CN103374074A - Anti-CD25 single-chain antibody - Google Patents
Anti-CD25 single-chain antibody Download PDFInfo
- Publication number
- CN103374074A CN103374074A CN201310152834XA CN201310152834A CN103374074A CN 103374074 A CN103374074 A CN 103374074A CN 201310152834X A CN201310152834X A CN 201310152834XA CN 201310152834 A CN201310152834 A CN 201310152834A CN 103374074 A CN103374074 A CN 103374074A
- Authority
- CN
- China
- Prior art keywords
- chain antibody
- gly
- seq
- aminoacid sequence
- polypeptide
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Abstract
The invention relates to an anti-CD25 single-chain antibody. A novel monoclonal-antibody medicament is prepared by constructing amino acid sequences of a heavy chain variable region (VH) and a light chain variable region (VL) of the anti-CD25 monoclonal-antibody medicament daclizumab efficiently on a small scale at low cost.
Description
Technical field
The invention belongs to biotechnology and field of immunology; More specifically, the present invention relates to a kind of anti-CD 25 single-chain antibody.
Background technology
CD25 is the α subunit of human interleukin-12 (IL2) acceptor, and IL-2 is cytokine important in the immunne response, and its acceptor is comprised of α, β, three subunits of γ; Independent α subunit is the medium avidity acceptor of IL-2, when α subunit and β γ heterodimer combine the acceptor that has just consisted of complete high-affinity, accept the signal of IL-2, activated T lymphocytes begins mitotic division, thereby CD25 mainly participates in activation and the immune activation of T cell, initial various immunne responses and immune graft-rejection.In addition, the overactivity of T cell can cause that T cell proliferation is out of hand and causes t cell lymphoma.The molecular mechanism of CD25 identification IL-2 has at first been reported in K.C.Garcia laboratories in 2003, demonstrates upper two the discontinuous regional 25-43 of CD25 and 118-120 and has participated in interaction with IL-2; And IL-2 has been reported in this laboratory subsequently, the tetraplex structure of the β of CD25 and IL-2 acceptor and γ subunit, CD25 has played Main Function in the combination of IL-2 in structure, β and γ subunit then mainly are responsible for assisting CD25 to the combination of IL-2, so that the IL-2 molecule of combination is more stable.Thereby might block the signal path of IL-2 to the blocking-up of CD25.In existing epi-position research, it is found that has three epi-position: A, B and C on the CD25 molecule.Wherein the antibody of B epi-position and C epi-position can't effectively be blocked the IL-2 signal path, for the A epi-position namely the antibody of Tac epi-position then can effectively block the IL-2 signal path, blocking t cell activates, the activation of Immunosuppression system, thereby in organ transplantation, can effectively reduce immune graft-rejection, these antibody also have significant curative effect in the treatment of t cell lymphoma.
Daclizumab (Roche company) is exactly the Typical Representative in the above-mentioned antibody class medicine.It originates from the antibody anti-TAC of the ancient anti-human CD25 of a strain, and humanized anti-TAC is the common research and development of Protein Design company and Roche company, went on the market by authentication in 1997, and be the humanized antibody of the first listing.Daclizumab relies on and to have blocked the signal path of CD25 with the combination of Tac epi-position differential high efficient, thereby plays good immunosuppressive action in organ transplantation.
But general monoclonal antibody targeted drug is because molecular weight is excessive, and immunogenicity is strong, causes clinical effectiveness not good enough.Simultaneously, the monoclonal antibody medicine production cost is high, is unfavorable for the scale operation of medicine.Therefore, be necessary the monoclonal antibody of development and improvement.
Summary of the invention
The object of the present invention is to provide a kind of anti-CD 25 single-chain antibody.
In a first aspect of the present invention, a kind of anti-CD 25 single-chain antibody is provided, it has:
(1) aminoacid sequence or its varient shown in the 1-114 position among the SEQ ID NO:2;
(2) aminoacid sequence or its varient shown in the 130-235 position among the SEQ ID NO:2;
And with (1) be connected 2) connection peptides that connects, length 4-30 amino acid.
In a preference, the varient of A is: aminoacid sequence is shown in 1-114 position among the SEQ ID NO:2, and the 54th or the 55th polypeptide that sports basic aminoacids; Or
(1) varient described in is: aminoacid sequence is shown in 130-235 position among the SEQ ID NO:2, and the 220th polypeptide that sports basic aminoacids.
In another preference, the varient of A is selected from: aminoacid sequence is shown in 1-114 position among the SEQ ID NO:2 and the 54th polypeptide that is sported Lys (K) by Ser (S); Aminoacid sequence is shown in 1-114 position among the SEQ ID NO:2 and the 55th polypeptide that is sported Arg (R) by Thr (T); Aminoacid sequence shown in 1-114 position among the SEQ ID NO:2 and the 54th by Ser(S) sport Lys(K), the 55th by Thr(T) sport Arg(R) polypeptide; Or
(2) varient described in is selected from: aminoacid sequence is shown in 130-235 position among the SEQ ID NO:2 and the 220th polypeptide that is sported Lys (K) by Ser (S); Aminoacid sequence is shown in 130-235 position among the SEQ ID NO:2 and the 220th polypeptide that is sported Arg (R) by Ser (S).
