral membrane, is first produced as an inactive precursor, then cleaved post-translationally to produce two disulfide linked polypeptides. The active F protein is involved in penetration of NDV into host cells by facilitating fusion of the viral envelope

4 with the host cell plasma membrane. The matrix protein (M), is involved with viral assembly, and interacts with both the viral membrane as well as the nucleocapsid proteins.

The main protein subunit of the NDV nucleocapsid is the nucleocapsid protein (NP) which confers helical symmetry on the capsid. In association with the nucleocapsid are the P and L proteins. The phosphoprotein (P), which is subject to phosphorylation, is thought to play a regulatory role in transcription, and may also be involved in methylation, phosphorylation and polyadenylation. The L gene, which encodes an RNA-dependent RNA
polymerase, is required for viral RNA synthesis together with the P protein.
The L protein, which takes up nearly half of the coding capacity of the viral genome is the largest of the viral proteins, and plays an important role in both transcription and replication.

The replication of all negative-strand RNA viruses, including NDV, is complicated by the absence of cellular machinery required to replicate RNA. Additionally, the negative-strand genome can not be translated directly into protein, but must first be transcribed into a positive-strand (mRNA) copy. Therefore, upon entry into a host cell, the virus can not synthesize the required RNA-dependent RNA polymerase. The L, P and NP proteins must enter the cell along with the genome on infection. Both the NDV negative strand genomes (vRNAs) and antigenomes (cRNAs) are encapsidated by nucleocapsid proteins; the only unencapsidated RNA species are virus mRNAs. The cytoplasm is the site of NDV
viral RNA replication, just as it is the site for transcription. Assembly of the viral components appears to take place at the host cell plasma membrane and mature virus is released by budding.

In U.S. Pat. No. 5,427,791, Ahmad et al. describe the embryonal vaccination against NDV, which requires the modification of the viruses through the use of ethyl methane sulfonate (EMS). However, EMS is a mutagen so that the vaccine prepared by the use of EMS is suspected to act as a mutagen as well, which is undesirable for regular

5 administration of the vaccine. Nevertheless, without the modification with EMS, the NDV
vaccine cannot be applied for in ovo vaccination as almost all of the embryos will die upon injection of the eggs with the unmodified virus.

Infectious bronchitis virus (IBV), the prototype of the family Coronaviridae, is the etiological agent of infectious bronchitis (IB). The virus has a single-stranded RNA
genome, approximately 20 kb in length, of positive polarity, and is usually about 80-100 nm in size, being round with projecting 20 nm spikes. IBV is the causative agent of an acute, highly contagious disease in chickens of all ages, affecting the respiratory, reproductive and renal systems.

IBV contains three structural proteins: the spike (S) glycoprotein, the membrane glycoprotein, and the nucleocapsid protein. The spike glycoprotein is so called because it is present in the teardrop-shaped surface projections or spikes protruding from the lipid membrane of the virus. The spike protein is believed likely to be responsible for immunogenicity of the virus, partly by analogy with the spike proteins of other corona-viruses and partly by in vitro neutralisation experiments (See, , D. Cavanagh et al.
(1984), Avian Pathology, 13, 573-583). There are two spike glycoproteins, which are S1 (90,000 daltons) and S2 (84,000 daltons). The polypeptide components of the glycopolypeptides S1 and S2 have been estimated after enzymatic removal of oligosaccharides to have a combined molecular weight of approximately 125,000 daltons. It appears that the spike protein is attached to the viral membrane by the S2 polypeptide.

IBV has been wide-spread in countries where an intensive poultry industry has been developed. Young chickens up to 4 weeks of age are most susceptible to IBV, infection leading to high rates of morbidity and to mortality resulting from secondary bacterial infection. Infection also results in a drop in egg production, or failure to lay at full potential,

6 together with an increase in the number of down-graded eggs with thin, misshapen, rough and soft-shells produced, which can have a serious economic effect.

Administering live vaccines to a developing chick in the egg (in-ovo) has proven to be a fast (40,000 eggs per hour), effective (100% of the eggs receive the vaccine), and labor saving ($100,000 per year per hatchery) method to vaccinate baby chicks against certain diseases before they hatch.

The first in-ovo vaccination machine for use on chicken hatching eggs was developed by Embrex, Inc., of Raleigh, N.C. in the late 1980s. (See U.S. Pat.
Nos.
5,056,464 and 5,699,751). This in-ovo machine is currently used in about 80%
of the U.S.

broiler hatcheries, primarily for administering MD vaccines. The popularity of this machine, which has proven to be safe and effective in vaccination of chicks against MD, is also being used increasingly to administer 1BD vaccines and ND vaccines.

In the invention to be presented in the following sections, a DNA-mediated immunization (collectively "DNA vaccines") will be introduced. There are two kinds of DNA vaccines, ie., a multiple DNA vaccine and a multivalent DNA vaccine. The multiple DNA vaccine of the present invention contains a combination of two or more DNA
construct, each containing a single DNA molecule which is a viral gene or a fragment thereof. The multivalent DNA vaccine of the present invention contains two or more viral genes or fragments thereof linking together in one DNA construct. The viral genes or fragments used in preparation of either the multiple DNA vaccine or the multivalent DNA
vaccine are those that encode viral peptides which are antigenic to and can induce both the humoral and the cellular immune system in a host. The DNA vaccines are preferably applied to the egg by needles. The injection of the DNA vaccines in ovo leads to surprisingly strong immune responses which include not only antibody induction and T -cell

7 activation with cytokine secretion, but also the production of cytotoxic T
lymphocytes (CTL).

SUMMARY OF THE INVENTION:

The present invention provides a multiple DNA vaccine for in ovo injection.
The multiple DNA vaccine contains two or more DNA constructs, each DNA construct expressing an antigenic protein of an avian virus causing avian viral disease in fowl. The antigenic protein of the avian virus is capable of inducing a protective immune response against an avian viral disease. The multiple DNA vaccine is preferred to inject into the egg, particularly the amniotic fluid of the egg, of the fowl. The egg is preferred to be fertilized for about 18 days. The preferred fowl includes chicken, turkey, duck, and goose.

The DNA construct contains a DNA molecule and a vector. The vector can be a plasmid or a viral carrier. The preferred vector is a plasmid. Examples of the plasmid include, but are not limited to, pcDNA3, pVAX1, pSectag, pTracer, pDisplay, pUC system plasmid (such as pUC7, pUC8, pUC18), and pGEM system plasmid. Alternatively, any plasmid which contains a promoter such as CMV promoter, SV40 promoter, RSV
promoter, and R-actin promoter, can also be used for preparing the DNA construct. The most favorable plasmid is pcDNA3. The preferred viral carrier is one selected from the group consisting of a baculovirus, a herpes virus, and a pox virus.

Examples of the avian virus include, but are not limited to Marek's disease virus (MDV), infectious vursal disease virus (IBDV), Newcastle disease virus (NDV), infectious bronchitis virus (IBV), infectious laryngotracheitis virus (ILTV), avian encephalomyelitis (AEV), avian leukosis virus (ALV), fowlpox virus (FPV), avian paramyxovirus (APV), duck hepatitis virus (DHV), and hemorrhagic enteritis virus (HEV).

8 The DNA molecules that are particularly suitable for inducing a protective immune response against the avian viral diseases as shown above include, but are not limited to, the entire of gB gene of Merk's Disease virus (MDV) having the DNA sequence of SEQ
ID
NO: 1 or a fragment thereof; the entire VP2 gene of infectious bursal disease virus (IBDV) having the DNA sequence of SEQ ID NO:2 or a fragment thereof; the entire HN
gene of Newcastle disease virus (NDV) having the DNA sequence (which is from bases 6321 to 8319) of SEQ ID NO:3 or a fragment thereof (i.e., SEQ ID NO:3 is the entire genome of the NDV); the entire Si gene of infectious bronchitis virus (IBV) having the DNA
sequence of SEQ ID NO:4 or a fragment thereof; the entire glycoprotein G gene of infectious laryngotracheitis virus (ILTV) having the DNA sequence of SEQ ID NO:5 or a fragment thereof; the entire VP1, VPO, or VP3 gene of avian encephalomyelitis virus (AEV) or a fragment therof (the VP1 gene has the DNA sequence of SEQ ID NO:6; the VPO
gene has the DNA sequence of SEQ ID NO:7; and the VP3 gene has the DNA sequence of SEQ
ID
NO:8); the entire paraglycoprotein G gene of avian parainfluenza virus (APV) having the DNA sequence of SEQ ID NO:9 or a fragment thereof; the entire type A penton base gene of hemorrhagic enteritis virus (HEV) having the DNA sequence of SEQ ID NO:10 or a fragment thereof; and the entire envelope antigen gene of fowlpox virus (FPV) having the DNA sequence of SEQ ID NO:11 or a fragment thereof.

One preferred example of the DNA vaccine contains two DNA constructs, each containing a DNA molecule capable of expressing a gene or a fragment thereof which is from Marek's disease virus (MDV), infectious vursal disease virus (IBDV), Newcastle disease virus (NDV), or infectious bronchitis virus (IBV).

Another preferred example of the multiple DNA vaccine contains three or more DNA constructs, each containing a DNA molecule capable of expressing a gene or a

9 fragment thereof which is from Marek's disease virus (MDV), infectious vursal disease virus (IBDV), Newcastle disease virus (NDV), or infectious bronchitis virus (IBV).

The present invention also provides a method for vaccinating fowl egg and a method for preparing the multiple DNA vaccine. The method for vaccinating fowl egg includes injecting into the fowl egg the multiple DNA vaccine as shown above. The method for preparing the multiple DNA vaccine includes ligating a DNA molecule to a plasmid or virus carrier to form a DNA construct; and then mixing two or more said DNA
constructs to form the multiple DNA vaccine. The insertion of the DNA molecule into the vector can be achieved by conventional method, i.e., by ligation the DNA molecule with an enzyme such as T4 DNA ligase when both the genes and the desired vector have been cut with the same restriction enzyme(s) as complementary DNA termini are thereby produced. For pcDNA3, the preferred restriction enzymes are BamH1 and EcoRl.

In another embodment, there is provided a multivalent DNA vaccine for in ovo injection. The multivalent DNA vaccine comprises a DNA construct containing two or more DNA molecules linked together with a vector. Each of the DNA molecules expresses an antigenic protein of an avian virus, which is capable of inducing a protective immune response against that avian viral disease in fowl. The multivalent DNA vaccine is preferred to be injected into a fowl egg. Each of the DNA molecules of the multivalent DNA vaccine is a gene or a fragment thereof from Marek's disease virus (MDV), infectious vursal disease virus (IBDV), Newcastle disease virus (NDV), infectious bronchitis virus (IBV), infectious laryngotracheitis virus ([LTV), avian encephalomyelitis (AEV), avian leukosis virus (ALV), fowlpox virus (FPV), avian parainfluenza virus (APV), duck hepatitis virus (DHV), and hemorrhagic enteritis virus (HEV).

DETAILED DESCRIPTION OF THE INVENTION:

Traditional avian vaccines comprise chemically inactivated virus vaccines or modified live-virus vaccines. Inactivated vaccines require additional immunizations which are not only expensive to produce but also laborious to administer. Further, some infectious virus particles may survive the inactivation process and may cause disease after administration to the animal.

In general, attenuated live virus vaccines are preferred over inactivated vaccines because they evoke an immune response often based on both huinoral and cellular reactions.
Such vaccines are normally based on serial passage of virulent strains in tissue culture.

However, the attenuation process induces mutations of the viral genome, resulting in a population of virus particles heterogeneous with regard to virulence and immunizing properties. In addition, it is well known that the traditional attenuated live virus vaccines can revert to virulence resulting in disease outbreaks in inoculated animals and the possible spread of the pathogen to other animals.

Thus, it is advantageous for the industry to employ vaccines based on recombinant DNA technology. The resulting DNA vaccines only contain and express the necessary and relevant immunogenic material that is capable of eliciting a protective immune response against the pathogens and would not display above mentioned disadvantages of the live or inactivated vaccines.

For the purpose of preparing multiple DNA vaccines or multivalent recombinant DNA vaccines, the DNA sequence of the gene (also used interchangeably as "DNA
molecule") need not contain the full length of DNA encoding the polypeptides.
In most cases, a fragment of the gene which encodes an epitope region should be sufficient enough for immunization. The DNA sequence of an epitope region can be found by sequencing the corresponding part of other viral strains and comparing them. The major antigenic determinants are likely to be those showing the greatest heterology. Also, these regions are likely to lie accessibly in the conformational structure of the proteins. One or more such fragments of genes encoding the antigenic determinants can be prepared by chemical synthesis or by recombinant DNA technology. These fragments of genes, if desired, can be linked together or linked to other DNA molecules.

