Ricerca Immagini Maps Play YouTube News Gmail Drive Altro »
Gli utenti che utilizzano screen reader possono fare clic su questo link per attivare la modalità di accessibilità. Questa modalità presenta le stesse funzioni principali, ma risulta maggiormente compatibile con il reader.


  1. Ricerca brevetti avanzata
Numero di pubblicazioneWO1990015813 A1
Tipo di pubblicazioneRichiesta
Numero domandaPCT/FR1990/000412
Data di pubblicazione27 dic 1990
Data di registrazione12 giu 1990
Data di priorità13 giu 1989
Pubblicato anche comeEP0477248A1
Numero di pubblicazionePCT/1990/412, PCT/FR/1990/000412, PCT/FR/1990/00412, PCT/FR/90/000412, PCT/FR/90/00412, PCT/FR1990/000412, PCT/FR1990/00412, PCT/FR1990000412, PCT/FR199000412, PCT/FR90/000412, PCT/FR90/00412, PCT/FR90000412, PCT/FR9000412, WO 1990/015813 A1, WO 1990015813 A1, WO 1990015813A1, WO 9015813 A1, WO 9015813A1, WO-A1-1990015813, WO-A1-9015813, WO1990/015813A1, WO1990015813 A1, WO1990015813A1, WO9015813 A1, WO9015813A1
InventoriJean-Louis Imbach, Bernard Rayner
CandidatoCentre Nat Rech Scient
Esporta citazioneBiBTeX, EndNote, RefMan
Link esterni:  Patentscope, Espacenet
Alpha anomer oligonucleotide compounds which inhibit retrovirus replication
WO 1990015813 A1
The invention relates to oligonucleotide or oligodeoxynucleotide compounds with an alpha anomer structure and to their therapeutic applications. These compounds are used to inhibit RNA virus replication, in particular the alpha oligonucleotide d5'(ACCGCGGGCTTGTCCCTG)3' is used to inhibit the replication of AIDS virus HIV.
Rivendicazioni  tradotto da: francese  (il testo OCR potrebbe contenere errori)


1. 1. Composé oiigonucléotidique utile pour inhiber la replication d'un rétrovirus, caractérisé en ce qu'il consiste en une séquence d'oligoribonucléotide ou oligodésoxyribonucléotide d'anomerie non naturelle alpha, ladite séquence étant complémentaire d'une séquence initiale de l'ARN viral comprise dans la séquence TBS ou une séquence en amont de l'ARN viral, notamment la séquence CAP. Oiigonucléotidique compound useful to inhibit replication of a retrovirus, characterized in that it consists of an oligoribonucleotide or oligodeoxyribonucleotide sequence of non-natural alpha anomeric, said sequence being complementary to a sequence of initial viral RNA within TBS sequence or a sequence upstream of the viral RNA including the cap sequence.

2. 2. Composé oiigonucléotidique selon la revendication 1, caractérisé en ce qu'il est en outre lié de façon covalente à un agent effecteur. Oiigonucléotidique compound according to claim 1, characterized in that it is further covalently bonded to an effector agent.

3. 3. Composé oiigonucléotidique selon l'une des revendications I ou 2, caractérisé en ce que les composés ont pour formule Oiigonucléotidique compound according to claim I or 2, characterized in that the compounds have the formula

Figure imgf000021_0001

dans laquelle : wherein:

Les radicaux B peuvent être identiques ou différents et représentent chacun une base d'un acide nucléique éventuellement modifiée et rattachée au cycle glycosidique selon une configuration anomerique alpha non naturelle, les radicaux B étant complémentaires un à un des bases de la séquence oligonucléotidiques cibles de la séquence TBS ou d'un séquence en amont de l'ARN viral ; The radicals B can be identical or different and each represent a base of a nucleic acid optionally modified and attached to the glycoside ring according to a non-natural alpha anomeric configuration, the radicals B being complementary bases one by one from the oligonucleotide sequence of the target acid TBS sequence or a sequence upstream of the viral RNA;

Les radicaux X peuvent être identiques ou différents et représentent chacun un oxoanion O , un thioanion S , un groupe alkyle, un groupe alcoxy, aryloxy, un groupe aminoalkyle, un groupe aminoalcoxy, un groupe thioalkyle ; R et R', qui peuvent être identiques ou différents, représentent chacun un atome d'hydrogène ou un groupement -YZ ; The X radicals may be the same or different and each represents a oxoanion O, a thioanion S ⊝, alkyl, alkoxy, aryloxy, aminoalkyl group, an aminoalkoxy group, a thioalkyl group, R and R ', which may be identical or different, each a hydrogen atom or a group-YZ represent;

Y représente un radical alcoylène droit ou ramifié -alk- ou un radical choisi parmi Y represents a straight or branched alkylene radical-alk-or a radical chosen from

Figure imgf000022_0001
Figure imgf000022_0002
Figure imgf000022_0003
Figure imgf000022_0004

et and

Figure imgf000022_0005
Figure imgf000022_0006
Figure imgf000022_0007
avec U = O, N ou S ou bien un radical -Y"-OY' où Y" ou Y' peuvent avoir les significations données pour Y ; where U = O, N or S, or a radical-Y "-OY 'where Y" or Y' can have the meanings given for Y;

E peut avoir les mêmes significations que X ; J représente un atome d'hydrogène ou un groupe hydroxy ; E can have the same meanings as X, J represents hydrogen or hydroxy;

Z est un radical correspondant à un agent effecteur ; n est un nombre entier y compris O ; Z is an agent corresponding to an effector radical, n is an integer including O;

L représente un atome d'oxygène, un atome de soufre ou un groupe -NH-. L represents an oxygen atom, a sulfur atom or-NH-.

4. 4. Composé selon l'une des revendications précédentes utile pour l'inhibition de la replication du virus du SIDA VIH dont la séquence est complémentaire du site 182-199 de l'ARN proviral du virus, soit comporte l'oligonucléotide alpha ACCGCGGGCXXGXCCCXG avec X = T ou U ou sa séquence complémentaire en interchangeant X et A d'une part, et C et G d'autre part. Compound according to one of the preceding claims useful for inhibiting the replication of HIV AIDS whose sequence is complementary to the site 182-199 RNA virus proviral virus or the oligonucleotide comprises alpha ACCGCGGGCXXGXCCCXG with X = T or U or its complementary sequence by interchanging A and X on one hand, and F and G on the other.

5. 5. Composé selon l'une des revendications précédentes, caractérisé en ce que les composés sont des oligodésoxynucléotides alpha pour lesquels dans la formule IX = O ; 3, R, R' = H ; B est choisi parmi A, Compound according to one of the preceding claims, characterized in that the compounds are alpha oligodeoxynucleotides for which in formula IX = O, 3, R, R '= H, B is selected from A,

C, T et G ; et L est un atome d'oxygène. C, G and T, and L is an oxygen atom.

6. 6. Composition pharmaceutique antivirale caractérisée en ce qu'elle comporte à titre de substance active un composé selon l'une des revendications précédentes. Antiviral pharmaceutical composition characterized in that it comprises as active ingredient a compound according to any preceding claim.

