WO1999006537A1 - Cross-linked polypeptide assay components - Google Patents

Abstract

Enzyme subunits or fragments of this invention are covalently cross-linked so as to inhibit their ability to complement with other enzyme components and reconstitute an active enzyme complex. Either the polypeptide backbone of the enzyme or the cross-link itself contains a cleavable site. In the presence of an analyte that effects cleavage, the cross-linked component is released from its inhibited state and again becomes capable of assembling into active enzyme. Cleavage and assembly can be monitored by providing a substrate for the active enzyme complex, and reflects the amount of analyte present in the reaction.

Description

CROSS-LINKED POLYPEPTIDE ASSAY COMPONENTS

REFERENCE TO RELATED APPLICATIONS

This application claims the priority benefit of U.S. non-provisional patent application 08/902,766, filed July 30, 1997, pending.

FIELD OF THE INVENTION

The reagents and methods of this application generally relate to the detection and measurement of substances in biological samples, particularly the presence of enzymes in clinical samples. More particularly, the reagents include enzyme components that are synthetically cross- linked and have a cleavable site that permits reconstitution of enzymatic activity.

BACKGROUND OF THE INVENTION

This invention relates to compounds, compositions and methods useful for the detection of analytes by reassembly of cross-linked enzyme components. Specifically, the invention relates to cross-linking agents, formation of an intramolecular cross-link in enzyme components, and the use of such compositions in the detection and quantitation of analytes in samples. In the past, various synthetic and natural antigenic polypeptides and polypeptide fragments have been conjugated to high molecular weight protein carriers such as latex functionalized SEPHAROSE™ (Pharmacia, Inc.), tetanus toxoid, keyhole limpet hemocyanin, agarose and cellulose to detectable labels such as fluorophores, and to chemotherapeutic agents using bifunctional cross-linking agents. U.S. Patent 4,493,795 and PCT publication WO 90/05749 (published May 31, 1990) are exemplary. Such cross-linking agents have also been used to attach bioactive or cytotoxic agents, dyes, radioactive compounds and the like to antibody molecules. U.S. Patent No. 4,671,958 is exemplary. Antibodies have been linked together using such agents. See Chen, Res. Virol. 141:337-42 (1990). Cross-linking agents have also found use for modifying bioactive and therapeutically useful polypeptides by conjugation with polymers such as polyethylene glycol to enhance pharmacokinetic properties. U.S. Patent Nos. 5,166,322, 4,179,337 and 4,766,106 are exemplary. β-Galactosidase is a tetrameric protein with a monomer molecular weight of approximately 116,000 Daltons. The monomer is composed of 1023 amino acids. Intracistronic complementation is the known phenomenon whereby individually inactive peptide fragments of the enzyme spontaneously associate to form an active β-galactosidase protein. Among the first galactosidase complementation pairs investigated in depth was the MI5/CNBr2 system described by Langley and Zabin, Biochemistry 75:4866 (1976). M 15 is a deletion mutant of β-galactosidase lacking amino acids 11-41. The CNBr2 peptide consists of amino acids 3-92 of β-galactosidase and is prepared from cyanogen bromide cleavage of the intact enzyme. When MI5 and CNBr2, which are individually inactive, are incubated together under appropriate conditions, the two peptides complement or associate with each other to form fully active, tetrameric β-galactosidase. In this system, CNBr2, the N-terminal peptide, is referred to as the α-enzyme donor. MI5, which has the N- terminal deletion, is referred to as the α-enzyme acceptor. The general phenomenon which uses the reassociation of the domains of β-galactosidase to form active β-galactosidase from inactive fragments is referred to as complementation. Other combinations of α-enzyme donors and α-enzyme acceptors have been described. See Zabin, Mol. and Cellular Biochem 49:84 (1982). Each is a variant derived from the natural β-galactosidase sequence.

Complementation of a C-terminal peptide and corresponding C-terminal deletion protein has also been described. An example of this phenomenon, known as omega-complementation, is X-90, a β-galactosidase deletion variant lacking 10 amino acids at the C-terminus and CNBr24, a peptide comprising amino acids 990-1021 of β-galactosidase. As in the case of α-complementation, ω-enzyme donor polypeptides and ω-enzyme acceptor proteins are inactive but reassociate to form enzymaticaliy active tetramer. See Welphy, Biochem. Biophys. Res. Comm. 93:223 (1980). β-galactosidase complementation activity has been exploited to produce sensitive quantitative assays for both high and low molecular weight analytes. U.S. Patent Nos. 5,362,625 and 4,708,929 disclose, inter alia, a variety of enzyme donor and enzyme acceptor polypeptide compositions for use in antibody and receptor binding assays. The enzyme donors and enzyme acceptors are generated by means of recombinant DNA or polypeptide synthesis techniques familiar to skilled artisans.