Also, the viral genes need not be in DNA. In fact, some of the frequently found avian viral diseases are caused by double- or single-stranded RNA viruses. For example, Marek's diesease virus is a double-stranded RNA virus, while infectious bursal disease virus (IBDV), Newcastle disease virus (NDV) and infectious bronchitis virus (IB) are single-stranded RNA viruses. The RNA viral sequences, however, can be reverse-transcribed into DNA using RT-Polymerase chain reaction (RT-PCR) technology and then incorporated into a vector by the conventional recombinant DNA technology.

In addition, because of the degeneracy of the genetic code it is possible to have numerous RNA and DNA sequences that encode a specified amino acid sequence.
Thus, all RNA and DNA sequences which result in the expression of a polypeptide having the antibody binding characteristics are encompassed by this invention.

To construct a recombinant DNA vaccine, either univalent or multivalent, the DNA
sequence of the viral gene can be ligated to other DNA molecules with which it is not associated or linked in nature. Optionally, the DNA sequence of a viral gene can be ligated to another DNA molecule, i.e., a vector, which contains portions of its DNA
encoding fusion protein sequences such as (3-galactosidase, resulting in a so-called recombinant nucleic acid molecule or DNA construct, which can be used for transformation of a suitable host. Such vector is preferably derived from, e.g., plasmids, or nucleic acid sequences present in bacteriophages, cosmids or viruses.

Specific vectors which can be used to clone nucleic acid sequences according to the invention are known in the art and include either a plasmid or a virus carrier. Examples of the plasmid include, but are not limited to, pBR322, pcDNA3, pVAX1, pSectag, pTracer, pDisplay, pUC system plasmids (ems, pUC7, pUC8, pUC1 8), pGEM system plasmids, Bluescript plasmids or any other plasmids where CMV promoter, SV40 promoter, RSV
promoter, or (i-actin promoter is included. The preferred plasmid is pcDNA3.
Examples of the virus carrier include, but are not limited to, bacteriophages (e.g., X and the M13-derived phages), SV40, adenovirus, polyoma, baculoviruses, herpes viruses (HVT) or pox viruses (e g , fowl pox virus).

The methods to be used for the construction of a recombinant nucleic acid molecule are known to those of ordinary skill in the art. For example, the insertion of the nucleic acid sequence into a cloning vector can easily be achieved by ligation with an enzyme such as T4 DNA ligase when both the genes and the desired cloning vehicle have been cut with the same restriction enzyme(s) so that complementary DNA termini are thereby produced.

Alternatively, it may be necessary to modify the restriction sites so as to produce blunt ends either by digesting the single-stranded DNA or by filling in the recessive termini with an appropriate DNA polymerase. Subsequently, blunt end ligation with an enzyme such as T4 DNA ligase may be carried out. If desired, any restriction site may be produced by ligating linkers onto the DNA termini. Such linkers may comprise specific oligonucleotide sequences that encode restriction site sequences. The restriction enzyme cleaved vector and nucleic acid sequence may also be modified by homopolymeric tailing.
The present invention provides two kinds of DNA vaccines. The first kind is a multiple DNA vaccine, which includes two or more of univalent DNA vaccines, each containing a DNA sequence encoding at least one polypeptide affording protection against one viral disease such as Marek's dosease voris (MDV), infectious bursal disease virus (IBDV), Newcastle disease virus (NDV), infectious bronchitis virus (IBV), infectious laryngotracheitis virus (ILTV), avian encephalomyelitis (AEV), Fowlpox virus (FPV), avian influenza virus (AIV), avian leukosis virus (ALV), duck hepatitis virus B
genome, and hemorrhagic enteritis virus (HEV), inserted into a commercially available plasmid.

The second kind is a multivalent recombinant DNA vaccine, which contains two or more genes or gene fragments from different viruses. These genes or gene fragments are carried by a useful vector, which can be either a plasmid or a virus carrier.
The multivalent recombinant DNA vaccine encodes two or more antigenic polypeptides which afford protection against at least two viral diseases including, but not limited to, MD, IBD, ND or IB. The viral genes or gene fragments are operatively attached to the vector in reading frame so that they can be expressed in a host. The different structural DNA
sequences carried by the vector may be separated by termination and start sequences so that the proteins can be expressed separately or they may be part of a single reading frame and therefore be produced as a fusion protein by methods known in the art.

The preferred DNA sequences include, but are not limited to, the entire of gB
gene of Merle's Disease virus (MDV) having the DNA sequence of SEQ ID NO:1 or a fragment thereof; the entire VP2 gene of infectious bursal disease virus (IBDV) having the DNA
sequence of SEQ ID NO:2 or a fragment thereof; the entire HN gene of Newcastle disease virus (NDV) having the DNA sequence of SEQ ID NO:3 or a fragment thereof; the entire S1 gene of infectious bronchitis virus (IBV) having the DNA sequence of SEQ ID
NO:4 or a fragment thereof.

The DNA sequence encoding the gB polypeptide of MDV has the nucleic acid sequence as SEQ IDNO:1. The DNA sequence contains 3650 bp of linear DNA.

The DNA sequence encoding the VP2 polypeptide of IBDV has the nucleic acid sequence as SEQ IDNO:2. The DNA sequence contains 3004 bp of linear DNA
molecule which is reversely transcribed from IBDV's RNA template.

The DNA sequence of the entire genome of NDV contains 15186 bps of DNA, wherein (1) base No. 56 to 1792 encodes NP polypeptide, which is nucleocapsid protein; (2) base No. 1804-3244 encodes P polypeptide, which is a phosphoprotein; (3) base No. 3256-4487 encodes M polypeptide, which is a matrix protein; (4) base No. 4498-6279 encodes F
polypeptide, which is a fusion protein; (5) base 6321-8319 encodes HN
polypeptide, which is a hemagglutinin-neuraminidase; (6) base No. 8370-15073 encodes L
polypeptide, which is a large polymerase protein. The NDV genome has the DNA sequence as SEQ ID
NO:3.
The DNA sequence of the S1 polypeptide contains 1611 bp of linear DNA sequence as shown in SEQ ID NO:4, which is reversely transcribed from IBV's RNA
templates.

The following experimental designs are illustrative, but not limiting the scope of the present invention. Reasonable variations, such as those occur to reasonable artisan, can be made herein without departing from the scope of the present invention.

I. Materials and Methods (A) Virus and vaccines Avian infectious bronchitis virus (IBV), infectious bursal disease (IBD) and Newcastle disease (ND) vaccines were purchased from Intervet Inc.

(B) Viral RNA isolation and RT PCR

Two hundred microliter recovered attenuated vaccines (Intervet Inc.) were resolved in iced cold GTC buffer (4 M guanidium isothiocyanate, 25mM sodium citrate, pH
7.0, 0.5% Sarkosyl, 0.1 M - mercaptoethanol) and sodium acetate (pH 4). An equal volume of phenol-chloroform (1:1) was added and placed on ice for 15 minutes after vortexing. The aqueous phase was collected after centrifuge and the RNA was precipitated with an equal volume of isopropanol. RNA was pelleted by centrifugation at 12000 rpm for 20 min at 4 C
and then suspended in diethylpyrocarbonate (DEPC) treated deionized distill water and stored at -70 C.

(C) Oligonucleotides Oligonucleotide primers for RT PCR amplification were purchased from Promega, and were designed according to the genome of the Avian infectious bronchitis virus (Beaudette CK strain), Newcastle disease virus (Lasota strain) and Infectious bursa disease virus respectively. The sequences of the primers used for PCR were :

IBS IF' 5' CGGGATCCGCCGCCGCCATGTTGGTAACACCTCTT Y; (SEQ ID
NO:12) IBS 1R' 5' CGGAATTCTTAACGTCTAAAACGACGTGT 3 ; (SEQ IDNO:13) NDF F' 5' CGGGATCCGCCGCCGCCATGGGCTCCAGACCTTCTACC 3'; (SEQ
ID NO:14) NDF R' 5' CCGCTCGAGTTACATTTTTGTAGTGGCTCTCATT Y; (SEQ ID NO:15) NDHN F'5' CGGGATCCGCCGCCGCCATGGACCGCGCCGTTAGGCAAG3;
(SEQ ID NO:16) NDHN R' 5' GCTCTAGATTACTCAACTAGCCAGACCTG Y; (SEQ ID NO: 17) IBDVP2F' 5' CGGGATCCGCCGCCGCCATGACAAACCTGCAAGAT Y; (SEQ ID
NO:18) IBDVP2R' 5' CGGAATTCTTACCTTATGGCCCGGATTAT 3'. (SEQ ID NO:19) (D) Reverse transcription polymerase reaction (RT PCR

Reverse transcription of IBV, NDV and IBDV RNA were carried out at 42 C for 30 min in 2.5 x Taq buffer (200 mM NaCl, 15 mM Tris-HC 1, pH7.4, 15 mM MgC 12,15 mM 13 mercaptoethanol, and 0.25 mM each of dATP, dCTP, dGTP, and dTTP). In addition to the Taq buffer, the reaction mixture (40 l) also contained viral RNA, 2.4 U of avian myeloblastosis virus (AMV) reverse transcriptase (Promega), 16 U of RNasin (Promega), and 0.01 nmol reverse primer (IBDVP2R, NDF F, NDHNF or IBSIR ). The final volume of the reaction mixture was 40 p1. After reverse transcription, the following reagents were added to the reverse transcription mixture: 0.02 nmol of each nucleotide triphosphate (dATP, dCTP, dGTP, dTTP), 0.01 nmol of forward primer (IBD VP2F, NDF R, NDHN R
or IBSIF) and 1.5 U of Taq DNA polymerase (Strategene). Water was then added to a final volume of 100 l. The reaction was carried out for 32 cycles in a Thermal Cycler (Perkin Elmer-Cetus). Each PCR cycle consisted of I min of denaturation at 94 C, 1 min of annealing at 57 C, and 2 min of DNA chain elongation at 72 C .

(E) Preparation of DNA constructs The plasmids pCMV-VP2, pCMV-S 1, pCMV-NDF and pCMV NDHN were constructed with the VP2, S1, NDF and NDHN genes from IBD vaccine, IBV vaccine and NDV vaccine respectively, placed downstream of the commercial plasmid pcDNA3.

(!nitrogen, U.S.A.). All of the genes were inserted into the pcDNA3 vector using restriction enzymes BainHl, EcoRl, Xbal and Xho1(underlined characters in the sequence of the primers). Sequences of the all genes in the pcDNA3 vector were verified by sequencing in both directions.

(F) Preparation of DNA and DNA delivery The quantity of plasmid DNA that had been purified by affinity chromatography (Qiagen.
Inc.) was determined by spectrophotometric measurements at 260 and 280 nm. The DNA in aliquots to 100 p.g was suspended in 100 .l of PBS (0.14M NaCl, 10mM sodium phosphate, pH 7.4). For DNA delivery, Icc syringe with a 20 gauge I and 1/2 inch needle were used.

For the in-ovo groups, the embryos (18-day-old fertilized and developing eggs from the setting trays) were injected with 0.1 milliliters of DNA vaccine (100 g) into the large end of each egg through the air cell with a needle. The eggs were then transferred into the hatchery where they remained until they hatched at about 21 days of age. For the IM
(Intramuscular), all of the vaccines (1/5 dose of live vaccines) were injected into the chicken's thoracic muscle at 10 days post hatchery.
H. Experimental design Specific Pathogen Free (SPF) fertilized eggs (n=60) were randomized into 12 groups. All groups (five eggs each group ), all eggs were given 100 l in volume each. 100 g pCMV-NDF+ 100 g pCMV NDHN mixture was injected in each egg of group A, 100 g pCMV S1 was injected in each egg of group B, 100 g pCMV VP2 was injected in each egg of group C, 100 g pCMV-NDF + 100 g pCMV NDHN+100 g pCMV-S1(ND+IB) was injected in each egg of group D, 100 g pCMV NDF+ 100 g pCMV-NDHN+100 g pCMV-VP2 (ND+IBD) was injected in each egg of group E, 100 g pCMV VP2+100 g pCMV VP2 mixture (IB+IBD) was injected in each egg of group F, 100 g pCMV-NDF+

100 g pCMV NDHN+100 g pCMV S l+100 pg pCMV-VP2 mixture (ND+IB+IBD) was injected in each egg of group G, one dose of commercialized in-ovo IBD vaccine (Embrex, Inc) was injected in each egg of group H as positive control, 100 ul PBS was injected in each egg of group I, J, K and L. All chickens in this experiment were given 100 l in volume (1/5 dose of live vaccines), injected into the chicken's thoracic muscle each at 10 days post hatchery. Chickens in group A and I were injected with NDV vaccine, group B
and J were injected with IBV vaccine, group C and K were injected with IBDV
vaccine, group D were injected with the mixture of NDV+IB vaccines, group E were injected with the mixture of NDV+IBD vaccines, group F were injected with the mixture of IB+IBD
vaccines and group G and L were injected with the mixture of NDV, IB and IBD
vaccines.