7. 7. Composition pharmaceutique utile pour le traitement du A pharmaceutical composition useful for the treatment of

SIDA caractérisée en ce qu'elle comporte à titre de substance active l'oligonucléotide d'anomerie alpha d 5 '(ACCGCGGGCTTGTCCCTG) 3 '. AIDS characterized in that it comprises as active ingredient the oligonucleotide of 5 alpha anomeric '(ACCGCGGGCTTGTCCCTG) 3'.

8. 8. Utilisation des composés selon l'une des revendications précédentes pour la préparation d'une composition pharmaceutique utile pour le traitement des affections virales des virus à ARN contenant lesdits composés à titre de substance active. Use of compounds according to one of the preceding claims for preparing a pharmaceutical composition useful for the treatment of viral infections of RNA viruses containing said compounds as active ingredient.

9. 9. Utilisation selon la revendication précédente pour la préparation d'une composition pharmaceutique utile pour le traitement du Use according to the preceding claim for the preparation of a pharmaceutical composition useful for the treatment of


10. 10. Utilisation de l'oligonucléotide alpha d 5 '(ACCGCG GGGGCCTTTTGGTTCCCCCCTTGG) 3 ' pour la préparation d'une composition pharmaceutique utile pour le traitement du SIDA Use of the alpha oligonucleotide 5 '(ACCGCG GGGGCCTTTTGGTTCCCCCCTTGG) 3' for the preparation of a pharmaceutical composition useful for the treatment of AIDS

Descrizione  tradotto da: francese  (il testo OCR potrebbe contenere errori)


La présente invention concerne des composés chimiques constitués par un oligonucleotide ou un oligodésoxynucléotide comportant un enchaînement de nucléotides possédant la configuration anomerique non naturelle alpha par opposition à la configuration anomerique naturelle bêta. The present invention relates to chemical compounds consisting of an oligonucleotide or oligodeoxynucleotide with a sequence of nucleotides with unnatural alpha anomeric configuration as opposed to the natural beta anomeric configuration.

De tels composés chimiques ont fait l'objet de demandes de brevets, en particulier les demandes FR S7 04339 (PCT WO 88/04301 ) et FR 88 12264 au nom de la demanderesse auxquelles il conviendra de se reporter en particulier pour y trouver la description de leurs procédés de préparation. Such chemicals have been the subject of patent applications, particularly applications S7 FR 04339 (PCT WO 88/04301) and 88 FR 12264 on behalf of the plaintiff which reference should be made in particular to find the description their methods of preparation.

Plus précisément, la présente invention concerne de tels composés oligonucléotidiques utiles pour inhiber la replication d'un rétrovirus et, en particulier, un composé oligonucléotidique utile pour inhiber la replication du virus VIH. More specifically, the present invention relates to such useful oligonucleotide compounds to inhibit the replication of a retrovirus and, in particular, useful for inhibiting the replication of HIV oligonucleotide compound.

Selon leurs caractéristiques essentielles, les composés selon l'invention consistent en une séquence d'oligoribonucléotide ou oligodésoxyribonuciéotide d'anomerie non naturelle alpha, ladite séquence étant complémentaire d'une séquence comprise dans la séquence dite TBS ou PBS (ARNt binding site ou primer binding site) consistant dans le site de fixation de l'amorce ARNt de replication de l'ARN viral ou dans une séquence de l'ARN viral en amont de la séquence TBS. According to their essential characteristics, the compounds according to the invention comprise a sequence or oligoribonucleotide oligodésoxyribonuciéotide unnatural alpha-anomeric, said sequence being complementary to a sequence within the sequence called TBS or PBS (tRNA primer binding site or binding website) consisting of the binding site of the primer tRNA replication of viral RNA or a viral sequence upstream of the RNA sequence TBS.

Parmi ces séquences en amont de la séquence TBS ou PBS, on peut citer notamment la séquence CAP. Among these sequences upstream of the TBS or PBS sequence can be cited the CAP sequence.

Les composes oligonucléotidiques alpha selon l'invention peuvent éventuellement être liés de façon covaiente à un agent effecteur, tel qu'un agent intercalant, in radical chimique réactif ou photoactivable. The alpha oligonucleotide compounds of the invention may optionally be linked to an effector how covalent agent, such as inserting, in radical chemical reagent or photoactivatable agent.

Dans un mode de réalisation des composés selon l'invention, ceux-ci présentent la formule suivante : In one embodiment of the compounds according to the invention, they have the following formula:

Figure imgf000003_0001
dans laquelle : wherein:

Les radicaux B peuvent être identiques ou différents et représentent chacun une base d'un acide nucléique éventuellement modifiée et rattachée au cycle glycosidique selon une configuration anomerique alpha non naturelle. The radicals B can be identical or different and each represent a base of a nucleic acid optionally modified and attached to the glycoside ring according to a non-natural alpha anomeric configuration.

Les radicaux B étant complémentaires un à un des bases de la séquence oligonucléotidiques cibles comprise dans la séquence TBS ou une séquence en amont de l'ARN proviral ; The radicals B being complementary bases one by one from the target oligonucleotide sequence within the TBS sequence or a sequence upstream of the proviral DNA;

Les radicaux X peuvent être identiques ou différents et représentent chacun un oxoanion Q , un thioanion S , un groupe alkyie, un groupe alcoxy, aryloxy, un groupe aminoalkyle, un groupe aminoalcoxy, un groupe thioalkyle ; The X radicals may be the same or different and each represents a Q oxoanion, a thioanion S, an alkyl group, alkoxy group, aryloxy group, an aminoalkyl group, an aminoalkoxy group, a thioalkyl group;

R et R', qui peuvent être identiques ou différents, représentent chacun un atome d'hydrogène ou un groupement -YZ ; Y représente un radical alcoylène droit ou ramifié -alk- ou un radical choisi parmi R and R ', which may be identical or different, each a hydrogen atom or represents a group-YZ, Y is a straight or branched alkylene radical-alk-or a radical chosen from

Figure imgf000004_0001
avec U = O, N ou S ou bien un radical -Y"-OY' où Y" ou Y' peuvent avoir les significations données pour Y ; where U = O, N or S, or a radical-Y "-OY 'where Y" or Y' can have the meanings given for Y;

E peut avoir les mêmes significations que X ; E can have the same meanings as X;

J représente un atome d'hydrogène ou un groupe hydroxy ; J represents hydrogen or hydroxy;

Z est un radical correspondant à un agent effecteur ; n est un nombre entier y compris O ; L représente un atome d'oxygène, un atome de soufre ou un groupe Z is a radical corresponding to an effector agent, n is an integer including O, L represents an oxygen atom, a sulfur atom or a group

-NH-. -NH-. Dans cette formule I, on utilise la représentation condensée des nucléosides suivante : In this formula I, the condensed representation of the following nucleosides are used:

Figure imgf000005_0001
qui correspond à la formule développée : which corresponds to the structural formula:

Figure imgf000005_0002
sur laquelle ont été mentionnées les extrémités (3') et (5'). which were mentioned in the ends (3 ') and (5').

Il convient de remarquer que la formule I représente un enchaînement de nuciéotides qui peuvent être identiques ou différents, n indiquant simplement le nombre de nuciéotides compris dans la molécule ; n est de préférence un nombre compris entre 1 et 30, et de préférence encore entre 1 et 20 et dépend de la taille de la séquence cible de l'ARN du rétrovirus. It should be noted that the formula I is a sequence of nucleotides which may be identical or different, n simply indicates the number of nucleotides within the molecule, n is preferably between 1 and 30, and preferably between 1 and 20 depends on the size of the target RNA sequence and of the retrovirus. En général, par exemple, les séquences TBS ont une vingtaine de nuciéotides. In general, for example, TBS sequences twenty nucleotides.