These approaches allow great flexibility and control over the design of enzyme donor and enzyme acceptor molecules. The use of genetic engineering techniques allows the sequence and length of the enzyme donor and enzyme acceptor polypeptides to be modified to maximize assay performance and reagent stability. Enzyme donors optimized for chemical coupling to analyte and enzyme donors genetically fused to analyte peptides or proteins have been described, and immunoassays using these compositions are commercially available. See Henderson, Clin. Chem. 32:1637 (1986); Khanna, Amer. Clin. Lab 8:14 (1989) and Coty, J. Clin. Immunoassay 77:144 (1994).

One problem not addressed by the art in this area involves the reduction of background interference in these complementation assays. Because the enzyme donor and enzyme acceptor molecules spontaneously combine to form active enzyme, antibody or receptor binding to the unmodified enzyme donor or enzyme acceptor fragments has been relied upon in the past to inhibit such undesirable complementation.

In addition, previous commercial application of this technology has been directed primarily at the measurement of hapten (small molecule) or inert analytes. No advantage is taken of any enzymatic activity expressed by the target analyte, which could boost the sensitivity of the assay or distinguish active from inactive forms of analyte.

SUMMARY OF THE INVENTION

This invention provides materials and methods for complementation assays using enzyme components that have been inter- or intramolecularly cross-linked. The assays of this invention are based on the observation that complementation between enzyme components can be greatly reduced or inhibited by the introduction of an cross-link within one or more subunits or components of the active enzyme structure. The cross-linked enzyme component is further introduced with a cleavable moiety, either in the polypeptide backbone of the component, or into the linker itself. Upon cleavage of the moiety, the component is released back to a configuration which permits homologous or heterologous reassembly into an active form, which in turn can be used to generate an active signal in an assay system. A significant advantage of this system over those previously described is the extremely low inherent background signal. Genetic engineering techniques and other techniques known in the art can be employed to position both the cross-linking points and the cleavable moiety so that complementation activity of the cross-linked molecules is minimized before cleavage.

Aspects of the present invention include cross-linked enzyme components, methods for making the cross-linked enzyme components, novel homo- or heterobifunctional bis-maleimido cross-linking agents, and assay methods which employ cross-linked enzyme components. The reagents and assay methods are typically used for measuring analytes capable of enzymaticaliy cleaving a recognition site in the enzyme component or the cross-linker. The reagents and methods of this invention may also be brought to bear in the measurement of certain environmental conditions, such as the presence of acid, base, oxidation or reduction activity, which in turn may be the biproduct of another enzymatic reaction. Included amongst the embodiments of this invention is a cross-linked enzyme component having an inserted enzyme recognition site in a polypeptide of the component and at least one covalent intrachain cross-link between amino acid side chains of the polypeptide, wherein the cross- linked enzyme component forms an enzymaticaliy active complex with a second enzyme component upon cleavage of the enzyme recognition site, but is inhibited from forming such an active complex prior to cleavage. The intrachain cross-link can be a disulfide bond between cysteine residues or thiolated amino groups, or it can be formed by contacting the polypeptide with a homo- or heterobifunctional cross-linking agent. The second enzyme component can be formed by cleavage of an identical cross-linked enzyme component (homologous assembly) or it can be a non-identical component (heterologous assembly), in which case the second component need not be cross- linked. Also embodied in this invention is a cross-linked enzyme component, having a polypeptide with a cross-linking moiety covalently bonded between amino acid side chains of the polypeptide, wherein the cross-linking moiety comprises a cleavable site, and wherein the cross-linked enzyme component forms an enzymaticaliy active complex with a second enzyme component upon cleavage of the cleavable site, but is inhibited from forming such an active complex prior to cleavage.

In a number of embodiments of this invention, the cross-linked enzyme component is distinct from β-galactosidase, which means that reconstitution of the component into an active enzyme complex does not result in β-galactosidase activity.

Further embodiments of this invention are methods for assembling the enzyme components of this invention, comprising contacting a polypeptide with a cross-linking agent, wherein the polypeptide is capable of complementing enzyme activity and the contacting is performed under conditions where a cross-linked enzyme component of this invention is formed.