III. Serology detection All of the serum samples were collected at 10 days (injected with low dose live vaccines at the same time), 17days, 24 days and 31 days post hatchery. The antibody titers were detected by ELISA using IB, IBD and NDV antibody test kits which purchased from IDEXX Laboratories, Inc. All of the samples were detected duplicated. Dilute test samples five hundred fold (1:500) with sample diluents prior to being assayed. The test procedure was applied according to the kit's manual. For the assay to be valid, measure and record absorbance values at 650 nm, A (650). The relative level of antibody in the unknown was determined by calculating the sample to positive (S/P) ratio. Endpoint titers were calculated using the formula: Log10Titer =1.09(Log10SIP)+ 3.36 Results As shown in Table 1, the results demonstrated that, for the detection of anti-IBD
antibodies, the IBDV recombinant antigens VP2 could be expressed and played the role of primary stimulation. The titers increased rapidly after a low dose vaccine booster. The titers of group C, E, F and G at 17 days post hatchery (i.e. 7 days post IM
injection) were significantly higher than those of group K and L. Most importantly, the expression of IBDV antigen was not interfered by other monovalent DNA vaccines (NDV and IBV). The same results were also applied to IB and NDV DNA vaccines. The titers of group B, D, F

and G were higher than those of group J and L at 17 days post hatchery (Table 2) and the titers of group A, D, E and G were higher than those of group I and L at 17 days post hatchery (Table 3). The only unpredicted result was the anti-NDV titer could not be highly induced by the triple valent DNA vaccine (Table 3, group G), but anti-IBD and anti-IB did (Tables 1 and 2, group G).

Table 1. Serum Samples Detected by IDEXX IBD Antibody Test Kit (Ab Titers Correspond to the Average Titers SD) Immunization and Sample Collection Schedule (days) Animal Group 10 Days PH* 17 Days PH 24 Days PH 31 Days PH
C(IBD) ^** 4535 1267 16623 3105 21254 3852 E(IBD+ND) ^ 1685 655 17339 2185 19041 2967 F(I B D+I B) ^ 8252 2205 10057 1295 17561 2006 G(IBD+IB+ND) ^ 9111 1701 13127 1763 16694 2134 H (I B D positive) 6553 851 13025 2131 18015 1592 18853 2614 K(PBS/IBD) ^ ^ 1853 302 17002 2965 L(PBS/IBD+IB+ ^ ^ 6923 1168 18063 2531 ND) *P H: post hatchery ** ^ : average titers less than 396 (be considered negative by IDEXX kit) Table 2. Serum Samples Detected by IDEXX IB Antibody test kit (Ab Titers Correspond to the Average Titers SD

Immunization and Sample Collection Schedule (days) Animal Group 10 Days PH* 17 Days PH 24 Days PH 31 Days PH
B(IB) ^** 441 117 2426 264 3214 877 D(IB+ND) ^ 586 182 805 221 1988 501 F(IB+IBD) ^ 509 89 685 186 1192 237 G(IBD+IB+ND) ^ 499 81 688 78 2551 531 J(PBS/IB) ^ ^ 485 76 1662 441 L(PBS/IBD+IB+ ^ ^ 819 202 1332 488 ND) *P H: post hatchery ** ^ : average titers less than 396 (be considered negative by IDEXX kit) Table 3. Serum Samples Detected by IDEXX ND Antibody Test Kit (Ab Titers Correspond to the Average Titers SD).

Immunization and Sample Collection Schedule (days) Animal Group 10 Days PH* 17 Days PH 24 Days PH 31 Days PH
A(ND) ^ 466 101 2394 456 8103 2198 D(ND+IB) ^ 706 140 1778 378 6811 2206 E(ND+IBD) ^ 517 104 3021 411 5991 1695 G(I BD+I B+N D) ^ ^ ^ 783 201 I(PBS/ND) ^ ^ 1853 324 3912 304 L(PBS/IBD+IB+ ^ ^ 4027+662 5807 1996 ND) *P H: post hatchery ** ^ : average titers less than 396 (be considered negative by IDEXX kit) SEQUENCE LISTING