Les radicaux effecteurs correspondent à des agents effecteurs qui sont des composés connus dans les techniques touchant aux acides nucléiques. Correspond to the radicals effectors effector agents which are known in the techniques relating to nucleic acid compounds. Il s'agit par exemple des composés capables de "s'intercaler" dans la structure des ADN ou des ARN. It is, for example, compounds capable of "insert" in the structure of DNA or RNA.

Ces agents d'intercalation sont notamment constitués par des composés polycycliques ayant une configuration plane tels que i'acridine, la furocoumarine, la daunomycine, la 1,10-phénanthroline, la phénanthridinium, les prophyrines, les dérivés de la dipyrido (1,2-a : 3', 2'-d) imidazole, l'ellipticine ou i'eliipticinium et leurs dérivés. These include intercalating agents consisting of polycyclic compounds having a planar configuration such as acridine, furocoumarin, daunomycin, 1,10-phenanthroline, phenanthridinium, the porphyrins, derivatives of dipyrido (1,2 -a: 3 ', 2'-d) imidazole, and i'eliipticinium ellipticine or derivatives thereof. Ces agents effecteurs peuvent aussi être des radicaux chimiques réactifs tels que des radicaux chimiques de scission, c'est-à-dire que ces radicaux peuvent directement ou indirectement réagir pour scinder une chaîne de nuciéotides. These effector agents may also be chemically reactive radicals such as chemical radicals split, that is to say that these radicals can react directly or indirectly to split a string of nucleotides. De préférence, ces radicaux chimiques réactifs seront activables, par exemple par voie chimique ou photochimique. Preferably, these reagents are activatable chemical groups, for example by chemical or photochemical means.

Les groupes réactifs de scission activables sont, par exemple, des dérivés de composés tels que : Cleavage of the reactive groups are activated, for example, derivatives of compounds such as:

- l'acide éthylène-diamine-tétracétique, - Ethylene-diamine-tetraacetic acid,

- l'acide diéthylène-triamine-pentaacétique, - les porphyrines, - Diethylene triamine pentaacetic acid, - porphyrins,

- la 1,10-phénanthroIine, le psoralène et autres groupes aromatiques absorbant les radiations du proche UV et du visible. - 1,10-phénanthroIine, psoralen and other aromatic groups radiation near UV and visible absorbing.

Ces groupements chimiquement activables en présence d'ions métalliques, d'oxygène et d'un agent réducteur, induisent des coupures dans des séquences d'acides nucléiques situées dans leur voisinage. The chemically activated groups in the presence of metal ions, oxygen and a reducing agent, induce cuts nucleic acid sequences located in their vicinity.

Le radical B est constitué par une base d'un acide nucléique liée à la partie sucre du nucléotide par une configuration anomerique alpha. The radical B is formed by a base of a nucleic acid linked to the sugar moiety of a nucleotide acid alpha anomeric configuration. Ce peut être la thymine, l'adénine, la cytosine, la guanine ou l'uracile. This can be thymine, adenine, cytosine, guanine or uracil. Mais il est également possible d'utiliser des bases d'acides nucléiques modifiées, notamment halogénées ou azidées, par exemple la But it is also possible to use modified nucleic acid bases, including halogenated or azidées, eg

5-bromo-uracile ou la 8-azidoadénine ; ou des dérivés aminés comme la 2-amino-adénine et ses dérivés substitués, par exemple sur le N par un groupe aminoalkylène ou par un groupe azidophénylalkyiène ; ou la guanine substituée sur le O , par exemple par un groupe (ω-alkylène)-9-acridine ou la 8-(ω-aminoalkyl)-ammo-adénine et ses dérivés substitués sur le NH 2 en u) par un groupe acridine. 5-bromo-uracil-azidoadénine or 8, or amino derivatives such as 2-amino and substituted adenine, for example the N by an aminoalkylene group or a group derived azidophénylalkyiène; or guanine substituted on the O , for example with a (ω-alkylene)-acridine-9 8-( or ω-aminoalkyl)-amino-substituted adenine and the u-NH 2) group by an acridine derivative.

Selon la présente invention, sont donc considérées les bases usuelles, ainsi que la possibilité d'introduction de bases modifiées. According to the present invention, are considered the usual bases, as well as the possibility of introduction of modified bases. Des. The. bases "effectrices", susceptibles de se lier par covalence à un brin bêta complémentaire, pourront être introduites. bases "effector", may covalently bind to a complementary strand beta, will be introduced. Ainsi, la fonctionnalisation de C ou T par un groupement aziridine en position 4 conduit à la formation de pontages covaients CH 2 -CH 2 entre les deux brins complémentaires sur respectivement G et A. Thus, the functionalization of C or T by a aziridine group in position 4 results in the formation of bridges covaients CH 2 CH 2-between the two complementary strands of respectively G and A. Donc, plus particulièrement, le radical B est choisi parmi la thymine, l'adénine, la cytosine, la guanine, la 4-azido-cytosine ou la 4-azιdo-thymine et la 8-azido-adénine, l'uracile, la 5 bromo-uracile. Therefore, in particular, the radical B is selected from thymine, adenine, cytosine, guanine, the 4-azido-4-cytosine or thymine and azιdo-8-azido adenine, uracil, 5-bromo-uracil.

Le radical X, bien qu'il représente de préférence un oxoanion, peut avoir d'autres significations ; lorsque le radical X représente un groupement alkyle, il s'agit de préférence d'un groupement alkyle inférieur en C 1 à C 7 et, par exemple, les groupements éthyle, méthyle ou propyle ; lorsque le radical X représente un groupe alcoxy, il s'agit de préférence d'un groupement alcoxy inférieur C 1 à C 7 , par exemple le groupement méthoxy ou éthoxy ; lorsque X représente un groupement amino-alkyle ou amino-alcoxy ; il peut s'agir d'un groupement amino-alkyle mono-substitué, disubstitué ou bien d'un radical amino sous forme de sel d'ammonium quaternaire. The radical X, although it is preferably oxoanion can have other meanings, when the radical X represents an alkyl group, it is preferably a lower alkyl group of C 1 to C 7 and for example, ethyl, methyl or propyl, where the radical X represents an alkoxy group, this is preferably a lower C 1-C 7 alkoxy, for example methoxy or ethoxy group, and when X is amino or amino-alkyl-alkoxy and may be a mono-amino-substituted alkyl group, or a disubstituted amino radical in the form of quaternary ammonium salt. Dans ces conditions, les substituants sont, de préférence, des radicaux aikyles inférieurs comme définis précédemment ; quant à la chaîne alkyle ou alcoxy reliant le radical amino au phosphore, il s'agit de préférence d'une chaîne droite ramifiée comportant de 1 à 10 atomes de carbone. Under these conditions, the substituents are preferably lower aikyles radicals as defined above, as to the alkyl or alkoxy chain linking the amino group to the phosphorus, it is preferably straight-chain having a branched January to October carbon atoms. Lorsque le radical alkyle ou alcoxy est substitué par un hétérocycle azoté, il s'agit notamment de cycle saturé à 5-6 chaînons comportant un atome d'azote qui peut être quaternaire. When the alkyl or alkoxy radical substituted with a nitrogenous heterocycle of these include saturated 5-6 membered rings having one nitrogen atom which ring may be quaternary. Enfin, lorsque le radical X est un radical thioalkyle, il s'agit de préférence d'un radical thioalkyle inférieur, c'est-à-dire qui comporte entre 1 et 7 atomes de carbone. Finally, when the radical X is a thio group, it is preferably a lower alkylthio group, that is to say, which has from 1 to 7 carbon atoms.