In another preference, described connection peptides is selected from (but being not limited to): Gly-Gly-Gly-Gly-Ser, (Gly-Gly-Gly-Gly-Ser)
2Or (Gly-Gly-Gly-Gly-Ser)
3
The polynucleotide of the arbitrary described anti-CD 25 single-chain antibody in coding front are provided in another aspect of this invention.
In a preference, described polynucleotide have the nucleotide sequence shown in the SEQ ID NO:2.
In another preference, described nucleotide sequence is codon optimized nucleotide sequence.
In another aspect of this invention, provide a kind of expression vector, it comprises described polynucleotide.
In another preference, described expression vector is prokaryotic expression carrier.
In another preference, described expression vector is the pET22b carrier.
In another aspect of this invention, provide a kind of host cell, it comprises described expression vector, or is integrated with described polynucleotide in its genome.
In another preference, described host cell is intestinal bacteria.
In another aspect of this invention, provide a kind of method for preparing described anti-CD 25 single-chain antibody, comprising: cultivate described host cell, thereby express described anti-CD 25 single-chain antibody.
In another preference, the anti-CD 25 single-chain antibody of prepared acquisition is solubility.
In another preference, also comprise the process of separating anti-CD 25 single-chain antibody, comprising: with the impurity albumen in the nickel ion affinity chromatograph technology removal intestinal bacteria lysate, then obtain the anti-CD 25 single-chain antibody of free state with the gel-filtration technology.
In another aspect of this invention, provide the purposes of described anti-CD 25 single-chain antibody, for the preparation of the medicine of Immunosuppression transplant rejection; Or for the preparation of the targeted drug of selectively targeted CD25 antigen.
In another aspect of this invention, provide a kind of pharmaceutical composition, it comprises:
The arbitrary described anti-CD 25 single-chain antibody in the front of significant quantity; And
Pharmaceutically acceptable carrier.
In another aspect of this invention, provide a kind of targeted drug of selectively targeted CD25 antigen, it comprises: the arbitrary described anti-CD 25 single-chain antibody in front, and be attached thereto, the functional medicine of coupling or absorption.
Other side of the present invention is because the disclosure of this paper is apparent to those skilled in the art.
Description of drawings
Fig. 1, single-chain antibody gene sequence.
Fig. 2, single-chain antibody aminoacid sequence.
The pcr amplification electrophoresis result of Fig. 3, single-chain antibody gene fragment.
Wherein: A.DNA molecular weight standard DL2000;
B. anti-CD 25 single-chain antibody gene fragment (about 720bp).
Fig. 4, single-chain antibody Expression in Escherichia coli.
Wherein: A. molecular weight of albumen standard;
B. induce the whole protein of bacterium;
C. induce bacterium lysate precipitation;
D. induce bacterium lysate supernatant.
Fig. 5, single-chain antibody nickel ion affinity chromatograph purifying.
Wherein: A. molecular weight of albumen standard;
B. induce bacterium lysate supernatant;
C. affinity chromatography prick post liquid;
D. affinity chromatography scavenging solution;
E. affinity chromatography elutriant.
Fig. 6, dynamic light scattering (DLS) are identified single-chain antibody solution phase gathering state.
Wherein: A.MW=34kDa, Pd%=6.3.
Fig. 7, surface plasma resonance (SPR) are measured single-chain antibody in conjunction with activity.
The composite structure of Fig. 8, Daclizumab Fab and CD25 extracellular region.The Fab heavy chain is green, and light chain is yellow.The upper selected mutating acid of scFv marks.
Fig. 9, surface plasma resonance (SPR) are measured 4 kinds of single-chain antibody mutant avidity and are changed.
Figure 10, surface plasma resonance (SPR) are measured the scFv avidity variation after connection peptides is changed into (Gly Gly Gly Gly Ser).
Figure 11, surface plasma resonance (SPR) are measured connection peptides and are changed into (Gly Gly Gly Gly Ser)
2After scFv avidity change.
Embodiment
The inventor is through deep research, at the variable region of heavy chain (V of Anti-CD25 monoclonal antibody medicine Daclizumab
H) and variable region of light chain (V
L) carry out the sequence transformation on the basis of aminoacid sequence, from the development of the aspects such as miniaturization, high efficiency, cost degradation, obtained novel monoclonal antibody medicine.
Term
As used herein, described " single-chain antibody (Single chain Fv, scFv) " is the variable region of heavy chain (V by immunoglobulin (Ig)
H) and variable region of light chain (V
L) by the recombinant protein that one section connection peptides is formed by connecting, it is the minimum antibody fragment with complete antigen binding site.
As used herein, described " basic aminoacids " refers to that the amino number that can dissociate is more than the amino acid of the carboxyl number (iso-electric point is greater than 7.0) that can dissociate.Described basic aminoacids is selected from: arginine, Methionin, Histidine.
As used herein, term " connection peptides " (linker) refers to be positioned at small peptide between the light variable region (or its varient) of the variable region of heavy chain (or its varient) of antibody and antibody, that play ligation, it can make heavily, variable region of light chain freely folds, make antigen binding site be in suitable configuration, do not cause that molecular dynamics changes.Usually, connection peptides does not affect or not remarkably influenced variable region of heavy chain (V
H) and variable region of light chain (V
L) aminoacid sequence forms correct folding and space conformation; Perhaps, connection peptides has consisted of variable region of heavy chain (V
H) and variable region of light chain (V
L) between flexibly connect and be conducive to the normal folding of them.