<110> KUO, Tsun Yuang <120> MULTIPLE AND MULTIVALENT DNA VACCINES IN OVO
<130> 39734-186920 <160> 19 <170> Patentln version 3.2 <210> 1 <211> 3650 <212> DNA
<213> Marek's disease virus <400> 1 tcgagctcgc cggggatgtt tagtcacgat agacatcggt tCgCCCagCC gtcgaataca 60 gcattatatt ttagtgttga aaatgtaggg CtgCttCCtC acttaaagga ggaaatggct 120 cgattcatgt ttcatagcag tagaaaaaca gattggaccg tcagtaagtt tagagggttt 180 tatgacttta gcactataga taatgtaact gcggcccatc gcatggcttg gaaatatatc 240 aaagaactga tttttgCaac agctttattt tcttctgtat ttaaatgtgg cgaattgcac 300 atctgtcgtg cCgacagttt gcagatcaac agCaatggag aCtatgtatg gaaaaatgga 360 atatatataa catatgaaac cgaatttcca cttataatga ttctggggtc agaatcaagc 420 acttCagaaa cgcaaaatat gaCtgcaatt attgatacag atgttttttc gttgctttat 480 tctattttgc agtatatggC ccccgttacg gCagatcagg tgcgagtaga acagattacc 540 aaCagCCacg cccccatctg acccgtcCaa tattcttgtg tccctgcatt ttatctcaca 600 caatttatga acagcatCat taagatcatc tcactatgca ctattttagg cggaattgca 660 tttttttcct tatagttatt ctatatggta cgaactcatC tccgagtaCC caaaatgtga 720 catCaagaga agttgtttcg agCgtccagt tgtctgagga agagtctacg ttttatcttt 780 gtccCCCacC agtgggttca accgtgatcc gtctagaacc gccgCgaaaa tgtCCCgaac 840 ctagaaaagc caccgagtgg ggtgaaggaa tcgcgatatt atttaaagag aatatcagtc 900 catataaatt taaagtgacg ctttattata aaaatatatt tcagacgaCg acatggacgg 960 ggaCgacata tagacagatc aCtaatcgat atacagatag gacgcccgtt tccattgaag 1020 agatcacgga tctaatcgac ggcaaaggaa gatgctcatc taaagcaaga taccttagaa 1080 acaatgtata tgttgaagcg tttgacaggg atgcgggaga aaaacaagta cttctaaaac 1140 catcaaaatt caacacgccc gaatctaggg catggcacac gactaatgag acgtataccg 1200 tgtggggatc accatggata tatcgaacgg gaacctccgt caattgtata gtagaggaaa 1260 tggatgcccg ctctgtgttt ccgtattcat attttgcaat ggccaatggc gacatcgcga 1320 acatatctcc attttatggt ctatccccac cagaggctgc cgcagaaccc atgggatatc 1380 cccaggataa tttcaaacaa ctagatagct atttttcaat ggatttggac aagcgtcgaa 1440 aagcaagcct tccagtcaag cgtaactttc tcatcacatc acacttcaca gttgggtggg 1500 actgggctcc aaaaactact cgtgtatgtt caatgactaa gtggaaagag gtgactgaaa 1560 tgttgcgtgc aacatttaat gggagataca gatttatggc ccgtgaactt tcggcaacgt 1620 ttatcagtaa tacgactgag tttgatccaa atcgcatcat attaggacaa tgtattaaac 1680 gcgaggcaga agcagcaatc gagcagatat ttaggacaaa atataatgac agtcacgtca 1740 aggttggaca tgtacaatat ttcttggctc tcgggggatt tattgtagca tatcagcctg 1800 ttctatccaa atccctggct catatgtacc tcagagaatt gatgagagac aacaggaccg 1860 atgagatgct cgacctggta aacaataagc atgcaattta taagaaaaat gctacctcat 1920 tgtcacgatt gcggcgagat attcgaaatg caccaaatag aaaaataaca ttagacgaca 1980 ccacagctat taaatcgaca tcgtctgttc aattcgccat gctccaattt ctttatgatc 2040 atatacaaac ccatattaat gatatgttta gtaggattgc cacagcttgg tgcgaattgc 2100 agaatagaga acttgtttta tggcacgaag ggataaagat taatcctagc gctacagcga 2160 gtgcaacatt aggaaggaga gtggctgcaa agatgttggg ggatgtcgct gctgtatcga 2220 gctgcactgc tatagatgcg gaatccgtca ctttgcaaaa ttctatgcga gttatcacat 2280 ccactaatac atgttatagc cgaccattgg ttctattttc atatggagaa aaccaaggaa 2340 acatacaggg acaactcggt gaaaacaacg agttgcttcc aacgctagag gctgtagagc 2400 catgctcggc taatcatcgt agatattttc tgtttggatc cggttatgct ttatttgaaa 2460 actataattt tgttaagatg gtagacgctg ccgatataca gattgctagc acatttgtcg 2520 agcttaatct aaccctgcta gaagatcggg aaattttgcc tttatccgtt tacacaaaag 2580 aagagttggg tgatgttggt gtattggatt atgcagaagt agctcgccgc aatcaactac 2640 atgaacttaa attttatgac ataaacaaag taatagaagt ggatacaaat tacgcgttta 2700 tgaacggttt ggccgaattg tttaacggta tgggtcaggt agggcaagct ataggcaaag 2760 ttgtagtagg ggctgccggt gcaatcgtat ctaccatatc tggtgtctct gctttcatgt 2820 caatcccttt ggggctttcg gcaatcggtt taatcattat agCaggactc gtggctgcat 2880 ttttagcata tcgttatgta aacaagctta aaagcaatcc aatgaaagcc ctttatccta 2940 tgacaacaga agtgcttaag gcacaggcaa cgtgtgtgtt gcatggcgag gaatcagatg 3000 atttggaacg aacatctatt gatgaaagaa aattagaaga agctagagaa atgataaaat 3060 atatggcgtt agtctccgcg gaagaacgcc acgagaaaaa actgcggaga aagaggcgag 3120 gcactaccgc cgttctatcg gaccacctgg caaaaatgag gattaaaaat agtaacccta 3180 aatatgataa gttacctact acatattcag actcagaaga tgatgctgtg taagtgggca 3240 ctattatatt tgaactgaat aaaacgcata gagcatgata tggtttactc atttattgcg 3300 agatataaag catattcaat acgatatatt gcgaacgtga tgctaaaaac atagctccct 3360 gtattattga tgcgccatca tttgattaat aaatacatcg acgccggcat cactggtgcg 3420 gtgtatacca gctacggcgc tagcattcat ggtatcccgt gattgctcga tgctttcctt 3480 ctgaattccg tcggaacgct cctgagagat ggtcgcagtt attggtacat ttcgaccagc 3540 ctccggatct gaaactggca caggaatgca ccgtggaatt ggtagaagtt tttccttccg 3600 tggaaggcat agggcgttcg actcccatgg gccatgaaac tgtgggatgt 3650 <210> 2 <211> 3004 <212> DNA
<213> infectious bursal disease virus (IBDV) <400> 2 tgatgccaac aaccggaccg gcgtccattc cggacgacac cctggagaag cacactctca 60 ggtcagagac ctcgacctac aatttgactg tgggggacac agggtcaggg ctaattgtct 120 ttttccctgg attccctggc tcaattgtgg gtgctcacta cacactgcag agcaatggga 180 actacaagtt cgatcagatg ctcctgactg cccagaacct accggccagt tacaactact 240 gcaggctagt gagtcggagt ctcacagtga ggtcaagcac acttcctggt ggcgtttatg 300 cactaaacgg caccataaac gccgtgacct tccaaggaag cctgagtgaa ctgacagatg 360 ttagctacaa tgggttgatg tctgcaacag ccaacatcaa cgacaaaatt gggaacgtcc 420 tagtagggga aggggtcacc gtcctcagct tacccacatc atatgatctt gggtatgtga 480 ggctttgtga ccccattccc gcaatagggc ttgacccaaa aatggtagcc acatgtgaca 540 gcagtgacag gcccagagtc tacaccataa ctgcagccga tgattaccaa ttctcatcac 600 agtaccaacc aggtggggta acaatcacac tgttctcagc caacattgat gccatcacaa 660 gcctcagcgt tgggggagag ctcgtgtttc gaacaagcgt ccacggcctt gtactgggcg 720 ccaccatcta cctcataggc tttgatggga caacggtaat caccagggct gtggccgcaa 780 acactgggct gacgaccggc accgacaacc ttatgccatt caatcttgtg attccaacaa 840 acgagataac ccagccaatc acatccatca aactggagat agtgacctcc aaaagtggtg 900 gtcaggcagg ggatcagatg ttatggtcgg caagagggag cctagcagtg acgatccatg 960 gtggcaacta tccaggggcc CtCCgtCCCg tcacgctagt ggcctacgaa agagtggcaa 1020 caggatccgt cgttacggtc gctggggtga gcaacttcga gctgatccca aatcctgaac 1080 tagcaaagaa cctggttaca gaatacggCC gatttgaccc aggagccatg aactacacaa 1140 aattgatact gagtgagagg gaccgtcttg gcatcaagac cgtctggcca acaagggagt 1200 acactgactt tcgtgaatac ttcatggagg tggccgacct caactctccc ctgaagattg 1260 caggagcatt cggcttcaaa gacataatcc gggccataag gaggatagct gtgccggttg 1320 tctccacatt gttcccacct gccgctcccc tagcccatgc aattggggaa ggtgtagact 1380 acctgctggg cgatgaggca caggctgctt caggaactgc tcgagccgcg tcaggaaaag 1440 caagagctgc ctcaggccgc ataaggcagc tgactctcgc cgccgacaag gggtgagagg 1500 tagtcgcgaa tctattccag gtgccccaga atcccgtagt cgacgggatt cttgcttcac 1560 ctggggtact ccgcggtgca cacaacctcg actgcgtgtt aagagagggt gccacgctat 1620 tccatgtggt tattacgaca gtgcaagacg ccatgacacc caaagcattg aacagcaaaa 1680 tgtttgctgt cattgaaggc gtgcgagaag acctccaacc tcgatctaaa agaggatcct 1740 tcatagaaac tctctctgga cacagagtct atggatatgc tccatatggg gtacttccac 1800 tggagactgg gagagactac accgttgtcc caatagatga tgtctgggac gacagcatta 1860 tgctgtccaa agatcccata cctcctattg tggaaaacag tggaaatcta gccatagctt 1920 acatggatgt gtttcgaccc aaagtcccaa tccatgtggc tatgacggga gccctcaatg 1980 cttgtggcga gattgagaaa gtaagcttta gaagcaccaa gctcgccact gcacaccgac 2040 ttggccttaa gttggctggt cccggagcat tcgatgtaaa caccgggccc aactgggcaa 2100 cgttcatcaa acgtttccct cacaatccac gcgactggga caggctcccc tacctcaacc 2160 taccatacct tccacccaat gcaggacgcc agtaccacct tgccatggct gcatcagagt 2220 tcaaagagac ccccgaactc gagagtgccg tcagagcaat ggaagcagca gccaacgtgg 2280 acccactatt ccaatctgca ctcagtgtgt tcatgtggct ggaagagaat gggattgtga 2340 ctgacatggc caacttcgca ctcagcgacc cgaacgccca tcggatgcga aattttcttg 2400 caaacgcacc acaagcaggc agcaagtcgc aaagggccaa gtacgggaca gcaggctacg 2460 gagtgaaggc tcggggcccc acaccagagg aagcacagag ggaaaaagac acacggatct 2520 caaagaagat ggagaccatg ggcatctact ttgcaacacc agaatgggta gcactcaatg 2580 ggcaccgagg gccaagcccc ggccagctaa agtactggca gaacacacga gaaataccgg 2640 acccaaacga ggactatcta gactacgtgc atgcaaagaa gagccggttg gcatcagaag 2700 aacaaatcct aagggcagct acatcgatct acggggctcc aggacaggca gagccacccc 2760 aagctttcat agacgaagtt gccaaagtct atgaaatcaa ccatggacgt ggcccaaacc 2820 aagaacagat gaaagatctg ctcttgactg cgatggagat gaagcatcgc aatcccaggc 2880 gggctctacc aaagcccaag ccaaaaccca atgctccaaC acagagaccc cctggtcggc 2940 tgggccgctg gatcaggacc gtctctgatg aggaccttga gtgaggctcc tggaagtctc 3000 ccga 3004 <210> 3 <211> 15186 <212> DNA
<213> Newcastle disease virus (NDV) <400> 3 accaaacaga gaatccgtga gttacgataa aaggcgaagg agcaattgaa gtcgcacggg 60 tagaaggtgt gaatctcgag tgcgagcccg aagcacaaac tcgagaaagc cttctgccaa 120 catgtcttcc gtatttgatg attacgaaca gctcctcgcg gctcagactc gccccaatgg 180 agctcatgga gggggagaaa aagggagtac cttaaaagta gacgtcccgg tattcactct 240 taacagtgat gacccagaag atagatggag ctttgtggta ttctgcctcc ggattgctgt 300 tagcgaagat gccaacaaac cactcaggca aggtgctctc atatctcttt tatgctccca 360 ctcacaggta atgaggaacc atgttgccat tgcagggaaa cagaatgaag ccacattggc 420 cgtgcttgag attgatggct ttgccaacgg cacgccccag ttcaacaata ggagtggagt 480 gtctgaagag agagcacaga gatttgcgat gatagcagga tctctccctc gggcatgcag 540 caacggaacc ccgttcgtca cagccggggc agaagatgat gcaccagaag acatcaccga 600 taccctggag aggatcctct ctatccaggc tcaagtatgg gtcacagtag caaaagccat 660 gactgcgtat gagactgcag atgagtcgga aacaaggcga atcaataagt atatgcagca 720 aggcagggtc caaaagaaat acatcctcta ccccgtatgc aggagcacaa tccaactcac 780 gatcagacag tctcttgcag tccgcatctt tttggttagc gagctcaaga gaggccgcaa 840 cacggcaggt ggtacctcta cttattataa cctggtaggg gacgtagact catacatcag 900 gaataccggg cttactgcat tcttcttgac actcaagtac ggaatcaaca ccaagacatc 960 agcccttgca cttagtagcc tctcaggcga catccagaag atgaagcagc tcatgcgttt 1020 gtatcggatg aaaggagata atgcgccgta catgacatta cttggtgata gtgaccagat 1080 gagctttgcg cctgccgagt atgcacaact ttactccttt gccatgggta tggcatcagt 1140 cctagataaa ggtactggga aataccaatt tgccagggac tttatgagca catcattctg 1200 gagacttgga gtagagtacg ctcaggctca gggaagtagc attaacgagg atatggctgc 1260 cgagctaaag ctaaccccag cagcaatgaa gggcctggca gctgctgccc aacgggtctc 1320 cgacgatacc agcagcatat acatgcctac tcaacaagtc ggagtcctca ctgggcttag 1380 cgaggggggg tcccatgctc tacaaggcgg atcgaataga tcgcaagggc aaccagaagc 1440 cggggatggg gagacccaat tcctggatct gatgagagcg gtagcaaata gcatgaggga 1500 ggcgccaaac tctgcacagg gcactcccca atcggggcct cccccaactc ctggcccatc 1560 ccaagataac gacaccgact gggggtattg atggacaaaa cccagcctgc ttccacaaaa 1620 acatcccaat gccctcaccc gtagtcgacc cctcgatttg cggctctata tgaccacacc 1680 ctcaaacaaa catccccctc tttCCtCCCt CCCCCtgCtg taCaaCtCCg cacgccctag 1740 ataccacagg cacaatgcgg ctcaCtaaca atcaaaacag agccgaggga attagaaaaa 1800 agtacgggta gaagagggat attcagagat cagggCaagt ctcccgagtc tctgctctct 1860 cctctacctg atagaccagg acaaacatgg ccacctttac agatgcagag atcgacgagc 1920 tatttgagac aagtggaact gtcattgaca acataattac agcccagggt aaaccagcag 1980 agactgttgg aaggagtgca atcccacaag gcaagaccaa ggtgctgagc gcagcatggg 2040 agaagcatgg gagcatccag ccaccggcca gtcaagacaa ccccgatcga caggacagat 2100 ctgacaaaca accatccata cccgagcaaa cgaccccgca tgacagcccg ccggccacat 2160 ccgccgacca gccccccacc caggccacag acgaagccgt cgacacacag ttcaggaccg 2220 gagcaagcaa ctctctgctg ttgatgcttg acaagctcag caataaatcg tccaatgcta 2280 aaaagggccc atggtcgagc ccccaagagg ggaatcacca acgtccgact caacagcagg 2340 ggagtcaacc cagtcgcgga aacagtcagg aaagaccgca gaaccaagtc aaggccgccc 2400 ctggaaacca gggcacagac gtgaacacag catatcatgg acaatgggag gagtcacaac 2460 tatcagctgg tgcaacccct catgctctcc gatcaaggca gagccaagac aatacccttg 2520 tatctgcgga tcatgtccag ccacctgtag actttgtgca agcgatgatg tctatgatgg 2580 aggcgatatc acagagagta agtaaggttg actatcagct agatcttgtc ttgaaacaga 2640 catcctccat ccctatgatg cggtccgaaa tccaacagct gaaaacatct gttgcagtca 2700 tggaagccaa cttgggaatg atgaagattc tggatcccgg ttgtgccaac atttcatctc 2760 tgagtgatct acgggcagtt gcccgatctc acccggtttt agtttcaggc cctggagacc 2820 cctctcccta tgtgacacaa ggaggcgaaa tggcacttaa taaactttcg caaccagtgc 2880 cacatccatc tgaattgatt aaacccgcca ctgcatgcgg gcctgatata ggagtggaaa 2940 aggacactgt ccgtgcattg atcatgtcac gcccaatgca cccgagttct tcagccaagc 3000 tcctaagcaa gttagatgca gccgggtcga tcgaggaaat caggaaaatc aagcgccttg 3060 ctctaaatgg ctaattacta ctgccacacg tagcgggtcc ctgtccactc ggcatcacac 3120 ggaatctgca ccgagttccc ccccgcagac ccaaggtcca actctccaag cggcaatcct 3180 ctctcgcttc ctcagcccca ctgaatggtc gcgtaaccgt aattaatcta gctacattta 3240 agattaagaa aaaatacggg tagaattgga gtgccccaat tgtgccaaga tggactcatc 3300 taggacaatt gggctgtact ttgattctgc ccattcttct agcaacctct tagcatttcc 3360 gatcgtccta caaggcacag gagatgggaa gaagcaaatc gccccgcaat ataggatcca 3420 gcgcctttac ttgtggactg atagtaagga ggactcagta ttcatcacca cctatggatt 3480 catctttcaa gttgggaatg aagaagccac tgtcggcatg atcgatgata aacccaagcg 3540 cgagttactt tccgctgcga tgctctgcct aggaagcgtc ccaaataccg gagaccttat 3600 tgagctggca agggcctgtc tcactatgat agtcacatgc aagaagagtg caactaatac 3660 tgagagaatg gttttctcag tagtgcaggc accccaagtg ctgcaaagct gtagggttgt 3720 ggcaaacaaa tactcatcag tgaatgcagt caagcacgtg aaagcgccag agaagattcc 3780 cgggagtgga accctagaat acaaggtgaa ctttgtctcc ttgactgtgg taccgaagaa 3840 ggatgtctac aagatcccag cttgagtatt gaaggtttct ggctcgagtc tgtacaatct 3900 tgcgctcaat gtcactatta atgtggaggt agacccgagg agtcctttgg ttaaatcttt 3960 gtctaaatct gacagcggat actatgctaa cctcttcttg catattggac ttatgaccac 4020 cgtagatagg aaggggaaga aagtgacatt tgacaagctg gaaaagaaaa taaggagcct 4080 tgatctatct gtcgggctca gtgatgtgct cgggccttcc gtgttggtaa aagcaagagg 4140 tgcacggact aagcttttgg cacctttctt ctctagcagt gggacagcct gctatcccat 4200 agcaaatgct tctcctcagg tggccaagat actctggagt caaaccgcgt gcctgcggag 4260 cgttaaaatc attatccaag caggtaccca acgcgctgtc gcagtgaccg ccgaccacga 4320 ggttacctct actaagctgg agaaggggca cacccttgcc aaatacaatc cttttaagaa 4380 ataagctgcg tctctgagat tgcgctccgc ccactcaccc agatcatcat gacacaaaaa 4440 actaatctgt cttgattatt tacagttagt ttacctgtct atcaagttag aaaaaacacg 4500 ggtagaagat tctggatccc ggttggcgcc ctccaggtgc aagatgggct ccagaccttc 4560 taccaagaac ccagcaccta tgatgctgac tatccgggtt gcgctggtac tgagttgcat 4620 ctgtccggca aactccattg atggcaggcc tctttcagct gcaggaattg tggttacagg 4680 agacaaagcc gtcaacatat acacctcatc ccagacagga tcaatcatag ttaagctcct 4740 cccgaatctg cccaaggata aggaggcatg tgcgaaagcc cccttggatg catacaacag 4800 gacattgacc actttgctca ccccccttgg tgactctgtc cgtaggatac aagagtctgt 4860 gactacatct ggagggggga gacaggggcg ccttataggc gccattattg gcggtgtggc 4920 tcttggggtt gcaactgccg cacaaataac agcggccgca gctctgatac aagccaaaca 4980 aaatgctgcc aacatcctcc gacttaaaga gagcattgcc gcaaccaatg aggctgtgca 5040 tgaggtcact gacggattat cgcaactagc agtggcagtt gggaagatgc agcagtttgt 5100 taatgaccaa tttaataaaa cagctcagga attagactgc atcaaaattg cacagcaagt 5160 tggtgtagag ctcaacctgt acctaaccga attgactaca gtattcggac cacaaatcac 5220 ttcacctgct ttaaacaagc tgactattca ggcactttac aatctagctg gtggaaatat 5280 ggattactta ttgactaagt taggtgtagg gaacaatcaa ctcagctcat taatcggtag 5340 cggcttaatc accggtaacc ctattctata cgactcacag actcaactct tgggtataca 5400 ggtaactcta ccttcagtcg ggaacctaaa taatatgcgt gccacctact tggaaacctt 5460 atccgtaagc acaaccaggg gatttgcctc ggcacttgtc cccaaagtgg tgacacaggt 5520 cggttctgtg atagaagaac ttgacacctc atactgtata gaaactgact tagatttata 5580 ttgtacaaga atagtaacgt tccctatgtc ccctggtatt tattcctgct tgagcggcaa 5640 tacgtcggcc tgtatgtact caaagaccga aggcgcactt actacaccat acatgactat 5700 caaaggttca gtcatcgcca actgcaagat gacaacatgt agatgtgtaa accccccggg 5760 tatcatatcg caaaactatg gagaagccgt gtctctaata gataaacaat catgcaatgt 5820 tttatcctta ggcgggataa ctttaaggct cagtggggaa ttcgatgtaa cttatcataa 5880 gaatatctca atacaagatt ctcaagtaat aataacaggc aatcttgata tctcaactga 5940 gcttgggaat gtcaacaact cgatcagtaa tgctttgaat aagttagagg aaagcaacag 6000 aaaactagac aaagtcaatg tcaaactgac tagcacatct gctctcatta cctatatcgt 6060 tttgactatc atatctcttg tttttggtat acttagcctg attctagcat gctacctaat 6120 gtacaagcaa aaggcgcaac aaaagacctt attatggctt gggaataata ctctagatca 6180 gatgagagcc actacaaaaa tgtgaacaca gatgaggaac gaaggtttcc ctaatagtaa 6240 tttgtgtgaa agttctggta gtctgtcagt tcagagagtt aagaaaaaac taccggttgt 6300 agatgaccaa aggacgatat acgggtagaa cggtaagaga ggccgcccct caattgcgag 6360 ccaggcttca caacctccgt tctaccgctt caccgacaac agtcctcaat catggaccgc 6420 gccgttagcc aagttgcgtt agagaatgat gaaagagagg caaaaaatac atggcgcttg 6480 atattccgga ttgcaatctt attcttaaca gtagtgacct tggctatatc tgtagcctcc 6540 cttttatata gcatgggggc tagcacacct agcgatcttg taggcatacc gactaggatt 6600 tccagggcag aagaaaagat tacatctaca cttggttcca atcaagatgt agtagatagg 6660 atatataagc aagtggccct tgagtctccg ttggcattgt taaatactga gaccacaatt 6720 atgaacgcaa taacatctct ctcttatcag attaatggag ctgcaaacaa cagtgggtgg 6780 ggggcaccta tccatgaccc agattatata ggggggatag gcaaagaact cattgtagat 6840 gatgctagtg atgtcacatc attctatccc tctgcatttc aagaacatct gaattttatc 6900 ccggcgccta ctacaggatc aggttgcact cgaataccct catttgacat gagtgctacc 6960 cattactgct acacccataa tgtaatattg tctggatgca gagatcactc acattcatat 7020 cagtatttag cacttggtgt gctccggaca tctgcaacag ggagggtatt cttttctact 7080 ctgcgttcca tcaacctgga cgacacccaa aatcggaagt cttgcagtgt gagtgcaact 7140 cccctgggtt gtgatatgct gtggtcgaaa gtcacggaga cagaggaaga agattataac 7200 tcagctgtcc ctacgcggat ggtacatggg aggttagggt tcgacggcca gtaccacgaa 7260 aaggacctag atgtcacaac attattcggg gactgggtgg ccaactaccc aggagtaggg 7320 ggtggatctt ttattgacag ccgcgtatgg ttctcagtct acggagggtt aaaacccaat 7380 tcacccagtg acactgtaca ggaagggaaa tatgtgatat acaaggcaaa caatgacaca 7440 tgcccagatg agcaagacta ccagattcga atggccaagt cttcgtataa gcctggacgg 7500 tttggtggga aacgcataca gcaggctatc ttatctatca aggtgtcaac atccttaggc 7560 gaagacccgg tactgactgt accgcccaac acagtcacac tcatgggggc cgaaggcaga 7620 attctcacag tagggacatc tcatttcttg tatcaacgag ggtcatcata cttctctccc 7680 gcgttattat atcctatgac agtcatcaac aaaacagcca ctcttcatag tccttataca 7740 ttcaatgcct tcactcggcc aggtattatc ccttgccagg cttcagcaag atgccccaac 7800 tcgtgtgtta ctggagtcta tacagatcca tatcccctaa tcttctatag aaaccacacc 7860 ttgcgagggg tattcgggac aatgcttgat ggtgtacaag caagacttaa ccctgcgtct 7920 gcagtattcg atagcacatc ccgcagtcgc attactggag tgagttcaag cagtaccaaa 7980 gcagcataca caacatcaac ttgttttaaa gtggtcaaga ctaataagac ctattgtctc 8040 agcattgctg aaatatctaa tactctcttc ggagaattca gaatcgtccc gttactagtt 8100 gagatcctca aagatgacgg ggttagagaa gccaggtctg gctagttgag tcaattataa 8160 aggagttgga aagatggcat tgtatcacct atcttctgcg acatcaagaa tcaaaccgaa 8220 tgccggcgcg tgctcgaatt ccatgttgcc agttgaccac aatcagccag tgctcatgcg 8280 atcagattaa gccttgtcat taatctcttg attaagaaaa aatgtaagtg gcaatgagat 8340 acaaggcaaa acagctcatg gtaaataata cgggtaggac atggcgagct ccggtcctga 8400 aagggcagag catcagatta tcctaccaga gccacacctg tcttcaccat tggtcaagca 8460 caaactactc tattactgga aattaactgg gctaccgctt cctgatgaat gtgacttcga 8520 ccacctcatt ctcagccgac aatggaaaaa aatacttgaa tcggcctctc ctgatactga 8580 gagaatgata aaactcggaa gggcagtaca ccaaactctt aaccacaatt ccagaataac 8640 cggagtgctc caccccaggt gtttagaaca actggctaat attgaggtcc cagattcaac 8700 caacaaattt cggaagattg agaagaagat ccaaattcac aacagaagat atggagaact 8760 gttcacaagg ctgtgtacgc atatagagaa gaaactgctg gggtcatctt ggtctaacaa 8820 tgtcccccgg tcagaggagt tcagcagcat tcgtacggat ccggcattct ggtttcactc 8880 aaaatggtcc acagccaagt ttgcatggct ccatataaaa Cagatccaga ggcatctgat 8940 ggtggcagct aagacaaggt ctgcggccaa caaattggtg atgctaaccc ataaggtagg 9000 ccaagtcttt gtcactcctg aacttgtcgt tgtgacgcat aagaatgata acaagttcac 9060 atgtcttacc cagaaacttg tattgatgta tgcagatatg atggagggca gagatatggt 9120 caacataata tcaaccacgg cggtgcatct cagaagctta tcagagaaaa ttgatgacat 9180 tttgcggtta atagacgctc tggcaaaaga cttgggtaat caagtctacg atgttgtatc 9240 actaatggag ggatttgcat acggagctgt ccagctactc gagccgtcag gtacatttgc 9300 aggagatttc ttcgcattca acctgcagga gcttaaagac attctaattg gcctcctccc 9360 caatgatata gcagaatccg tgactcatgc aatcgctact gtattctctg gtttagaaca 9420 gaatcaagca gctgagatgt tgagtctgtt gcgtctgtgg ggtcacccac tgcttgagtc 9480 ccgtattgca gcaaaggcag tcaggagcca aatgtgcgca ccaaaaatgg tagactttga 9540 tatgatcctt caggtactgt ctttcttcaa gggaacaatc atcaacgggt acagaaagaa 9600 gaatgcaggt gtgtggccgc gagtcaaagt ggatacaata tatgggaagg tcattgggca 9660 actacatgca gattcagcag agatttcaca cgatatcatg ttgagagagt ataagagttt 9720 atctgcactt gaatttgagc catgtatata atatgaccct gtcaccaacc tgagcatgtt 9780 cctaaaagac aaggcaatcg cacaccccaa cgataattgg cttgcctcgt ttaggcggaa 9840 ccttctctcc gaagaccaga agaaacatgt aaaagaagca acttcgacta atcgcctctt 9900 gatagagttt ttagagtcaa atgattttga tccatataaa gagatggaat atctgacgac 9960 ccttgagtac cttagagatg acaatgtggc agtatcatac tcgctcaagg agaaggaagt 10020 gaaagttaat ggacggatct tcgctaagct gacaaagaag ttaaggaact gtcaggtgat 10080 ggcggaaggg atcctagccg atcagattgc acctttcttt cagggaaatg gagtcattca 10140 ggatagcata tccttgacca agagtatgct agcgatgagt caactgtctt ttaacagcaa 10200 taagaaacgt atcactgact gtaaaaaaag agtatcttca aaccgcaatc atgatccgaa 10260 aagcaagaac cgtcggagag ttgcaacctt cataacaact gacctgcaaa agtactgtct 10320