Le radical -alk- est de préférence un radical alcoylène droit ou ramifié ayant de 1 à 10 atomes de carbone. The group-alk-is preferably a straight or branched alkylene radical having 1 to 10 carbon atoms. En particulier, à partir des fonctions alcool terminales 3' ou 5' de l'oligomère alpha, l'effecteur peut donc être introduit via une chaîne In particular, from the alcohol functional terminal 3 'or 5' end of the oligomer alpha, the effector can be introduced via a chain

(CH 2 ) n liée à une fonctionnalisation Z' de natures diverses à la partie osidique de l'oligomère. (CH 2) n bound to a functionalization Z 'of various kinds to the saccharide portion of the oligomer.

A partir de la formule 3' ou -O-Z'-(CH 2 ) n -effecteur (Z) on obtiendra, selon ce que représente Z', par exemple From the formula 3 'or Z'-O-(CH 2) n-effector (Z) will be obtained, depending on what is Z', for example

- un phosphate ou méthyl phosphonate de formule - A phosphate or methyl phosphonate of the formula

Figure imgf000008_0001
U = O, N ou S U = O, N or S

- un éther de formule générale - An ether of the general formula

Figure imgf000008_0002

- un ester de formule générale - An ester of general formula

Figure imgf000008_0003
ou encore or

- un carbamate de formule générale - A carbamate of general formula

Figure imgf000008_0004
Selon la présente invention sont concernés également les composés précédents sous forme de sel avec des bases ou des acides, et les composés sous forme racemique, ou sous forme d'isomères R ou S optiques purifiés ou en mélange. According to the present invention also concerns the above compounds in salt form with bases or acids, and the compounds in racemic form or in the form of R or S isomers or optical purified mixture.

Selon la présente invention sont concernés également les composés précédents cans les séries D ou L. According to the present invention are also concerned the preceding compounds cans series D or L.

Dans un wode de réalisation de l'invention, on utilise des oiigodésoxynucléotides aipna. In wode embodiment of the invention, aipna oiigodésoxynucléotides is used. II s'agit des composés pour lesquels X = O ; J, R et R' = H ; B est choisi parmi A, C, T et G, et L est un atome d'oxygène dans la f ormule I. II are the compounds wherein X = O, J, R and R '= H, B is selected from A, C, G and T, and L is an oxygen atom in the ormule f I. La présente imention a également pour objet des compositions pharmaceutiques antiwraies contenant à titre de substance active lesdits composés, et notamment des compositions utiles pour le traitement des affections virales des virus à ARN, tels que le virus VIH1 du SIDA. This imention also relates to pharmaceutical compositions containing antiwraies as active substance said compounds, including compositions useful for the treatment of viral diseases RNA viruses, such as HIV-1 AIDS virus.

Enfin, la présente invention a pour objet l'utilisation des composés selon l'invention à la préparation de compositions pharmaceutiques antivirales notamment utiles pour le traitement du SIDA. Finally, the present invention relates to the use of the compounds according to the invention in the preparation of such antiviral pharmaceutical compositions useful for the treatment of AIDS. Comme mentionné ci-dessus, l'application des composés oligonucléotidiques alpha selon la présente invention consiste à inhiber la replication des rétrovirus et notamment du virus de l'immunodéficience humaine VIH1 du SIDA. As mentioned above, the application of the alpha oligonucleotide compounds of the present invention is to inhibit the replication of retroviruses and viruses including human immunodeficiency virus HIV-1 AIDS. Le rétrovirus associé à des iymphadénopathies (LAV), également appelé virus HTLV III (HTLV - human T leukemia virus) ou AIDS - related virus (ARV) a été baptisé plus récemment VIHI et est en effet reconnu comme l'agent responsable du SIDA. The retrovirus associated with iymphadénopathies (LAV), also called HTLV III (HTLV - human T leukemia virus) or AIDS - related virus (ARV) was baptized recently Vihi and indeed is recognized as the causative agent of AIDS.

Les virus à ARN et notamment le virus du SIDA ont un mécanisme de multiplication qui fait effectivement intervenir l'enzyme RNA viruses, including the AIDS virus have a multiplying mechanism which actually involves the enzyme

ADN polymérase - ARN dépendante encore appelée transcriptase inverse ou plus communément réverse transcriptase. DNA polymerase - also called RNA-dependent reverse transcriptase or more commonly reverse transcriptase. Cette enzyme copie en ADN monobrin dit complémentaire (ADNc), l'ARN viral. This enzyme copy single-stranded DNA complementary says (cDNA), the viral RNA. Il faut pour cela qu'elle trouve une amorce oligonucléotidique appariée à l'extrémité 3' de la matrice d'ARN à copier. This implies that it is an oligonucleotide primer paired with the 3 'end of the RNA template to copy.

La transcriptase réverse est à la fois nécesaire à l'établissement de l'état provirai, au démarrage de la replication du virus, et à l'éventuelle transformation de la cellule. Reverse transcriptase is both necesary for the establishment of the proviral state at the start of virus replication, and the eventual transformation of the cell.

Chez les rétrovirus, l'amorce est un ARNt d'origine cellulaire présent à l'intérieur des virions. In retroviruses, the primer is a cellular origin present inside virions tRNA. Précisément, quand le virus infecte une cellule, la transcriptase reverse (RT) se fixe à l'ARN virale et l'ARNt-3' de la lysine sert de début à l'ADN qui sera synthétisé. Specifically, when the virus infects a cell, reverse transcriptase (RT) binds to the viral RNA and tRNA 3'lysine serves to start the DNA to be synthesized. Le brin synthétisé est guidé par le sillon d'amorce. The synthesized strand is guided by the groove bait. Le brin d'ADN ainsi synthétisé est alors sous forme de monobrin, suite à l'activité RNasique liée à la RT et un brin complémentaire d'ADN est synthétisé via l'activité polymerasique DNA dépendante de la RT. The DNA strand is synthesized and then in the form of monofilament, following the RNasique activity related to RT and a complementary DNA strand is synthesized using the polymerase activity dependent RT DNA.