As used herein, term " targeted drug " refers to the targeted drug of selectively targeted CD25 antigen, and it includes single-chain antibody of the present invention.
As used herein, " operationally being connected in " refers to a kind of like this situation, and namely some part of linear DNA sequence can affect the activity of same other parts of linear DNA sequence.For example, if signal peptide DNA as precursor expression and participate in the secretion of polypeptide, signal peptide (secretion leader sequence) DNA operationally is connected in polypeptid DNA so; If transcribing of promotor control sequence, it is operationally to be connected in encoding sequence so; When if ribosome bind site is placed in the position that can make its translation, it is operationally to be connected in encoding sequence so.Generally, " operationally being connected in " means adjoining, then means in reading frame adjacent for the secretion leader sequence.
Single-chain antibody
The invention provides a kind of single-chain antibody, described single-chain antibody contains the variable region of heavy chain (V of Daclizumab
H) and variable region of light chain (V
L) structure.
Preferably, the variable region of heavy chain (V of described Daclizumab
H) have an aminoacid sequence shown in the 1-114 position among the SEQ ID NO:2; Variable region of light chain (the V of described Daclizumab
L) have an aminoacid sequence shown in the 130-235 position among the SEQ ID NO:2.More preferably, also comprise connection peptides between heavy chain and the light chain, such as the connection peptides of 4-30aa.
The present invention also comprises varient, derivative and the analogue of described single-chain antibody.As used herein, term " varient ", " derivative " refer to basically keep the identical biological function of single-chain antibody of the present invention or active polypeptide with " analogue ".Polypeptide variants of the present invention, derivative or analogue can be that (i) has one or more conservative or substituted polypeptide of non-conservation amino-acid residue (preferred conservative amino acid residue), and the amino-acid residue of such replacement can be also can not encoded by genetic code, or (ii) in one or more amino-acid residues, has a polypeptide of substituted radical, or (iii) additional aminoacid sequence is fused to this peptide sequence and the polypeptide that forms (such as leader sequence or secretion sequence or be used for sequence or the propolypeptide sequence of this polypeptide of purifying or fusion polypeptide).These varients of definition, derivative and analogue according to this paper belong to the known scope of those skilled in the art.
In the present invention, term " single-chain antibody " refers to have the polypeptide of the SEQ ID NO:2 sequence of specific binding CD25 antigen function.This term also comprises having variant form specific binding CD25 antigen function, SEQ ID NO:2 sequence.These variant forms comprise (but being not limited to): several (are generally 1-50, preferably 1-30, more preferably 1-20,1-10 best, also better for 1-8 or 1-5) amino acid whose disappearance, insertion and/or replacement, and add or lack one or several (being generally in 20, preferably is in 10, more preferably is in 5) amino acid at C-terminal and/or N-terminal.For example, in the art, when replacing with the close or similar amino acid of performance, usually can not change the function of protein.Again such as, add or reduce the function that or several amino acid also can not change protein usually at C-terminal and/or N-terminal.
The present invention also provides the analogue of single-chain antibody.The difference of these analogues and natural single-chain antibody can be the difference on the aminoacid sequence, also can be the difference that does not affect on the modified forms of sequence, perhaps haves both at the same time.These polypeptide comprise genetic variant natural or that induce.The induce variation body can obtain by various technology, as by radiation or be exposed to mutagenic compound and produce random mutagenesis, also can pass through site-directed mutagenesis method or the biological technology of other known moleculars.Analogue also comprises having the analogue that is different from the amino acid whose residue of natural L-(such as D-amino acid), and the analogue with that non-natural exists or synthetic amino acid (such as β, gamma-amino acid).Should be understood that polypeptide of the present invention is not limited to the above-mentioned representational polypeptide that exemplifies.
As optimal way of the present invention, described single-chain antibody is the single-chain antibody antibody that variable region of heavy chain is undergone mutation, and preferably, sudden change occurs in the 54th of SEQ ID NO:2, the 55th, sports the polypeptide of basic aminoacids.More preferably, the 54th polypeptide that is sported Lys (K) by Ser (S); The 55th sports Arg (R) by Thr (T).
As optimal way of the present invention, described single-chain antibody is the single-chain antibody antibody that variable region of light chain is undergone mutation, and preferably, sudden change occurs in the 220th of SEQ ID NO:2, sports the polypeptide of basic aminoacids.More preferably, the 220th polypeptide that is sported Lys (K) by Ser (S); The 220th sports Arg (R) by Ser (S).
In addition, aminoterminal or the carboxyl terminal at described single-chain antibody also can add the aminoacid sequence of other activity that does not basically affect single-chain antibody of the present invention, expression amount and stability.Preferably, the aminoacid sequence of these interpolations is conducive to express (such as signal peptide), is conducive to purifying (such as 6 * His sequence), or other can promote the sequence of activity, expression amount or the stability of described single-chain antibody.
The present invention also comprises the dna molecular of coding single-chain antibody of the present invention or its varient, derivative.Described dna molecular is synthetic all, and also the method for available pcr amplification obtains.
In order further to improve the expression amount of host cell, can transform the encoding sequence of single-chain antibody of the present invention, for example adopt the codon of host cell preference, eliminate the sequence that is unfavorable for genetic transcription and translation.