10/22 taattggaga tatcagacaa tcaaattgtt cgctcatgcc atcaatcagt tgatgggcct 10380 acctcacttc ttcgaatgga ttcacctaag actgatggac actacgatgt tcgtaggaga 10440 ccctttcaat cctccaagtg accctactga ctgtgacctc tcaagagtcc ctaataatga 10500 catatatatt gtcagtgcca gagggggtat cgaaggatta tgccagaagc tatggacaat 10560 gatctcaatt gctgcaatcc aacttgctgc agctagatcg cattgtcgtg ttgcctgtat 10620 ggtacagggt gataatcaag taatagcagt aacgagagag gtaagatcag acgactctcc 10680 ggagatggtg ttgacacagt tgcatcaagc cagtgataat ttcttcaagg aattaattca 10740 tgtcaatcat ttgattggcc ataatttgaa ggatcgtgaa accatcaggt cagacacatt 10800 cttcatatac agcaaacgaa tcttcaaaga tggagcaatc ctcagtcaag tcctcaaaaa 10860 ttcatctaaa ttagtgctag tcgtaggtga tctcagtgaa aacaccgtaa tgtcctgtgc 10920 caacattgcc tctactgtag cacggctatg cgagaacggg cttcccaaag acttctgtta 10980 ctatttaaac tatataatga gttgtgtgca gacatacttt gactctgagt tctccatcac 11040 caacaattcg caccccgatc ttaatcagtc gtggattgag gacatctctt ttgtgcactc 11100 atatgttctg actcctgccc aattaggggg actgagtaac cttcaatact caaggctcta 11160 cactagaaat atcggtgacc cggggactac tgcttttgca gagatcaagc gactagaagc 11220 agtgggatta ctgagtccta acattatgac taatatctta actaggccgc ctgggaatgg 11280 agattgggcc agtctgtgca acgacccata ctctttcaat tttgagactg ttgcaagccc 11340 aaatattgtt cttaagaaac atacgcaaag agtcctattt gaaacttgtt caaatccctt 11400 attgtctgga gtgcacacag aggataatga ggcagaagag aaggcattgg ctgaattctt 11460 gcttaatcaa gaggtgattc atccccgcgt tgcgcatgcc atcatggagg caagctctgt 11520 aggtaggaga aagcaaattc aagggcttgt tgacacaaca aacaccgtaa ttaagattgc 11580 gcttactagg aggccattag ggatcaagag gctgatgcgg atagtcaatt attctagcat 11640 gcatgcaatg ctgtttagag acgatgtttt ttcctccagt agatccaacc accccttagt 11700 ctcttctaat atgtgttctc tgacactggc agactatgca cggaatagaa gctggtcacc 11760 tttgacggga ggcaggaaaa tactgggtgt atctaatcct gatacgatag aactcgtaga 11820 gggtgagatt cttagtgtaa gcggatggtg tacaagatgt gacagcggag atgaacaatt 11880 tacttggttc catcttccaa gcaatataga attgaccgat gacaccagca agaatcctcc 11940 gatgagggta ccatatctcg ggtaaaagac acaggagagg agagctgcct cacttgcaaa 12000 aatagctcat atgtcgccac atgtaaaggc tgccctaagg gcatcatccg tgttgatctg 12060 ggcttatggg gataatgaag taaattggac tgctgctctt acgattgcaa aatctcggtg 12120