La structure d'un rétrovirus avant et après sont intégration dans le DNA d'une cellule-hôte peut se schématiser comme suit : a) Intégration du rétrovirus dans le DNA de la cellule-hôte The structure of a retrovirus are before and after integration into the DNA of a host cell can be depicted as follows: a) Integration of the retrovirus in the DNA of the host cell

ARN viral Viral RNA

Figure imgf000010_0001

transcriptase reverse reverse transcriptase

Figure imgf000010_0002

DNA 2 brins Two DNA strands

Figure imgf000010_0003
Figure imgf000010_0004

DNA cellule-hôte Host cell DNA

Figure imgf000010_0005
Figure imgf000010_0006
b) Structure moléculaire du génome du rétrovirus durant les différentes phases de l'intégration * ARN génomique b) Molecular structure of retrovirus genome during different phases of integration * genomic RNA

5' RU 5 -UU - TBS- NC -région codante- NC - Pur -AA-U 3 -R 3' 5 '5-UU RU - TBS-NC-NC-coding region - Pure G-AA-3-R 3'

(ARN) Le ARN d'un rétrovirus est un ARN simple brin dans lequel les régions codantes sont flanquées de séquences essentielles pour la replication et l'expression virales. (RNA) The RNA retrovirus is a single-stranded RNA in which the coding regions are flanked by sequences essential for viral replication and expression. Ces séquences sont, de l'extrémité 5' vers 3' : These sequences are the 5 'to 3':

- R (short "repeat") : une courte séquence à l'extrémité 5' qui comprend en début de séquence une séquence CAP nécessaire pour que puisse s'effectuer la traduction. - R (short "repeat"): a short sequence at the 5 'end that comprises a sequence start CAP sequence necessary for the translation can take place. (Les mêmes nuciéotides seront répétés à l'extrémité 3'), (The same will be repeated nucleotides at the 3 'end)

- U 5 : séquence iinique de l'extrémité 5' (constituée d'environ 80 nuciéotides), - U 5 iinique sequence of the 5 '(consisting of about 80 nucleotides)

- UU : 2 nuciéotides à uracile, - UU: 2 nucleotides to uracil,

- TBS ("tRNA binding site"). - TBS ("tRNA binding site"). Il s'agit du site où se lie (par son extrémité 3') l'ARNt qui servira d'amorce lors de la replication. This is the site where binds (through its 3 'end) that will tRNA primer during replication. Les liaisons complémentaires et antiparallèles porteront sur 20 pdb environ, Additional links and antiparallel focus on about 20 bps

- NC : une séquence non codante, - NC: non-coding sequence,

- région codante : elle est située au centre, elle contient très peu de gènes. - Coding region: it is located in the center, it contains very few genes. Ce sont : They are:

"gag", (pour "group spécifie antigen") ou gène de l'antigène de groupe, qui code pour une polyprotéine qui, découpée, donne les protéines du nuciéoîde. "Gag" (for "specifies group antigen"), or antigen gene group, which encodes a polyprotein, which cut gives nuciéoîde proteins. Parmi ces protéines internes, l'une d'entre elles porte i'antigénicité du groupe, Among these internal proteins, one of them has i'antigénicité group,

"pol" (pour "poiymérase") qui code pour la transcriptase réverse et "env" (pour "enveloppe") qui code pour les giycoprotéines de l'enveloppe. "Pol" (for "poiymérase") which codes for the reverse transcriptase and "env" (for "shell") that encodes the envelope glycoproteins. Une d'entre elles porte I'antigénicité de chaque sérotype viral. One of them carries I'antigénicité each virus serotype. Dans la région codante peut se trouver aussi un gène codant pour une protéine (ou un segment de protéine) virale spécifique du rétrovirus (Par exemple, chez les rétrovirus oncogenes, on trouve un gène onc. Ce n'est pas le cas du virus du SIDA qui n'est pas un rétrovirus oncogène, il ne cancérise pas les cellules mais les détruit). In the coding region may also find a gene coding for a protein (or protein segment) virus specific retrovirus (For example, in oncogenic retroviruses, there is an onc gene. This is not the case of virus AIDS is not an oncogenic retroviruses, it does not cancérise cells but destroyed). - NC : une région non codante, - NC: non-coding region

- Pur : une séquence riche en bases puriques, - Pure: a purine-rich sequence,

- AA : 2 nuciéotides à adénine, - AA: 2 nucleotides adenine,

- U 3 : séquence jjnique de l'extrémité 3' (environ 300 nuciéotides), - U 3: jjnique sequence of the 3 '(300 nucleotides)

- R : (short "repeat"), à l'extrémité 3'. - R (short "repeat"), to the 3 'end. * DNA virai après action de la transcriptase réverse : DNA viral non intégré * DNA virai after the action of reverse transcriptase: unintegrated viral DNA

5' AA-U 3 -RU 5 -TT-TBS-NC- région codante -NC-Pur-AA-U 3 -RU 5 -TT 3' (DNA) 5 AA-U 3-RU 5-TT-TBS-NC-NC-coding region-Pur-AA-U 3-RU-5 TT 3 '(DNA)

3' TT-U 3 -RU 5 -AA-TBS-NC- région codante-NC-Pyr-TT-U 3 -RU _-AA 5' Après action de la transcriptase réverse, la molécule de DNA double brin transcrite est plus longue que le DNA génomique correspondant. 3 'TT-3 U-AA 5-RU-TBS-N-CN-coding region-TT-G-Pyr-3-_ RU AA 5' After the action of reverse transcriptase, the molecule double-stranded DNA is transcribed long as the corresponding genomic DNA. En effet, il ya addition aux 2 extrémités de 2 séquences : Indeed, there are two ends to the addition of two sequences:

- à l'extrémité 5' est ajoutée une séquence U 3 , - In the 5 'end a sequence is added 3 U,

- à l'extrémité 3' est ajoutée une séquence U 5 . - At the 3 'end is added a 5 U sequence. On appelle "LTR" (long terminal repeat) l'ensemble : U 3 -R- U 5 . Called "LTR" (long terminal repeat) all: U 3 U-R-5.

Il ya donc 1 LTR à chacune des 2 extrémités. It is therefore one for each of two LTR ends. * DNA viral intégré (provirus) * Integrated viral DNA (provirus)

' '

Figure imgf000012_0001
Le DNA linéaire double brin devient circulaire clos, puis il est à nouveau ouvert pour être intégré dans le DNA de la cellule-hôte. The linear double-stranded DNA is enclosed circular, then it is open again to be integrated into the DNA of the host cell. On appelle "provirus" le DNA viral intégré. Called "provirus" the integrated viral DNA. Lors de l'intégration, les dinuciéotides (TT, AA) situés aux extrémités du DNA transcrit (et faisant partie de U 3 ou U 5 ) sont éliminés. During integration, dinuciéotides (TT, AA) at the ends of the DNA transcribed (and part of U 3 and U 5) are eliminated. La jonction au niveau du site d'intégration implique : The junction at the site of integration involves:

- au niveau du DNA hôte, une séquence directe répétée : DR ("direct repeat"), à la jonction donc avec le provirus. - At the host DNA, a direct repeat sequence: DR ("direct repeat"), then at the junction with the provirus.

Toutes les DR sont longues de 4 à 6 pdb. All CDs are long from April to June bps. Leurs séquences sont différentes. Their sequences are different. Pour un même provirus, on trouve d'ailleurs différentes DR dans le DNA d'une cellule-hôte. For the same provirus, different DR found elsewhere in a host cell DNA. Le site d'intégration du virus n'est donc pas sepcifique, le virus peut être intégré dans le génome de l'hôte à plusieurs endroits différents. The integration site of the virus is not sepcifique, the virus can be integrated into the host genome in several different places.