Described single-chain antibody has many advantages, comprising: (a) molecule is little, and immunogenicity is low, is used for human body and is difficult for producing anti-foreign protein reaction; (b) enter easily the microcirculation on every side of target spot tissue; Circulation of blood and whole body are cleaned up soon, and the transformation period is short, and kidney is accumulated seldom; (c) without the Fc section, be difficult for being combined imaging clearly with the non-target cell with Fc acceptor; (d) be easy to genetic manipulation and genetically engineered is produced in a large number.
The expression of single-chain antibody
After having obtained code book and having invented the dna sequence dna of new single-chain antibody or its varient, derivative, it is cloned into suitable expression vector, change again the appropriate host cell over to.At last, cultivate the host cell after transforming, obtain new single-chain antibody of the present invention by separation and purification.
As used herein, term " carrier " comprises plasmid, clay, expression vector, cloning vector, virus vector etc.
In the present invention, can select various carrier known in the art.Such as, select commercially available carrier, the nucleotide sequence of then code book being invented new single-chain antibody operationally is connected in expression regulation sequence, can form expression vector.
In the present invention, term " host cell " comprises prokaryotic cell prokaryocyte and eukaryotic cell.The example of prokaryotic host cell commonly used comprises intestinal bacteria, Bacillus subtilus etc.The host cell that is used for the expression single-chain antibody comprises intestinal bacteria, yeast cell, insect cell, COS cell, Chinese hamster ovary celI etc.Preferably, this host cell is prokaryotic cell prokaryocyte, more preferably is Bacillus coli cells.
After obtaining the host cell that transforms, can under the condition that is fit to expression single-chain antibody of the present invention, cultivate this cell, thereby give expression to single-chain antibody; And then isolate the single-chain antibody of expression.
In an embodiment of the present invention, according to the variable region of heavy chain (V of Anti-CD25 monoclonal antibody medicine Daclizumab
H) and variable region of light chain (V
L) aminoacid sequence, by codon optimized, made up the single-chain antibody gene of the anti-CD25 of suitable solubility expression.This gene clone transforms intestinal bacteria to the pET22b carrier, solubility expression manufacture order chain antibody, and process affinity chromatography and gel-filtration purification step can obtain the single-chain antibody of homogeneous free state.Surface plasma resonance experimental results show that this single-chain antibody has still kept the avidity with CD25 antigen height, therefore is expected to become reduce body to implanting the miniaturization monoclonal antibody medicine of organ rejection response.
Connection peptides
" connection peptides (linker) " refers to small peptide between variable region of heavy chain and variable region of light chain or its varient analogue, that play ligation.The length of connection peptides is not particularly limited, as long as it can make weight, variable region of light chain freely fold, makes antigen binding site be in suitable configuration, does not cause that molecular dynamics changes.For example, the length of connection peptides also can be 4-30aa, and this moment, each Exendin-4 polypeptide or its analogue directly linked to each other.Connection peptides can have multiple choices, for example is selected from:
(a) (Asp
4LysGluSerAsp
4Lys)
m, wherein m=1-3 (preferably, m=1);
(b) (Met)
t, wherein, t=1-5 (preferably, t=1-3; Most preferred, t=1);
(c) (Gly-Gly-Gly-Gly-Ser)
h, h is 1-5.Or
(d) by (a), (b) or the aminoacid sequence that (c) is combined to form.
More preferably, single-chain antibody of the present invention contains (Gly-Gly-Gly-Gly-Ser)
hConnection peptides; More preferably, h=1-3; Best, h=1-2.
The purposes of single-chain antibody and composition thereof
The invention provides the purposes of described single-chain antibody, it can be used to prepare the medicine of Immunosuppression transplant rejection; Or for the preparation of the targeted drug of selectively targeted CD25 antigen.
The present invention also provides a kind of composition, and it contains the described single-chain antibody of significant quantity (such as 0.0001-10wt%), and pharmaceutically acceptable carrier.
Composition of the present invention can be directly used in prevention or the treatment of immune transplant rejection.In addition, also can unite use with other therapeutical agent or assistant agent simultaneously.
Usually, single-chain antibody of the present invention can be formulated in nontoxic, inertia with pharmaceutically acceptable aqueous carrier medium in, wherein pH is about 5-8 usually, preferably, pH is about 6-8.
As used herein, term " significant quantity " or " effective dose " refer to and can produce function or amount active and that can be accepted by people and/or animal to people and/or animal.
As used herein, the composition of " pharmaceutically acceptable " is applicable to people and/or Mammals and without excessive bad side reaction (such as toxicity, stimulation and transformation reactions), namely has the material of rational benefit/risk ratio.Term " pharmaceutically acceptable carrier " refers to be used for the treatment of the carrier of agent administration, comprises various vehicle and thinner.This term refers to like this some medicament carriers: they itself are not necessary activeconstituents, and do not have undue toxicity after using.Suitable carrier is well known to those of ordinary skill in the art.In Remington ' s Pharmaceutical Sciences (Mack Pub.Co., N.J.1991), can find proving absolutely about pharmaceutically acceptable carrier.Acceptable carrier can contain liquid on combination of traditional Chinese medicine is learned, such as water, salt solution, glycerine and ethanol.In addition, also may there be complementary material in these carriers, such as lubricant, glidant, wetting agent or emulsifying agent, pH buffer substance etc.