11/22 taatgtaaac ttaaagtatc tttggttact gtccccttta cccacggctg ggaatcttca 12180 acatagacta gatgatggta taactcagat gacattcacc cctgcatctc tctacaggtg 12240 tcaccttaca ttcacatatc caatgattct caaaggctgt tcactgaaga aggagtcaaa 12300 gaggggaatg tggtttacca acagagttat gctcttgggt ttatctctaa tcgaatcgat 12360 ctttccaatg acaacaacca gaacatatga tgagatcaca ctgcacctac atagtaaatt 12420 tagttgctgt atcagagaag cacctgttgc ggttcctttc gagctacttg gggtggtacc 12480 ggaactgagg acagtgacct caaataagtt tatgtatgat cctagccctg tatcggaggg 12540 agactttgcg agacttgact tagctatctt caagagttat gagcttaatc tggagtcata 12600 tcccacgata gagctaatga acattctttc aatatccagc gggaagttga ttggccagtc 12660 tgtggtttct tatgatgaag atacctccat aaagaatgac gccataatag tgtatgacaa 12720 tacccgaaat tggatcagtg aagctcagaa ttcagatgtg gtccgcctat ttgaatatgc 12780 agcacttgaa gtgctcctcg actgttctta ccaactctat tacctgagag taagaggcct 12840 agacaatatt gtcttatata tgggtgattt atacaagaat atgccaggaa ttctactttc 12900 caacattgca gctacaatat ctcatcccgt cattcattca aggttacatg cagtgggcct 12960 ggtcaaccat gacggatcac accaacttgc agatacggat tttatcgaaa tgtctgcaaa 13020 actattagta tcttgcaccc gacgtgtgat ctccggctta tattcaggaa ataagtatga 13080 tctgctgttc ccatctgtct tagatgataa cctgaatgag aagatgcttc agctgatatc 13140 ccggttatgc tgtctgtaca cggtactctt tgctacaaca agagaaatcc cgaaaataag 13200 aggcttaact gcagaagaga aatgttcaat actcactgag tatttactgt cggatgctgt 13260 gaaaccatta cttagccccg atcaagtgag ctctatcatg tctcctaaca taattacatt 13320 cccagctaat ctgtactaca tgtctcggaa gagcctcaat ttgatcaggg aaagggagga 13380 cagggatact atcctggcgt tgttgttccc ccaagagcca ttattagagt tcccttctgt 13440 gcaagatatt ggtgctcgag tgaaagatcc attcacccga caacctgcgg catttttgca 13500 agagttagat ttgagtgctc cagcaaggta tgacgcattc acacttagtc agattcatcc 13560 tgaactcaca tctccaaatc cggaggaaga ctacttagta cgatacttgt tcagagggat 13620 agggactgca tcttcctctt ggtataaggc atctcatctc ctttctgtac ccgaggtaag 13680 atgtgcaaga cacgggaact ccttatactt agctgaaggg agcggagcca tcatgagtct 13740 tctcgaactg catgtaccac atgaaactat ctattacaat acgctctttt caaatgagat 13800 gaaccccccg caacgacatt tcgggccgac cccaactcag tttttgaatt cggttgttta 13860 taggaatcta caggcggagg taacatgcaa agatggattt gtccaagagt tccgtccatt 13920

12/22 atggagagaa aatacagagg aaagtgacct gacctcagat aaagcagtgg ggtatattac 13980 atctgcagtg ccctacagat ctgtatcatt gctgcattgt gacattgaaa ttcctccagg 14040 gtccaatcaa agcttactag atcaactagc tatcaattta tctctgattg ccatgcattc 14100 tgtaagggag ggcggggtag taatcatcaa agtgttgtat gcaatgggat actactttca 14160 tctactcatg aacttgtttg ctccgtgttc cacaaaagga tatattctct ctaatggtta 14220 tgcatgtcga ggagatatgg agtgttacct ggtatttgtc atgggttacc tgggcgggcc 14280 tacatttgta catgaggtgg tgaggatggc aaaaactctg gtgcagcggc acggtacgct 14340 cttgtctaaa tcagatgaga tcacactgac caggttattc acctcacagc ggcagcgtgt 14400 gacagacatc ctatccagtc ctttaccaag attaataaag tacttgagga agaatattga 14460 cactgcgctg attgaagccg ggggacagcc cgtccgtcca ttctgtgcgg agagtctggt 14520 gagcacgcta gcgaacataa ctcagataac ccagattatc gctagtcaca ttgacacagt 14580 tatccggtct gtgatatata tggaagctga gggtgatctc gctgacacag tatttctatt 14640 taccccttac aatctctcta ctgacgggaa aaagaggaca tcacttatac agtgcacgag 14700 acagatccta gaggttacaa tactaggtct tagagtcgaa aatctcaata aaataggcga 14760 tataatcagc ctagtgctta aaggcatgat ctccatggag gaccttatcc cactaaggac 14820 atacttgaag catagtacct gccctaaata tttgaaggct gtcctaggta ttaccaaact 14880 caaagaaatg tttacagaca cttctgtatt gtacttgact cgtgctcaac aaaaattcta 14940 catgaaaact ataggcaatg cagtcaaagg atattacagt aactgtgact cttaacgaaa 15000 atcacatatt aataggctcc ttttttggcc aattgtattc ttgttgattt aatcatatta 15060 tgttagaaaa aagttgaacc ctgactcctt aggactcgaa ttcgaactca aataaatgtc 15120 ttaaaaaaag gttgcgcaca attattcttg agtgtagtct cgtcattcac caaatctttg 15180 tttggt 15186 <210> 4 <211> 1611 <212> DNA
<213> infectious bronchitis virus (IBV) <400> 4 atgttggtaa cacctctttt actagtgact cttttgtgtg cactatgtag tgctgctttg 60 tatgacagta gttcttacgt gtactactac caaagtgcct tcagaccacc tgatggttgg 120 catttacatg ggggtgcgta tgcggttgtt aatatttcta gtgaatctaa taatgcaggc 180 tcttcatctg ggtgtactgt tggtattatt catggtggtc gtgttgttaa tgcttcttct 240 atagctatga cggcaccgtc atcaggtatg gcttggtcta gcagtcagtt ttgtactgca 300

13/22 tactgtaact tttcagatac tacagtgttt gttacaaatt gttacaaaca tgttgggtgt 360 cctataactg gcatgcttca acagcattct atacgtgttt ctgctatgaa aaatggccag 420 cttttttaga atttaacagt tagtgtagct aagtacccta cttttaaatc atttcagtgt 480 gttaataatt taacatccgt atatttaaat ggtgatcttg tttacacctc taatgagacc 540 acagatgtta catctgcagg tgtttatttt aaagctggtg gacctataac ttataaagtt 600 atgagagaag ttagagccct ggcttatttt gttaatggta ctgcacaaga tgttattttg 660 tgtgatgggt cacctagagg cttgttagca tgccagtata atactggcaa tttttcagat 720 ggcttttatc cttttactaa tagtagttta gttaatggta agtttattgt ctatcgtgaa 780 aatagtgtta atactacttt tacgttacac aatttcactt ttcataatga gactggcgcc 840 aacccaaatc ctagtggtgt ccagaatatt caaacttacc aaacacaaac agctcagagt 900 ggttattata attttaattt ttcctttctg agtagttttg tttataagga gtctaatttt 960 atgtatggat cttatcaccc aagttgtaat tttagactag aaactattaa taatggtttg 1020 tggtttaatt cactttcagt ttcaattgct tacggtcctc ttcaaggtgg ttgcaagcaa 1080 tctgtcttta gtggtagagc aacctgttgt tatgcttact catatggagg tcctttgctg 1140 tgtaaaggtg tttattaagg tgagttagat cataattttg aatgtggact gttagtttat 1200 gttactaaga gcggtggctc tcgtatacaa acagccactg aaccgccagt tataactcaa 1260 cacaattata ataatattac tttaaatact tgtgttgatt ataatatata tggcagaact 1320 ggccaaggtt ttattactaa tgtaaccgac tcagatgtta gttataatta tctagcagac 1380 gcaggtttgg ctattttaga tacatctggt tccatagaca tctttgtcgt acaaagtgaa 1440 tatggtctta attattataa ggttaaccct tgcgaagatg tcaaccagca gtttgtagtt 1500 tctggtggta aattagtagg tattcttact tcacgtaatg agactggttc ccagcttctt 1560 gagaatcagt tttacatcaa aatcactaat ggaacacgtc gttttagacg t 1611 <210> 5 <211> 960 <212> DNA
<213> infectious laryngotracheitis virus (ILTV) <400> 5 ggaggggaga gagacaactt cagctcgaag tctgaagata catcatgagc ggcttcagta 60 acataggatc gattgccacc gtttccctag tatgctcgct tttgtgcgca tctgtattag 120 gggcgccggt actggacggg ctcgagtcga gccctttccc gttcgggggc aaaattatag 180 cccaggcgtg caaccgcacc acgattgagg tgacggtccc gtggagcgac tactctggtc 240