- au niveau du DNA viral, une séquence inverse répétée ; IR ("inverted repeat") aux extrémités du rétrovirus. - At the level of viral DNA, repeated reverse sequence; IR ("inverted repeat") at the ends of the retrovirus. Deux séquences sont dites "inverses répétées" quand l'une est à la fois l'inverse et le complément de l'autre. Two sequences are called "inverse repeated" when one is both the reverse and the complement of the other.

On a essayé de lutter contre la replication du virus du SIDA, avec des oligonucléotides antisens, c'est-à-dire des segments d'ADN complémentaires d'une portion de l'ARN messager du virus qui code directement les protéines devant être synthétisées par le ribosome. We tried to fight against the replication of the AIDS virus, with antisense oligonucleotides, that is to say complementary DNA segments of a portion of messenger RNA virus that directly encodes the protein to be synthesized by the ribosome.

Compte tenu du fait que les oligonucléotides alpha forment des hétéroduplex avec leurs oligonucléotides complémentaires bêta et que ceux-ci ne sont pas substrats pour l'enzyme RNase H, on pouvait penser que l'inhibition de l'expression de protéines par l'oligonucléotide alpha pouvait peut-être s'effectuer par un empêchement du ribosome à traduire l'ARNm en protéine virale. Given that alpha oligonucleotides form heteroduplexes with their beta complementary oligonucleotides and that they are not substrates for the enzyme RNase H, one might think that the inhibition of protein expression by oligonucleotide alpha perhaps could be done by preventing the ribosome translate viral mRNA into protein.

Toutefois, les expériences qui ont été entreprises en ce sens n'ont pas été concluantes. However, the experiences that have been taken in this direction have not been successful.

En revanche, l'approche selon la présente invention visant à utiliser des oligonucléotides complémentaires d'une séquence initiale de l'ARN viral et notamment du site initial de fixation de l'ARNt de la lvsine sur l'ARN provirai, s'est avérée efficace. In contrast, the approach of the present invention to use oligonucleotides complementary to an initial sequence of the viral RNA, including the initial binding site of tRNA lvsine the proviral RNA, proved effective.

Ainsi, la présente invention a pour objet un oligonucleotide alpha dont ia séquence est complémentaire du site 182- 199 de la séquence PBS de l'ARN proviral du virus VIH, soit l'oiigodésoxynucleotide alpha d 5' (ACCGCGGGCTTGTCCCTG) 3' ou plus généralement un oligonucleotide alpha de formule ACCGCGGGCXXGXCCCXG avec X = T pour un oligodésoxyribonuciéotide alpha ou X = U pour un oligoribonucléotide alpha ou une séquence complémentaire en interchangeant X et A d'une part et C et G d'autre part. Thus, the present invention relates to an alpha oligonucleotide whose sequence is complementary ia Site 182-199 of PBS RNA sequence proviral HIV virus or the oiigodésoxynucleotide alpha of 5 '(ACCGCGGGCTTGTCCCTG) 3' or more generally an alpha oligonucleotide ACCGCGGGCXXGXCCCXG formula with X = T or for alpha oligodésoxyribonuciéotide X = U for alpha oligoribonucleotide or a complementary sequence by interchanging A and X on the one hand and C and G on the other. D'autres caractéristiques et avantages de la présente invention apparaîtront à la lumière des exemples qui vont suivre. Other features and advantages of the present invention will become apparent in light of the following examples.

La figure 1 représente l'inhibition de la production virale de cellule MT4 par l'oligonucléotide alpha d 5 '(ACCGCGGGCTTGTCCCTG) 3 ' (oligo alpha "PBS") par dosage de l'activité (cpm) de transcriptase inverse. Figure 1 shows the inhibition of viral production MT4 cell alpha of the oligonucleotide 5 '(ACCGCGGGCTTGTCCCTG) 3' (alpha trace "PBS") by assaying the activity (cpm) of reverse transcriptase. EXEMPLE 1 : Cytotoxicité des oligonucléotides alpha EXAMPLE 1: Cytotoxicity of alpha oligonucleotides

Quel que soit le type d 'oligonucleotide utilisé, ceux-ci finissent plus ou moins rapidement par être dégradés par les enzymes cellulaires. Whatever type of oligonucleotide used, they end up more or less rapidly being degraded by cellular enzymes. On montre ci-après que les oligonucléotides alpha et leur catabolites nucléosides al pha et nucléotide alpha ne présentent pas de cytotoxicité. We show below that alpha oligonucleotides and catabolites nucleoside al pha nucleotide alpha and show no cytotoxicity.

Ainsi, l 'ol igonucléotide alpha-d(CCTCTCGTTCTTTAC) oligo alpha Tat (complémentaire) de la séquence Tat dirigé, à priori, contre aucun site du génome des cellules MT-4, présente une CD 50 supérieure à 250 μg/ml. Thus, the alpha-ol igonucléotide d (CCTCTCGTTCTTTAC) oligo alpha Tat (complementary) of the Tat sequence directed a priori against any site in the genome of MT-4 cells, CD50 has a more than 250 mcg / ml. De même, des alpha oligothymidylates alpha-(dT) n (2 ≤ n ≤ 12) se sont révélés non cytotoxiques vis-à-vis de la même lignée cellulaire. Similarly, alpha oligothymidylates alpha-(dT) n (2 ≤ n ≤ 12) have been found not cytotoxic in relation to the same cell line.

Enfin, des al pha nucléosides et alpha nuciéotides pouvant résulter de l'hydrol yse len te d'oligonucleotides sont également dépourvus de cytotoxicité contre diverses lignées cellulaires (Hela, Vero, cellules primaire de rein de lapin. MT-4). Finally, al pha nucleosides and nucleotides alpha resulting from the hydrol ysis len are also devoid of cytotoxicity against various (MT-4 Hela, Vero, primary rabbit kidney cells.) Cell lines you oligonucleotides.

Figure imgf000014_0001

EXEMPLE 2 : Evaluation de l'effet antiviral de l'oligo alpha EXAMPLE 2: Evaluation of the antiviral effect of alpha trace


1. 1. Protocole a) méthode L'évaluation est basée sur l'étude de l'effet cytopathogène du virus VIH1 sur la lignée cellulaire MT4, après infection par le virus VIH1, la formation des syncitia est observée 4 à 6 jours après l'infection, suivie par une production de particules virales, puis par la mort des cellules. Protocol) The evaluation method is based on the study of the cytopathic effect of HIV-1 virus on MT4 cell line after infection with HIV-1 virus, the formation of syncytia was observed 4-6 days after infection, followed by the production of viral particles, followed by cell death.