Composition of the present invention contains described single-chain antibody and the pharmaceutically acceptable carrier of safe and effective amount.This class carrier comprises (but being not limited to): salt solution, damping fluid, glucose, water, glycerine, ethanol and combination thereof.Usually pharmaceutical preparation should be complementary with administering mode, and pharmaceutical composition of the present invention can be made into the injection form, for example with physiological saline or contain glucose and the aqueous solution of other assistant agents is prepared by ordinary method.Described pharmaceutical composition should be made under aseptic condition.The dosage of activeconstituents is the treatment significant quantity.Pharmaceutical preparation of the present invention also can be made into sustained release preparation.
Targeted drug
The present invention also provides a kind of targeted drug of selectively targeted CD25 antigen, and it comprises: described anti-CD 25 single-chain antibody, and be attached thereto, the functional medicine of coupling or absorption.Described targeted drug can mix to be prepared into composition with pharmaceutically acceptable carrier.
The functional medicine that is suitable for treating and/or preventing can be other binding molecule of toxin or its funtion part, radio isotope, prodrug, microbiotic, enzyme (such as saccharase), cytokine, enhancing phagolysis or immunostimulation.
In addition, described single-chain antibody can also with etc. the effect molecule construction become multiple bifunctional antibody molecule, single-chain antibody also is the ideal element that makes up bi-specific antibody, is used for clinical diagnosis and the treatment of disease.
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used for explanation the present invention and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example is write according to normal condition such as J. Pehanorm Brooker etc. usually, molecular cloning experiment guide, Science Press, the condition described in 2002, or the condition of advising according to manufacturer.Unless otherwise indicated, otherwise per-cent and umber calculate by weight.
The structure of embodiment 1, anti-CD 25 single-chain antibody gene
This single-chain antibody is the variable region of heavy chain (V with Daclizumab
H) 1～114 and variable region of light chain (V
L) 1～106 aminoacid sequence is as template, and is middle by constituting (Gly Gly Gly Gly Ser)
3Linker connect and form, variable region of heavy chain (V wherein
H) 1～114 be positioned at N end, variable region of light chain (V
L) 1～106 be positioned at C end.In order to realize more preferably expressing, this aminoacid sequence has passed through the optimization of codon when being converted into gene order, and rely on full gene synthesis technology (Shanghai is given birth to worker bio-engineering corporation and provided) finally to obtain the encoding gene of single-chain antibody, this full length gene 708bp (Fig. 1, SEQ ID NO:1), 235 amino acid (Fig. 2, SEQ ID NO:2) of encoding.This gene fragment is loaded in the Nde I/XhoI restriction enzyme site of pBluescript plasmid, consists of pBluescript-scFv.
The structure of embodiment 2, single-chain antibody colibacillus expression plasmid
Following primer is provided:
DACF (scFv5 ' the end primer): 5 ' CGC
CATATGCAAGTACAGCTGGTACAA3 ';
NdeⅠ
DACR (scFv3 ' the end primer): 5 ' ATA
CTCGAGTTTAACTTCAACCTTAGTGC3 '.
XhoⅠ
Take pBluescript-scFv as template, DACF (SEQ ID NO:3), DACR (SEQ ID NO:4) carry out pcr amplification for primer, such as Fig. 3, obtain the scFv gene fragment of long 723bp, carry out double digestion with Nde I and Xho I after the separation and purification, enzyme is connected with the plasmid pET22b (Novagen) that is connected with Xho I enzyme through the Nde I after cutting product purification, obtain recombinant plasmid pET22b-scFv, give birth to worker bio-engineering corporation by Shanghai and carry out sequencing, gene fragment is inserted correct.
Expressive host bacterium used in the present invention is Escherichia coli BL21 (DE3).Expression plasmid pET22b-scFv transformed competence colibacillus bacterial strain, with LB culture medium flat plate screening recombinant conversion that contains penbritin and paraxin, the picking transformant is seeded in the 1L LB substratum.37 ℃ of shaking culture were about 0.6 to OD600, and adding final concentration is the isopropyl-β-D-thiogalactoside(IPTG) (IPTG) of 0.5mM, in 16 ℃ of shaking culture 24 hours.Centrifugal collection bacterial sediment.Ultrasonic degradation thalline, high speed centrifugation get supernatant and precipitation is done the SDS-PAGE analysis, and soluble scFv has the expression of a large amount, such as Fig. 4.
The purifying of embodiment 4, single-chain antibody
Bacterial lysate and an amount of nickel ion affinity chromatograph filler (Ni-NTA superflow, provided by QIAGEN company) in conjunction with about 4 hours, the sedimentation filler, supernatant discarded is with cleaning buffer solution (20mM HEPES pH7.4,0.5M NaCl, the 20mM imidazoles) cleans to flowing out without albumen, then use elution buffer (20mM HEPES pH7.4,0.5M NaCl, the 500mM imidazoles) collects scFv, such as Fig. 5.Elutriant is after concentrating, at purifying damping fluid (20mM HEPES pH7.4,0.5M NaCl) under the environment by gel-filtration (Superdex G75, provided by GE Healthcare company), collect the albumen of 60ml place peak position, analyze through SDS-PAGE and successfully obtain highly purified scFv albumen.ScFv albumen presents the free state of homogeneous in 20 ℃ of lower these solution environmentals of utilization dynamic light scattering (DLS) technical evaluation, such as Fig. 6.