14/22 gcaccgaagg agtgtcagtc gaggtgaaat ggttctacgg gaatagtaat cccgaaagct 300 tcgtgttgag ggtggatagc gaaacgggca gtggacacga ggacctgtct acgtgctggg 360 ctctaatcca taatctgaac gcgtctgtgt gcagggcgtc tgacgccggg atacctgatt 420 tcgacaagca gtgcgaaaaa gtgcagaaaa gactgcgctc cggggtggaa cttggtagtt 480 acgtgtctgg caatggaacc ctggtgctgt acccagggat gtacgatgcc ggcatctacg 540 cctaccagct ctcagtgggt gggaagggat ataccgggtc tgtttatcta gacgtcggac 600 caaaccccgg atgccacgac cagtatgggt acacctatta cagcctggcc gacgaggcgt 660 cagacttatc atcttatgac gtagcctcgc ccgaactcga cggtcctatg gaggaagatt 720 attccaattg tctagacatg cccccgctac gcccatggac aaccgtttgt tcgcatgacg 780 tcgaggagca ggaaaacgcc acggacgagc tttacctatg ggacgaggaa tgcgccggtc 840 cgctggacga gtacgtcgac gaaaggtcag agacgatgcc caggatggtt gtcttttcac 900 cgccctctac gctccagcag tagccacccg agagtgtttt ttgtgagcgc ccacgcaaca 960 <210> 6 <211> 810 <212> DNA
<213> avian encephalomyelitis virus (AEV) <400> 6 gggaaagagg atgaaggagg atttttcagt gtgcctgaag tggagcaaca tgttgttgag 60 gataaggaac cacagggacc tttgcacgtg acaccttttg gcgctgttaa agctatggag 120 gacccccaat tggccaggaa aacacctggc acattccctg aattagctcc tggtaaacct 180 cgacatacag tggaccacat ggatctgtat aagttcatgg ggcgtgccaa ttacttgtgg 240 ggacatgaat tcaccaaaac tgacatgcag tacacattcc agataccatt aagtcccatt 300 aaagagggtt ttgtgacggg tacacttagg tggtttttaa gtcttttcca actgtatcgt 360 ggttctctcg acattaccat gacatttgca ggaaaaacta atgtggatgg cattgtgtac 420 tttgtgcctg agggtgttgc gataaagact gagagggagg agcagacccc tttgctcaca 480 ttgaactata aaacatcggt aggtgccatt aggtttaata ctggacaaac tacgaatgtc 540 cagtttagga tccctttcta cacgccactg gaacacatcg caacccattc taaaaatgcg 600 atggattcag tcttgggggc aatcacaacc cagatcacta actatagtgc tcaggatgag 660 tatttgcagg ttacctacta catcagtttc aatgaagatt cacagttttc tgttcccaga 720 gcggtgccag tggtcagctc attcactgac acatctagca aaacagtgat gaatacatat 780 tggcttgatg atgacgagtt ggtagaagag 810

15/22 <210> 7 <211> 726 <212> DNA
<213> avian encephalomyelitis virus (AEV) <400> 7 atgagcaaac tattttctac tgtaggcagg actgttgatg aggttttttc tgtgctcaat 60 gatgaggata ctgaatctta tgctggccct gatcgcactg cagtagttgg cggaggattt 120 ctgacaacgg tagaccagag ttcagttagc acggctacaa tgggaagttt acaagatgta 180 cagtacagga ctgcagtcga tattcctggt tctagagtga cacaaggtga gaggttcttc 240 cttatcgatc agcgtgagtg gaactcaaca cagagtgaat ggcagttatt gggcaagatt 300 gacatagtaa aagagctgct tgatcagtcg tatgctgttg atggcctttt gaagtaccat 360 tcttatgcaa ggtttggctt ggatgtcatt gttcagatta atccaacatc attccaggca 420 gggggcctca tagcagctct cgtaccttat gaccaggttg acattgaatc aattgttgcc 480 atgaccactt attgccatgg caaggttaat tgcaacataa actacgttgt aaggatgaag 540 gtgccatata tatacagtcg aggttgttac aaccttagga actcagcata ctccatttgg 600 atgcttgtga taagagtgtg gtcacggctg cagttgggat ctggcacttc aacacagatt 660 actatcacca ccttggctag gtttgtggat ttggaactgc atggacttag ccctttggtc 720 gcacag 726 <210> 8 <211> 735 <212> DNA
<213> avian encephalomyelitis virus (AEV) <400> 8 atgatgcgca acgaatttcg actgtcgtca tctagcaaca ttgtcaattt ggctaattat 60 gacgatgcaa gagccaaagt gtctctagcg ctgggacaag aagagttttc cagagactcg 120 tcaagtaccg ggggggaatt ggtgcatcat ttttcacagt ggacgtccat tccgtgcctt 180 gccttcactt ttacattccc cggcacggta gggccaggca ctcacatctg gtcaaccacg 240 gtggaccctt tttcctgtaa cttgagggcg tctagcactg tgcaccccac taacttgagc 300 tcgattgcgg gtatgttctg tttttggaga ggtgacattg tatttgagtt tcaagtcttt 360 tgcaccaagt atcattccgg caggttgatg tttgtgtatg tgcctggcga tgaaaacaca 420 aaaatcagca ccttaactgc aaaacaagca tctactggtc ttactgctgt ttttgatatc 480 aatggtgtaa attcaacact ggtgtttaga tgccctttca tctctgacac accttacagg 540 gtgaatccaa Cgactcataa gtccctctgg ccttatgcaa ctggcaagct tgtgtgctat 600 gtctacaata tactgaacgc acctgccagt gtatcaccaa ccctgcccat taatgtgtac 660

16/22 aaaagtgctg cggatctgga gttgtatgca cctgtttatg gggtttctcc caccaacacc 720 tcaatttttg ttcaa 735 <210> 9 <211> 1500 <212> DNA
<213> avian parainfluenza virus (APV) <400> 9 ggggggtgtg catggtaggg tggggaaggt agccaattcc tgcccattgg gccgaccgta 60 ccaagagaag tcaagagaag tatagatgca gggcgacatg gagggtagcc gtgataacct 120 cacagtagat gatgaattaa agacaacatg gaggttagct tatagagttg tatccctcct 180 attgatggtg agtgccttga taatctctat agtaatcctg acgagagata acagccaaag 240 cataatcacg gcgatcaacc agtcgtatga cgcagactca aagtggcaaa cagggataga 300 agggaaaatc acctcaatca tgactgatac gctcgatacc aggaatgcag ctcttctcca 360 cattccactc cagctcaata cacttgaggc aaacctgttg tccgccctcg gaggttacac 420 gggaattggc cccggagatc tagagcactg tcgttatccg gttcatgact ccgcttacct 480 gcatggagtc aatcgattac tcatcaatca aacagctgac tacacagcag aaggccccct 540 ggatcatgtg aacttcattc cggcaccagt tacgactact ggatgcacaa ggatcccatc 600 cttttctgta tcatcatcca tttggtgcta tacacacaat gtgattgaaa caggttgcaa 660 tgaccactca ggtagtaatc aatatatcag tatgggggtg attaagaggg ctggcaacgg 720 cttaccttac ttctcaacag tcgtgagtaa gtatctgacc gatgggttga atagaaaaag 780 ctgttccgta gctgcgggat ccgggcattg ttacctcctt tgtagcctag tgtcagagcc 840 cgaacctgat gactatgtgt caccagatcc cacaccgatg aggttagggg tgctaacaag 900 ggatgggtct tacactgaac aggtggtacc cgaaagaata tttaagaaca tatggagcgc 960 aaactaccct ggggtagggt caggtgttat agcaggaaat aaggtgttat tcccatttta 1020 cggcggagtg aagaatggat caacccctga ggtgatgaat aggggaagat attactacat 1080 ccaggatcca aatgactatt gccctgaccc gctgcaagat cagatcttaa gggcagaaca 1140 atcgtattat cctactcgat ttggtaggag gatggtaatg cagggagtcc taacatgtcc 1200 agtatccaac aattcaacaa tagcCagcaa atgccaatct tactatttca acaactcatt 1260 aggattcatc ggggcggaat ctaggatcta ttaccttaat ggtaacattt acctttatca 1320 aagaagctcg agctggtggc ctcaccccca aatttaccta cttgattcca ggattgcaag 1380 tccgggtacg cagaacattg actcaggcgt taacctcaag atgttaaatg ttactgtcat 1440

17/22 tacacgacca tcatctggct tttgtaatag tcagtcaaga tgccctaatg actgcttatt 1500 <210> 10 <211> 1440 <212> DNA
<213> hemorrhagic enteritis virus (HEV) <400> 10 gaaatgttaa tgttagacca tactgaccaa ttcctggttc attttagatg gaatcttcga 60 acactgccac tagaattttt gctccaacgg aagggagaaa caatataatt tacagcaact 120 tgcctcctgt tcaagataca accaaaatat tttatataga taacaaggcc attgatatag 180 agtcatataa tcaagagaaa gatcattcta attattatac taatataatt caaacacaga 240 acatttcaac tattgattca agtatacagc aaattcagtt agatgaaagg tctagatggg 300 gaggagaact acatacaagc ttagtaacat ctgttatgaa ttgtactaaa cattttaatt 360 cagataggtg tttagtgaaa attcagacta ttaagagtcc acctacattt gaatggaaag 420 aattgaaaat acctgaggga aactatgttt taaatgagtt tattgattta ttaaatgaag 480 gtattacttc tttatacctt cagtatggca ggcaacaggg tgtacttgaa gaagacatag 540 gaataaaatt tgatactcgc aattttgaaa ttggtaaaga tccaactact aatcttgtta 600 ctcctggtaa atacttgttt aagggttatc atgctgatat aatacttctt cctggttggg 660 ctattgattt ttctttttct agattgggta acattttagg tattagaaaa cgtgagactt 720 ataaagctgg ctttttgatt gaatatgatg acttgacaaa tggtaatatt ccaccactgt 780 tggatgttgc taactataag tctacaagtc aagctaaacc attattacag gatccatctg 840 gcagatctta ccacgttatg gatagtgatt ctaacagacc tgtgactgca tataggtctt 900 ttgttttgtc atataacaat gaaggtgctg caaaattaaa gtttttgatg tgtatgagtg 960 atataacggg gggtctcaat cagctgtatt ggtgtttgcc tgattcttat aaaccgccag 1020 tatcttttaa gcaagaaacg caagtagata aactgcctgt tgttggtatg caactttttt 1080 tcctttttgt ttgtaaatct gtgtattctg gtgctgctgt ttacacacag ttaattgaac 1140 agcagactaa tttgacacaa atttttaaca gatttcatga taatgaaatt ttaaaacaag 1200 ctccatatgt gaatcaagtt ttattggctg aaaatgtgcc cataaatgtt aatcagggaa 1260 caataccaat attttcaact cttccaggag tacagagagt ggttgtggaa gacgatagga 1320 gaagaactgt accctacgtt accaagtcac ttgctacagt atatccgaag gttttgtcta 1380 gcaaaacttt gcaataatgc attctgttgt ttattctcca ggggacagta gaggatgggg 1440 <210> 11 <211> 2995

18/22 <212> DNA
<213> fowlpox virus (FPV) <400> 11 ctcttaattc gtttcaaaaa tgggaaatat ttttaagcct attccaaagg ccgattatca 60 gattgtggaa acagtaccac aaagcttaac agctattaat tctactaatc tttctactta 120 tgaatgtttt aaacgtttaa tagatctagc aaaaaaagag atctacatag ctacgttttg 180 ttgtaaccta agtactaatc ctgagggtac tgacatacta aacagattaa tgaatgtttc 240 gagtaaagtt tctgtatata ttttagtaga tgagagcagt cctcataaag attatgaaaa 300 gattaagtct tcccatatta gttatattaa agtagatata ggtgtgctta ataatgaatc 360 agtagaaaac ttgttaggta atttctgggt agtggataag cttcactttt atataggtag 420 tgcgtctctt atgggaaatg cgctaacaac tattaaaaat atgggcatat attccgaaaa 480 taagtcttta gcaatggatt tatatttcag atcgttggac tataaaatta taagcaagaa 540 aaaatgttta ttctttacca gaatggccac aaagtacaat ttcttcaaaa accataacgg 600 tatattcttt tcagattctc cagaacatat ggtaggtaga aaaagaactt ttgacttgga 660 ttgtgttatt cattatatag acgcggcgaa gtctactata gatctaggaa tagtatcttt 720 tcttcctaca aagagaacaa aagattctat cgtctattgg cctataataa aagatgcatt 780 aatacgggcc gtattagaac gaggtgtcaa actacgagtg ctattaggat tttggaaaaa 840 aacggatgtt atatcaaaag catctataaa aagccttaac gaactaggag ttgaccatat 900 agatatctct actaaagtat ttaggtttcc cgttaattct aaagtagatg atattaataa 960 ttctaaaatg atgattatag atggaaggta tgctcatttt atgactgcta acctagacgg 1020 gtctcatttt aatcaccatg cttttgttag ctttaactgt atggatcaac aatttaaaaa 1080 gaaaatagct gaagtgtttg aaagggactg gatatctcct tacgcaaaag aaatagatat 1140 gtctcaaata tagtatatat gataaaaaga tcctaataaa taaatatagc atggcaataa 1200 tagaacagtt acaatcttct gaacaatcaa tactttcacc gtttagatat tatggtttta 1260 aagattttca taatgtaatt tttaccacaa tagatgacga aacattaata gtaattacag 1320 tcaacaatgt accattagta actaggttaa taacgtttga aaaaataaca ttttttagat 1380 cgtttaatag tacttgtatt ataacttcca acaataattc ggatattgat acagatactt 1440 attttatacc aaattcgtta tcactactag atattttgaa gaaaagagca tatgatgtag 1500 aactaagaga tctattattt gctataatgt cggaaatgaa taagcatgaa ttgagaaata 1560 gtgatattgt atctctaaac aaatggctac ataagcataa tttactagac tacaaattag 1620 tactaataag tgatatcgat agaagatata aattatacaa taaaaaaaat acaataattg 1680