La destruction de lymphocytes T4 indispensables à la défense immunitaire est la première cause de la déficience immunitaire caractéristique de l'infection par le VIH. The destruction of T4 lymphocytes essential for immune defense is the primary cause of immune deficiency characteristic of HIV infection. On sait que ce virus tue les cellules en s'y multipliant ; lorsqu'il s'en échappe, il endommage la membrane cellulaire. We know that this virus kills cells by multiplying them and when he escapes, it damages the cell membrane. Le VIH tue peut-être aussi les lymphocytes T4 indirectement, par la protéine gp l 20 présente sur la membrane des cellules infectées. HIV kills perhaps T4 cells indirectly by the gp 20 protein present on the membrane of infected cells. En effet, les lymphocytes T4 portent une molécule de surface, le récepteur CD4, à laquelle la protéine GP120 se lie ; les lymphocytes T4 sains se fixent à la protéine et fusionnent avec la cellule infectée. Indeed, T4 lymphocytes bear a surface molecule, CD4 receptor, which binds the gp120 protein, healthy T4 lymphocytes bind to the protein and fuse with the infected cell. L'amas cellulaire qui se forme est un "syncytiuni", incapable de survivre, et toutes les cellules saines qui le composent meurent avec la cellule infectée. The cell clusters formed is a "syncytiuni" unable to survive, and all the healthy cells that compose die with the infected cell. Le VIH peut aussi déclencher des réactions immunitaires normales contre les lymphocytes infectés. HIV can also trigger immune responses against normal lymphocytes infected. Avec ou sans l'aide des anticorps, les cellules cytotoxiques de défense détruisent une cellule infectée portant à sa surface des protéines virales. With or without the help of antibodies, cytotoxic defensive cells destroy an infected cell carrying on its surface viral proteins. Enfin, la protéine gp120 circule parfois librement en solution dans le sang des sujets infectés ; elle se lie au récepteur CD4 des cellules saines, simulant une infection et déclenchant une réaction de destruction de cellules non infectées. Finally, gp120 sometimes flows freely dissolved in the blood of infected individuals, it binds to the CD4 receptor of healthy cells, simulating an infection and triggering a reaction of destruction of uninfected cells.

Les syncytia sont des structures formées de plusieurs noyaux entourés par une seule membrane cellulaire ; Ce sont des signes d'infection par le VIH dans les cultures cellulaires; Les syncytia se forment lorsque les cellules infectées qui synthétisent la molécule gp120 et la transportent à leur surface fusionnent avec des cellules saines portant la molécule CD4. Syncytia are formed of several structures surrounded by a single membrane cell nuclei; These are signs of HIV infection in cell cultures, the syncytia formed when infected cells that synthesize the gp120 molecule and carry on their surface merge with healthy cells bearing the CD4 molecule. b) Composé testé alpha-d 5 ' ACCGCGGGCTTGTCCCTG 0,54 U solution mère à 1 mg/ml en eau bidistillée stérile et conservée à-80°C. b) Test compound alpha-d 5 'ACCGCGGGCTTGTCCCTG 0.54 U stock solution 1 mg / ml in sterile double distilled water and stored at -80 ° C. c) Test MT4 Les cellules MT4 au jour 2 après le dernier passage sont pré-incubées 1 heure à 37°C avec les dilutions successives du composé à raison de 3.10 cellules pour 100 μl de composé (en micropaque à 96 puits). c) The test MT4 MT4 cells on day 2 after the last passage are pre-incubated for 1 hour at 37 ° C with serial dilutions of the compound due to 3.10 cells per 100 mu.l of compound (in Micropaque 96 wells).

L'infection est réalisée en micropuits en ajoutant 100 μl d'une dilution 10 - 4 du virus VIH1 (la dilution de virus a été déterminée pour induire la formation de syncitia en 4 jours). Infection is carried out by adding 100 microwells mu.l of a dilution 10-4 of HIV1 (dilution of virus was determined to induce syncytia formation in 4 days).

Après une incubation de 1 heure à 37°C, les cellules MT4 infectées sont lavées 5 fois avant d'être mises en cultures à la concentration de 3.10 cellules par ml, en microplaque à 24 puits, en présence des différentes dilutions choisies. After incubation for 1 hour at 37 ° C, the infected MT4 cells were washed five times before being placed in culture at a concentration of 3.10 cells per ml in 24-well microtiter plate in the presence of different dilutions chosen. Tous les 3 ou 4 jours, les cellules sont diluées 3 ou 4 fois et ajustées à la concentration de 3.10 cellules/ml avec le milieu RPM 1 10 % FCS 1 % PSN 1 % Gluta toujours en présence de l'oligo alpha PBS. Every 3 or 4 days, the cells are diluted 3 or 4 times and adjusted to a concentration of 3.10 cells / ml with medium RPM 1 10% FCS 1% 1% PSN Gluta always in the presence of alpha trace PBS.

Tous les 2 ou 3 jours, l'apparition des syncitia est observée dans les cultures. Every 2 or 3 days, the appearance of syncytia was observed in cultures. d) Dosage de la transcriptase inverse d) Determination of reverse transcriptase

Le suivi de la production virale des cellules MT4 est réalisé par dosage de l'activité de la transcriptase inverse (figure 1 RT) dans la culture tous les 3 ou 4 jours. Monitoring of viral production MT4 cells is achieved by assaying the activity of reverse transcriptase (RT Figure 1) in the culture every 3 or 4 days. Brièvement, l'activité enzymatique est testée en utilisant une amorce synthétique et un substrat radiomarque au H 3 "in vitro". Briefly, the enzymatic activity is tested using synthetic primer radiolabeled substrate and H 3 "in vitro". La quantité de matériel radiomarque précipité, exprimée en coups par minute, est proportionnelle à l'activité de la transcriptase inverse elle-même proportionnelle à la quantité de virus produit par les cellules MT4 infectées. The amount of radiolabeled material precipitated, expressed in counts per minute is proportional to the activity of reverse transcriptase itself proportional to the amount of virus produced by infected MT4 cells.



J3 J 4 J5 J7 J10 J11 J12 J14 J18 4 J J3 J5 J7 J10 J11 J12 J14 J18

100 μg/ml - - - - - - - - - (+) - (-) (+) ++ ++ T 100 g / ml --------- (+) - (-) (+) + + + + T

25 μg/ml (+) - (+) - (+) - (+) (+) ( +) ++ + ++ + -+ ++ ++ TT 25 mcg / ml (+) - (+) - (+) - (+) (+) (+) + + + + + + - + + + + + TT

10 μg/ml - (+) ( 4 ) ( 4 ) + + + ++ ++ ++ ++ + + ++ ++ ++ ++ ++ TT 10 mg / ml - (+) (4) (4) + + + + + + + + + + + + + + + + + + + + + + + TT

5 μg/ml (+)+(+) + + ++ + ++ ++ ++ ++ ++ ++ ++ ++ ++ ++ ++ ++ 5 g / ml (+) + (+) + + + + + + + + + + + + + + + + + + + + + + + + + + + + +

I μg/ml (+) (+) (+) (+) + (+) ++ ++ ++ ++ ++ ++ ++ ++ ++ ++ ++ ++ I mg / ml (+) (+) (+) (+) + (+) + + + + + + + + + + + + + + + + + + + + + + + +

100 ng/ml (+) (+) (+) ++ + ++ +- ++ ++ ++ ++ ++ ++ ++ ++ ++ T ++ 100 ng / ml (+) (+) (+) + + + + + + - + + + + + + + + + + + + + + + + + + + + T

50 ng/ml (+) (+) + + + + + + + + + ++ + + ++ ++ + + ++ ++ ++ ++ T 50 ng / ml (+) (+) + + + + + + + + + + + + + + + + + + + + + + + + + + + T

VIH 1 (+) (+) + + ++ + + ++ ++ + + ++ ++ ++ ++ ++ ++ ++ TT HIV-1 (+) (+) + + + + + + + + + + + + + + + + + + + + + + + + + + TT

Légende : - : absence de syncitia ( + ) : syncitia en formation + : apparition de syncitia + + : syncitia T : cel lules tuées Legend: -: no syncytia (+): + syncytia formation: appearance of syncytia + + syncitia T: cel cells killed

3. 3. Conclusions Conclusions

Lors de l'évaluation de l'inhibition de l'effet cytopathogène du virus VIH1 sur la lignée MT4 par l'oligo alpha "PBS", un retard dans la formation des syncitia est observé pour les doses non toxiques de 100 μg/ml à 10 μg/ml, ce retard pouvant atteindre le 12ème jour après l'infection à la concentration de 100 μg/ml. When evaluating the inhibition of cytopathic effect of HIV-1 virus on MT4 line by alpha trace "PBS", a delay in the formation of syncytia was observed for the non-toxic doses of 100 mg / ml 10 mcg / ml, this delay up to the 12th day after infection at a concentration of 100 micrograms / ml.