The mensuration of embodiment 5, single-chain antibody biologic activity
The present invention is by the binding kinetics research of surface plasma resonance (SPR) technology realization scFv and CD25 extracellular domain fragment, and this experiment is to finish at Biacore T100 (GE Healthcare provides) under 25 ℃.
CD25 extracellular domain fragment (the 1-217 position of aminoacid sequence shown in the GenBank accession number AAA59142.1) is fixed on the CM5 chip by amino coupled test kit (GE Healthcare provides).The scFv that purifying obtains carries out the combination experiment as moving phase behind HBS damping fluid (0.01M HEPES, pH7.4,0.15M NaCl, 3mM EDTA, 0.005%Surfactant P20) gradient dilution.After scFv was combined 180 seconds with CD25, with HBS damping fluid flushing 900 seconds, observe its dissociation process.Experimental data is analyzed by the Biacore T100 Evaluation software that GE Healthcare provides, and such as Fig. 7, adopts the 1:1 combination model to carry out match, calculates at last the dissociation constant (K of scFv and CD25 extracellular domain fragment
DValue) be 1.5 * 10
-8M, wherein association rate is 1.3 * 10
5(1/Ms), dissociation rate is 2.0 * 10
-3(1/s), has similar binding ability (1.0 * 10 to the Fab of bibliographical information Daclizumab
-8M), visible scFv has kept same high-affinity.
The foundation of embodiment 6, mutant single-chain antibody, screening high reactivity mutant
The inventor has successfully resolved the compound crystal structure of Fab and the CD25 extracellular region protein of Daclizumab, such as Fig. 8.This avidity transformation for single-chain antibody provides accurate architecture basics.From the compound crystal structure, can observe 5 CDR districts formations of Daclizumab by the pocket of two hydrophobic alkalescence that flank.Be rich in the N end of acidic amino acid (Glu1 is to Asp6) and the alkaline pocket on the Fab on the CD25 and have strong interaction, hydrogen bond quantity wherein accounts for all and forms the over half of hydrogen bonds, and nearly 1/3 hydrophobic interaction power is provided.The hydrophobic region of both sides then mainly provides the hydrophobic interaction with CD25.The site that we suddenly change mainly is chosen in the hydrophobic region of both sides, major cause is the interference of avoiding on the one hand the existing hydrogen bond network of alkaline pocket, by in interactions such as the stronger hydrogen bond of both sides introducing effect or salt bridges, can enlarge the network of strong interaction on the other hand.There are some acid amino acid (Glu1, Asp6, Glu9 at the CD25 near the hydrophobic flank of Fab, Glu22), some amino acid so the inventor has suddenlyd change on some hydrophobic flanks make it be with alkaline electric charge, thereby make up hydrogen bond or the salt bridge interaction new with CD25.
The structure of mutant single-chain antibody carries out with conventional site-directed mutagenesis technique, summary is: take the wild-type single-chain antibody plasmid that builds as template, design is with the primer of mutating alkali yl, obtain mutant plasmid by the full plasmid of PCR reaction amplification, remove template plasmid by the DpnI enzymic digestion subsequently, Transformed E scherichia coli BL21 (DE3) bacterium gets final product.Expression afterwards, purification step are identical with wild-type protein.
The mutant that sudden change obtains is verified by SPR.The SPR experimental technique is with embodiment 5.
At last, the inventor has obtained 2 mutational sites and has been positioned at the mutant of heavy chain (based on the sequence of SEQ ID NO:2, the 54th sports the mutant of K (S54K), the 55th mutant that is sported R (T55R) by T by S) increased the association rate of single-chain antibody for the CD25 extracellular region.Wherein the association rate of mutant S54K is from 1.3 * 10
5(1/Ms) be increased to 3.2 * 10
5(1/Ms), dissociation rate is from 2.8 * 10
-3(1/s) be attenuated to 9.8 * 10
-4(1/s), dissociation constant (K
DValue) be 3.1 * 10
-9M, binding ability has improved about 5 times.The association rate of mutant T55R is from 1.3 * 10
5(1/Ms) be increased to 2.4 * 10
5(1/Ms), dissociation rate is from 2.8 * 10
-3(1/s) be attenuated to 6.8 * 10
-4(1/s), dissociation constant (K
DValue) be 2.9 * 10
-9M, association rate has improved about 5 times.The inventor has also obtained 2 mutational sites and has been positioned at the mutant of light chain (based on the sequence of SEQ IDNO:2, the 220th mutant that is sported K (S220K) by S, the 220th mutant that is sported R (S220R) by S) reduced the dissociation rate of single-chain antibody for the CD25 extracellular region. wherein, the dissociation rate of mutant S220K is from 2.0 * 10
-3(1/s) be attenuated to 6.7 * 10
-4(1/s), dissociation constant (K
DValue) be 2.9 * 10
-9The M binding ability has improved about 5 times; The dissociation rate of mutant S220R is from 2.0 * 10
-3(1/s) be attenuated to 6.0 * 10
-4(1/s), dissociation constant (K
DValue) be 3.7 * 10
-9The M binding ability has improved about 4 times, and the mutant of these single-chain antibodies is compared with wild-type scFv (WT), and avidity has all had more significant enhancing, such as Fig. 9.
The varient research that embodiment 7, connection peptides change
With embodiment 1 similarly, the inventor has also made up the single-chain antibody of different connection peptides.