19/22 atgttatatc cgtaaatggt agaaattata atatatgggt taaagatgtt atagaatatt 1740 attcaccgga atacttaaga tggtctatag atattaaaag agccacagaa agtaataact 1800 ggttaccgta tagccagtct ataaaccctt tgaatgaaaa tatatacgct tttgaattta 1860 tagctacttt agaaagatcc aatgagcgct taaatatcgg agcgatattc ctgtatccgg 1920 atataataat tacaggtaga aacaacgaag atataataga aaagttttta gatcagttag 1980 aagaagtaat atataaaaaa aattctgata gtattgtttt aacaggttat catctaacat 2040 ttttagagaa tactatttta gagagatata tcagtaagta taaagacttg atttttacat 2100 gtaatcgtct agtacattgt aaaaccggca ctgaagtatt cttatttgat gccgctatat 2160 tttttccatc ctctaataag aaaggatatg taaaacattg gacaggtaaa aaattaaatt 2220 ttaaaaactt tttccaaaaa gatagtcagc tagaaaaata cataaataat aacagtgtag 2280 cagaacttat atattattta cagtcttctt tacacaagca tatatcctgt ctaatagaaa 2340 ttttgaagtt aaatggattt gattttaatt tttctgggtt gttagatata cttattttca 2400 gtattcgttt taagaataat aatggtaatt actattaccc taaacattct tcagctgtga 2460 atttgatgtt gtcatctatt tacacggact attatgctat tgatgatata gataaagata 2520 gtaagaaact tgtttttaac tctatttttc ctttaataat ggaaggatat taccctgaag 2580 gaaaacctta ttatacgaaa acacccaaag aagggtattt gtcaatatgt ttatgtgatg 2640 tagaaatatc taatgatata aagaatccta tattgtattg taaaaaaaac aagtcagcta 2700 ggaagtttac aggagtattc acatctgtag atatagatac cgctgtaaaa ctaagaggat 2760 ataaaattaa aatattagaa tgtattgaat ggcctaataa aataaaatta ttcgacaata 2820 tatgttatct gaataaatta tttatagaac atcaggatta cacacacgat gaaaaatctt 2880 tacaaggcta tcttttttct tatttactta aaggcaacgt taccgaagat gttttagcta 2940 tgaaaagttg tagaaataat ctttctataa tatcatttat aataagttac tgcag 2995 <210> 12 <211> 35 <212> DNA
<213> artificial sequence <220>
<223> PCR primer, IBS1F' <400> 12 cgggatccgc cgccgccatg ttggtaacac ctctt 35 <210> 13 <211> 29 <212> DNA

20/22 <213> artificial sequence <220>
<223> PCR primer, IBS1R' <400> 13 cggaattctt aacgtctaaa acgacgtgt 29 <210> 14 <211> 38 <212> DNA
<213> artificial sequence <220>
<223> PCR primer, NDF F' <400> 14 cgggatccgc cgccgccatg ggctccagac cttctacc 38 <210> 15 <211> 34 <212> DNA
<213> artificial sequence <220>
<223> PCR primer, NDF R' <400> 15 ccgctcgagt tacatttttg tagtggctct catt 34 <210> 16 <211> 39 <212> DNA
<213> artificial sequence <220>
<223> PCR primer, NDHN F' <400> 16 cgggatccgc cgccgccatg gaccgcgccg ttaggcaag 39 <210> 17 <211> 29 <212> DNA
<213> artificial sequence <220>
<223> PCR primer, NDHN R' <400> 17 gctctagatt actcaactag ccagacctg 29 <210> 18 <211> 35 <212> DNA

21/22 <213> artificial sequence <220>
<223> PCR primer, IBDVP2F' <400> 18 cgggatccgc cgccgccatg acaaacctgc aagat 35 <210> 19 <211> 29 <212> DNA
<213> artificial sequence <220>
<223> PCR primer, IBDVP2R' <400> 19 cggaattctt accttatggc ccggattat 29

22/22

Claims (26)

1. A multiple DNA vaccine for in ovo injection comprising: two or more DNA constructs, each DNA construct expressing an antigenic protein of an avian virus causing avian viral disease in fowl; wherein said antigenic protein of said avian virus is capable of inducing a protective immune response against said avian viral disease in said fowl; and said multiple DNA vaccine is for injection into egg of said fowl, wherein said avian virus is one selected from the group consisting of Marek's disease virus (MDV), infectious vursal disease virus (IBDV), Newcastle disease virus (NDV), infectious bronchitis virus (IBV), infectious laryngotracheitis virus (ILTV), avian encephalomyelitis virus (AEV), avian leukosis virus (ALV), fowlpox virus (FPV), avian parainfluenza virus (APV), duck hepatitis virus (DHV), and hemorrhagic enteritis virus (HEV).

2. The multiple DNA vaccine according to claim 1, wherein each said DNA construct comprises a DNA molecule encoding said antigenic protein of said avian virus and a vector.

3. The multiple DNA vaccine according to claim 2, wherein said vector is a plasmid.

4. The multiple DNA vaccine according to claim 3, wherein said plasmid is one selected from the group consisting of pcDNA3 .TM., pVAXI .TM., pSectag .TM., pTracer .TM., pDisplay .TM., pUCT .TM. system plasmid, and pGEM system plasmid.

5. The multiple DNA vaccine according to claim 3, wherein said plasmid comprises a promoter which is selected from the group consisting of a CMV
promoter, SV40 promoter, RSV promoter, and .beta.-actin promoter.

6. The multiple DNA vaccine according to claim 2, wherein said DNA
molecule is an entire gB gene of Marek's Disease virus (MDV) comprising the DNA sequence of SEQ ID NO:1 or a fragment thereof.

7. The multiple DNA vaccine according to claim 2, wherein said DNA
molecule is an entire VP2 gene of infectious bursal disease virus (IBDV) comprising the DNA sequence of SEQ ID NO:2 or a fragment thereof.

8. The multiple DNA vaccine according to claim 2, wherein said DNA molecule is an entire HN gene of Newcastle disease virus (NDV) comprising the DNA
sequence of bases 6321 to 8319 in SEQ ID NO:3 or a fragment thereof.

9. The multiple DNA vaccine according to claim 2, wherein said DNA molecule is an entire S 1 gene of infectious bronchitis virus (IBV) comprising the DNA
sequence of SEQ ID NO:4 or a fragment thereof.

10. The multiple DNA vaccine according to claim 2, wherein said DNA
molecule is an entire glycoprotein G gene of infectious laryngotracheitis virus (ILTV) comprising the DNA sequence of SEQ ID NO:5 or a fragment thereof.

11. The multiple DNA vaccine according to claim 2, wherein said DNA
molecule is an entire VP1, VP0, or VP3 gene of avian encephalomyelitis virus (AEV) or a fragment therof; wherein said VP1 gene comprises the DNA sequence of SEQ ID NO:6; said VP0 gene comprises the DNA sequence of SEQ ID NO:7;
and said VP3 gene comprises the DNA sequence of SEQ ID NO:8.

12. The multiple DNA vaccine according to claim 2, wherein said DNA
molecule is an entire paraglycoprotein G gene of avian parainfluenza virus (APV) comprising the DNA sequence of SEQ ID NO:9 or a fragment thereof.

13. The multiple DNA vaccine according to claim 2, wherein said DNA
molecule is an entire type A penton base gene of hemorrhagic enteritis virus (HEV) comprising the DNA sequence of SEQ D) NO: 10 or a fragment thereof.

14. The multiple DNA vaccine according to claim 2, wherein said DNA
molecule is an entire envelope antigen gene of fowlpox virus (FPV) comprising the DNA sequence of SEQ ID NO: 11 or a fragment thereof.

15. The multiple DNA vaccine according to claim 1, wherein said multiple DNA vaccine is for injection into an amniotic fluid of said egg.

16. The multiple DNA vaccine according to claim 15, wherein said egg is for fertilization for about 18 days.

17. The multiple DNA vaccine according to claim 1, wherein said DNA
vaccine comprises two DNA constructs, each containing a DNA molecule capable of expressing a gene or a fragment thereof which encodes the antigenic protein of an avian virus, which is, for each DNA construct, independently selected from the group consisting of Marek's disease virus (MDV), infectious vursal disease virus (IBDV), Newcastle disease virus (NDV), infectious bronchitis virus (IBV), infectious laryngotracheitis virus (ILTV), avian encephalomyelitis virus (AEV), avian leukosis virus (ALV), fowlpox virus (FPV), avian parainfluenza virus (APV), duck hepatitis virus (DHV), and hemorrhagic enteritis virus (HEV).

18. The multiple DNA vaccine according to claim 1, wherein said DNA
vaccine comprises three or more DNA constructs, each containing a DNA
molecule capable of expressing a gene or a fragment thereof which encodes the antigenic protein of an avian virus, which is, for each DNA construct, independently selected from the group consisting of Marek's disease virus (MDV), infectious vursal disease virus (IBDV), Newcastle disease virus (NDV), infectious bronchitis virus (IBV), infectious laryngotracheitis virus (ILTV), avian encephalomyelitis virus (AEV), avian leukosis virus (ALV), fowlpox virus (FPV), avian parainfluenza virus (APV), duck hepatitis virus (DHV), and hemorrhagic enteritis virus (HEV).

19. The multiple DNA vaccine according to claim 1, wherein said fowl is one selected from the group consisting of chicken, turkey, duck, and goose.

20. A use of said multiple DNA vaccine according to claim 1 for vaccinating fowl egg by injection into said fowl egg.

21. A method for preparing said multiple DNA vaccine according to claim 1 comprising ligating a DNA molecule to a plasmid to form a DNA construct;
mixing two or more said DNA constructs to form said multiple DNA vaccine; wherein said DNA molecule comprises a gene or a fragment thereof which encodes the antigenic protein of an avian virus, which is selected from the group consisting of Marek's disease virus (MDV), infectious vursal disease virus (IBDV), Newcastle disease virus (NDV), infectious bronchitis virus (IBV), infectious laryngotracheitis virus (ILTV), avian encephalomyelitis virus (AEV), avian leukosis virus (ALV), fowlpox virus (FPV), avian parainfluenza virus (APV), duck hepatitis virus (DHV), and hemorrhagic enteritis virus (HEV).

22. A multivalent DNA vaccine for in ovo injection comprising: a DNA
construct containing two or more DNA molecules, wherein each of said DNA
molecules express an antigenic protein of an avian virus causing avian viral disease in fowl; wherein said antigenic protein of said avian virus is capable of inducing a protective immune response against said avian viral disease in said fowl; and said multivalent DNA vaccine is for injection into egg of said fowl, which encodes the antigenic protein of an avian virus, which is, for each DNA
construct, independently selected from the group consisting of Marek's disease virus (MDV), infectious vursal disease virus (IBDV), Newcastle disease virus (NDV), infectious bronchitis virus (IBV), infectious laryngotracheitis virus (ILTV), avian encephalomyelitis virus (AEV), avian leukosis virus (ALV), fowlpox virus (FPV), avian parainfluenza virus (APV) duck hepatitis virus (DHV), and hemorrhagic enteritis virus (HEV).

23. The multivalent DNA vaccine according to claim 22, wherein said DNA
construct further comprises a plasmid.

24. The multivalent DNA vaccine according to claim 23, wherein said plasmid is one selected from the group consisting of pcDNA3 .TM., pVAX1 .TM., pSectag .TM., pTracer .TM., pDisplay .TM., pUC .TM. system plasmid, and pGEM
system plasmid.

25. The multiple DNA vaccine according to claim 23, wherein said plasmid comprises a promoter which is selected from the group consisting of a CMV
promoter, SV40 promoter, RSV promoter, and,.beta.-actin promoter.

26. A use of said multivalent DNA vaccine according to claim 22 for vaccinating fowl egg by injection into said fowl egg.