Parallèlement, le suivi de la production virale par les cellules Meanwhile, the monitoring of viral production by cells

MT4 infectées montre (figure 1 ) que quelques soient les doses d'oligo alpha Infected MT4 shows (Figure 1) that whatever alpha trace doses

"PBS" utilisées, la production virale reste inférieure à celle obtenue en présence du virus VIH1 , avec un pic de production virale maximale retardée. "PBS" used, viral production is lower than that obtained in the presence of HIV-1 virus, with a delayed peak maximum viral production.

L'ensemble de ces résultats indiquent que l'oligo alpha PBS présente un effet antiviral sur le virus VIHI . Taken together, these results indicate that the trace alpha PBS has an antiviral effect on Vihi virus.

EXEMPLE 3 : Comparaison de l'effet antiviral d'oligonucleotides "alpha PBS", "alpha Tat", "alpha random" La production de particules virales par les cellules CEM, infectées par VIH1 BRU et cultivées en présence d'oligonucleotides, est suivie par dosage de la Reverse Transcriptase (cpm). EXAMPLE 3 Comparison of antiviral oligonucleotides "PBS alpha", "alpha Tat" Indeed, "alpha random" The production of viral particles by CEM cells infected with HIV-1 BRU and cultured in the presence of oligonucleotides, followed by assay of reverse transcriptase (cpm).

L'oligonucléotide "alpha Tat" correspond à l'oligonucléotide alpha d 5 GTAAAAGTCTTAACCCAC 3' . The oligonucleotide "alpha Tat" is the alpha of 5 GTAAAAGTCTTAACCCAC oligonucleotide 3 '. Il est complémentaire de la séquence du gène Tat du virus du SIDA. It is complementary to the sequence of the Tat gene of the AIDS virus.

L'oligo nucléotide "alpha random" correspond à un oligonucléotide quelconque alpna d 5' ACTGACTGACTGACTGAC 3' . The oligo nucleotide "random alpha" refers to an oligonucleotide of any Alpna 5 'ACTGACTGACTGACTGAC 3'.

Les résultats de la Reverse Transcriptase en coups par minute comparés à un contrôle Random sont les suivants. The results of the Reverse Transcriptase in counts per minute compared to a random control are.

Figure imgf000019_0001

L'oligonucléotide "alpha PBS" montre une inhibition de la production virale pour des concentrations de 100 μg/ml et 50 μg/mi. The oligonucleotide "alpha PBS" shows inhibition of viral production at concentrations of 100 micrograms / ml and 50 mg / mi.

A la concentration de 6,25 μ/ml on remarque que l'oligonucléotide "alpha Tat" ne présente pas de production virale au jour 1 1. A concentration of 6.25 μ / ml can be seen that the oligonucleotide "alpha Tat" presents no viral production at day 1 1. Il en est de même pour le Random à 3,1. It is the same for Random to 3.1.

L'ensemble de ces résultats indique l'oligonucléotide "alpha PBS" présente un effet antiviral sur le virus HIV1 à des concentrations de 100 μg/ml et 50 μg/ML, alors que l'oligonucléotide "alpha Tat" et l'oligonucléotide "alpha Random" ne présentent aucun effet antiviral. Taken together, these results indicate the oligonucleotide "alpha PBS" has an antiviral effect on HIV-1 virus at concentrations of 100 micrograms / ml and 50 mg / ML, while the oligonucleotide "alpha Tat" and oligonucleotide " alpha Random "have no antiviral effect.

Citazioni di brevetti
Brevetto citato Data di registrazione Data di pubblicazione Candidato Titolo
WO1988004301A1 *2 dic 198716 giu 1988Centre Nat Rech Scientalpha OLIGONUCLEOTIDES
WO1988008001A1 *6 apr 198820 ott 1988Astra AbNucleosides and nucleoside analogues, pharmaceutical composition and processes for the preparation of the compounds
WO1989003217A1 *13 ott 198820 apr 1989Centre Nat Rech ScientANTIVIRAL APPLICATION OF alpha OLIGONUCLEOTIDES
Citazioni diverse da brevetti
1 *Nucleosides & Nucleotides, Volume 8, No 5&6, 1989, Marcel Dekker, Inc., R. PAUWELS et al.: "Alpha-Oligodeoxynucleotides as Inhibitors of HIV Reserve Transcriptase", pages 995-1000
Con riferimenti in
Brevetto con rif. Data di registrazione Data di pubblicazione Candidato Titolo
WO1995024916A1 *13 mar 199521 set 1995Briand Jean PaulRetropeptides, antibodies thereto, and uses thereof for vaccination and in vitro diagnosis
WO2008037924A226 set 20073 apr 2008Biomerieux SaNovel labelled oligonucleotide
EP0527916A1 *22 apr 199124 feb 1993Isis Pharmaceuticals, Inc.Antisense inhibitors of the human immunodeficiency virus
EP1016715A1 *29 set 19935 lug 2000Isis Pharmaceuticals, Inc.Oligonucleotides having a conserved G4 core sequence
US67769866 giu 199717 ago 2004Novartis AgNucleic acid sequence which, when generates mrna which anneals with mrna stranscrip from hiv-1 provirus encoding env, pol, and/or gag proteins
US815834526 set 200717 apr 2012BiomerieuxLabeled oligonucleotide
US86639233 lug 20094 mar 2014BiomerieuxDetection probe
Classificazione internazionaleC07H21/00, A61K31/70, C07H21/02, A61P31/18, A61P31/12, C12N15/09, C07H21/04, C12N15/113
Classificazione cooperativaC12N15/1132, A61K31/70, C12N2310/337, C07H21/00, C07H21/04
Classificazione EuropeaC07H21/00, C07H21/04, A61K31/70, C12N15/113A1
Eventi legali
22 nov 1993WWW
Ref document number: 1990909462
Country of ref document: EP
25 lug 1993WWR
Ref document number: 1990909462
Country of ref document: EP
13 feb 1993NENP
Ref country code: CA
1 apr 1992WWP
Ref document number: 1990909462
Country of ref document: EP
9 dic 1991WWE
Ref document number: 1990909462
Country of ref document: EP
27 dic 1990AK
Kind code of ref document: A1
Designated state(s): CA JP US
27 dic 1990AL
Kind code of ref document: A1
Designated state(s): AT BE CH DE DK ES FR GB IT LU NL SE