(1) connection peptides is (Gly Gly Gly Gly Ser)
Variable region of heavy chain (V with Daclizumab
H) 1～114 and variable region of light chain (V
L) 1～106 aminoacid sequence is as template, middle linker by constituting (Gly Gly Gly Gly Ser) connects and forms, wherein variable region of heavy chain (V
H) 1～114 be positioned at N end, variable region of light chain (V
L) 1～106 be positioned at C end.
Such as embodiment 1 in the same manner, based on above-mentioned aminoacid sequence, carry out codon optimized acquisition encoding gene, be loaded into the pBluescript plasmid.Carry out expression plasmid structure, recombinant expressed and purifying acquisition single-chain antibody such as embodiment 2-4.
Carry out the SPR experiment such as embodiment 5 similar approach, result such as Figure 10, the scFv after visible connection peptides changes compares with wild-type scFv (WT), and binding ability has obvious enhancing, and main manifestations is that dissociation rate significantly slows down on the kinetics, from 2.0 * 10
-3(1/s) be attenuated to 2.1 * 10
-4(1/s), binding ability has improved about 10 times.
(2) connection peptides is (Gly Gly Gly Gly Ser)
2
Variable region of heavy chain (V with Daclizumab
H) 1～114 and variable region of light chain (V
L) 1～106 aminoacid sequence is as template, and is middle by constituting (Gly Gly Gly Gly Ser)
2Linker connect and form, variable region of heavy chain (V wherein
H) 1～114 be positioned at N end, variable region of light chain (V
L) 1～106 be positioned at C end.
Such as embodiment 1 in the same manner, based on above-mentioned aminoacid sequence, carry out codon optimized acquisition encoding gene, be loaded into the pBluescript plasmid.Carry out expression plasmid structure, recombinant expressed and purifying acquisition single-chain antibody such as embodiment 2-4.
Carry out the SPR experiment such as embodiment 5 similar approach, result such as Figure 11, the scFv after visible connection peptides changes compares with wild-type scFv (WT), and avidity has certain increase.
Advantage of the present invention and positive effect are: the single-chain antibody that utilizes protein engineering to obtain, can use economic, the convenient and great expression of intestinal bacteria, and greatly reduced production cost, for later stage manufacture order chain antibody targeted drug lays a solid foundation.
All quote in this application as a reference at all documents that the present invention mentions, just as each piece document is quoted separately as a reference.Should be understood that in addition those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims limited range equally.
Claims (12)
1. anti-CD 25 single-chain antibody, it has:
(1) aminoacid sequence or its varient shown in the 1-114 position among the SEQ ID NO:2;
(2) aminoacid sequence or its varient shown in the 130-235 position among the SEQ ID NO:2;
And with (1) be connected 2) connection peptides that connects, length 4-30 amino acid.
2. anti-CD 25 single-chain antibody as claimed in claim 1 is characterized in that,
(1) varient described in is: aminoacid sequence is shown in 1-114 position among the SEQ ID NO:2, and the 54th or/and the 55th polypeptide that sports basic aminoacids; Or
(2) varient described in is: aminoacid sequence is shown in 130-235 position among the SEQ ID NO:2, and the 220th polypeptide that sports basic aminoacids.
3. anti-CD 25 single-chain antibody as claimed in claim 2 is characterized in that,
(1) varient described in is selected from: aminoacid sequence is shown in 1-114 position among the SEQ ID NO:2 and the 54th polypeptide that is sported Lys by Ser; Aminoacid sequence is shown in 1-114 position among the SEQ ID NO:2 and the 55th polypeptide that is sported Arg by Thr; Aminoacid sequence shown in 1-114 position among the SEQ ID NO:2 and the 54th sport Lys, the 55th polypeptide that is sported Arg by Thr by Ser; Or
(2) varient described in is selected from: aminoacid sequence is shown in 130-235 position among the SEQ ID NO:2 and the 220th polypeptide that is sported Lys by Ser; Aminoacid sequence is shown in 130-235 position among the SEQ ID NO:2 and the 220th polypeptide that is sported Arg by Ser.
4. anti-CD 25 single-chain antibody as claimed in claim 1 is characterized in that, described connection peptides is selected from: Gly-Gly-Gly-Gly-Ser, (Gly-Gly-Gly-Gly-Ser)
2Or (Gly-Gly-Gly-Gly-Ser)
3
5. the polynucleotide of coding claim 1-4 arbitrary described anti-CD 25 single-chain antibody.
6. polynucleotide as claimed in claim 5 is characterized in that, have the nucleotide sequence shown in the SEQ ID NO:2.
7. expression vector, it comprises claim 5 or 6 described polynucleotide.
8. host cell, it comprises expression vector claimed in claim 7, or is integrated with claim 5 or 6 described polynucleotide in its genome.
9. a method for preparing the arbitrary described anti-CD 25 single-chain antibody of claim 1-4 comprises: cultivate host cell claimed in claim 8, thereby express the arbitrary described anti-CD 25 single-chain antibody of claim 1-4.
10. the purposes of the arbitrary described anti-CD 25 single-chain antibody of claim 1-4 is for the preparation of the medicine of Immunosuppression transplant rejection; Or for the preparation of the targeted drug of selectively targeted CD25 antigen.
11. a pharmaceutical composition, it comprises:
The arbitrary described anti-CD 25 single-chain antibody of the claim 1-4 of significant quantity; And
Pharmaceutically acceptable carrier.
12. the targeted drug of a selectively targeted CD25 antigen, it comprises: the arbitrary described anti-CD 25 single-chain antibody of claim 1-4, and be attached thereto, the functional medicine of coupling or absorption.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310152834XA CN103374074A (en) | 2012-04-28 | 2013-04-27 | Anti-CD25 single-chain antibody |
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210134284.4 | 2012-04-28 | ||
| CN201210134284 | 2012-04-28 | ||
| CN201310152834XA CN103374074A (en) | 2012-04-28 | 2013-04-27 | Anti-CD25 single-chain antibody |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN103374074A true CN103374074A (en) | 2013-10-30 |
Family
ID=49459955
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310152834XA Pending CN103374074A (en) | 2012-04-28 | 2013-04-27 | Anti-CD25 single-chain antibody |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103374074A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2014144935A3 (en) * | 2013-03-15 | 2014-12-24 | Abbvie Biotherapeutics Inc. | Anti-cd25 antibodies and their uses |
| WO2014145000A3 (en) * | 2013-03-15 | 2015-03-19 | Abbvie Biotherapeutics Inc. | Anti-cd25 antibodies and their uses |
| CN115197321A (en) * | 2022-06-02 | 2022-10-18 | 四川大学 | Antibodies targeting CD25 and uses thereof |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1467223A (en) * | 2002-07-12 | 2004-01-14 | 菁 马 | Recombinated anti-CD25 monoclonal antibody, coding sequence and application |
| WO2004045512A2 (en) * | 2002-11-15 | 2004-06-03 | Genmab A/S | Human monoclonal antibodies against cd25 |
| WO2006108670A2 (en) * | 2005-04-15 | 2006-10-19 | Novartis Ag | Use of cd25 antibodies in immunotherapy |
| CN101544695A (en) * | 2008-03-27 | 2009-09-30 | 四川大学华西医院 | Humanized anti-CD25 single-chain antibody and preparation method |
-
2013
- 2013-04-27 CN CN201310152834XA patent/CN103374074A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1467223A (en) * | 2002-07-12 | 2004-01-14 | 菁 马 | Recombinated anti-CD25 monoclonal antibody, coding sequence and application |
| WO2004045512A2 (en) * | 2002-11-15 | 2004-06-03 | Genmab A/S | Human monoclonal antibodies against cd25 |
| WO2006108670A2 (en) * | 2005-04-15 | 2006-10-19 | Novartis Ag | Use of cd25 antibodies in immunotherapy |
| CN101544695A (en) * | 2008-03-27 | 2009-09-30 | 四川大学华西医院 | Humanized anti-CD25 single-chain antibody and preparation method |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2014144935A3 (en) * | 2013-03-15 | 2014-12-24 | Abbvie Biotherapeutics Inc. | Anti-cd25 antibodies and their uses |
| WO2014145000A3 (en) * | 2013-03-15 | 2015-03-19 | Abbvie Biotherapeutics Inc. | Anti-cd25 antibodies and their uses |
| EP3216804A3 (en) * | 2013-03-15 | 2017-12-20 | AbbVie Biotechnology Ltd. | Anti-cd25 antibodies and their uses |
| CN115197321A (en) * | 2022-06-02 | 2022-10-18 | 四川大学 | Antibodies targeting CD25 and uses thereof |
| CN115197321B (en) * | 2022-06-02 | 2023-08-18 | 四川大学 | Antibodies targeting CD25 and uses thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US11535657B2 (en) | Molecules that selectively activate regulatory T cells for the treatment of autoimmune diseases | |
| US20220112260A1 (en) | Molecules that selectively activate regulatory t cells for the treatment of autoimmune diseases | |
| US8193316B2 (en) | TACI-Fc fusion proteins, methods of making and uses thereof | |
| TWI703161B (en) | Compositions and methods of use for treating metabolic disorders | |
| CN103370339B (en) | The soluble fusion molecules of polymer IL 15 and its manufacture and use method | |
| ES2327409T3 (en) | IMPROVED FC FUSION PROTEINS. | |
| CN110214147A (en) | IL15/IL15R α heterodimer FC- fusion protein | |
| JP2021528105A (en) | Interleukin-2 variant and how to use it | |
| US20180153987A1 (en) | Tumour necrosis factor receptor fusion proteins and methods of using the same | |
| CN102036690B (en) | Novel soluble CD83 polypeptides, formulations and methods of use | |
| CA3190463A1 (en) | Il27r.alpha. binding molecules and methods of use | |
| CN103374074A (en) | Anti-CD25 single-chain antibody | |
| US20230340054A1 (en) | Interleukin-2 muteins and uses thereof | |
| CN103641896A (en) | Use of gelatin-like unit | |
| CN105916883B (en) | Bifunctional fusion proteins and its preparation method and application | |
| KR101255682B1 (en) | Novel MD-2 binding polypeptide and the use thereof | |
| CN103130894A (en) | Recombinant single-chain antibody G5-4ScFv of anti-human gamma delta T cell receptor (TCR) monoclonal antibody and encoding gene and application thereof | |
| RU2642260C1 (en) | Polypeptide for blood sugar level reducing on basis of human glucagon-like peptide-1, recombinant producing strain e. coli and method of obtaining this polypeptide | |
| CN111100211B (en) | Fc fusion protein and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20131030 |