Additional embodiments of this invention are methods of using any of the cross-linked enzyme components of this invention for detecting or measuring the amount of an analyte in a sample, particularly a biological or clinical sample, wherein an increase or decrease in the amount of analyte in the sample correlates with disease, disease susceptibility, or the presence of an etiologic agent. The analyte may be an enzyme or an environmental agent capable of cleaving the peptide backbone or crosslinking moiety of the enzyme component, or an inhibitor of such an enzyme, or a polynucleotide of a particular sequence. Other aspects and advantages of the present invention will be apparent upon consideration of the following detailed description of the invention, including illustrative examples of the practice thereof.

BRIEF DESCRIPTION OF THE DRAWINGS

The present invention will be better understood by reference to the following detailed description of the invention when considered in combination with the drawings that form part of the specification, wherein:

Figure 1 is a particular synthetic scheme for preparing N-(2-trimethylsiloxyethyl)-maleimide. Figure 2 is a particular synthetic scheme for preparing 4-maleimidobutyraldehyde. Figure 3 is a particular synthetic scheme for preparing 1,7-bismaleimido-4-0-(tetraacetyl-β- D-galactopyranosyl)-5-oxaheptane and 1 ,7-bis-(3'-methoxysuccinimido)-4-0-(β-D-galactopyranosyl)- 5-oxaheptane.

Figure 4 is a sequence listing for several exemplary cross-linked enzyme components, incorporating a core enzyme donor sequence of β-galactosidase, an enzyme recognition sequence in the N-terminal direction, and a reactive amino acid (i.e., cysteine) linked to the N-terminal end via a short spacer sequence comprising a glycine repeat. The first enzyme component (SEQ. ID NO:9) contains the ICE protease recognition sequence YVAD (SEQ. ID NO:10) inside the artificial sequence CGGGYVADG (SEQ. ID NO:11), which in turn is linked onto the enzyme donor core. The second enzyme component (SEQ. ID NO:12) contains the Caspase recognition sequence DEVD (SEQ. ID NO:13) inside the artificial sequence CGGGDEVDG (SEQ. ID NO:14), which in turn is linked onto the enzyme donor core. The third enzyme component (SEQ. ID NO: 15) contains the IgA protease recognition sequence TPPTPSPS (SEQ. ID NO: 16) inside the artificial sequence CLGGGTPPTPSPS (SEQ. ID NO: 17), which in turn is linked onto the enzyme donor core. The enzyme components are cyclized through the added N-terminal Cys and the Cys imbedded near the C-terminal of the core. In the presence of the corresponding analyte enzyme, the recognition sequence is cleaved and the component is linearized, allowing it to assemble with an enzyme acceptor and provide an assay signal.

Figure 5 is a two-panel chart showing assay results of several separated fractions of a cross-linked enzyme component having the ICE protease recognition sequence YVAD (SEQ. ID NO: 10). The upper panel is a chart of absorption data for the fractions used for an assay at various dilutions of the protease. The lower panel compares the rate of the reaction in the presence and absence of the protease.

Figure 6 is a listing of the S-peptide (SEQ. ID NO: 18) and S-protein (SEQ. ID NO: 19) components of ribonuclease, which complement to create enzymatic activity. A cyclized enzyme component of this invention is made from either subunit by inserting an intramolecular cross-link; for example, between the lysine residues at positions 1 and 7 of the S-peptide.

DETAILED DESCRIPTION OF THE INVENTION

This invention provides cross-linked enzyme components, based on the sequence of any protein with catalytic activity or capable of being assembled, cleaved, or otherwise altered into a form that exhibits catalytic activity. Also embodied are methods of making such components, and their use in assays for the detection or measurement of analytes in a sample of interest. A "cross-linked enzyme component" of this invention is a compound comprising a polypeptide chain which has been covalently crosslinked internally or to a neighboring polypeptide chain. It has the characteristic of being able to assemble or reassemble so as to form an active enzyme (or to act as a co-factor required by an active enzyme), when a bond within the compound, usually either within a polypeptide or the cross-linking moiety, is cleaved by a catalytic analyte in a sample with which it is mixed.

Following the cleavage of the bond, the component reassembles internally by unfolding or refolding, or reassembles with a second component in the reaction mixture, so as to form the active enzyme complex. Where internal reassembly is involved, the reassembling enzyme component will contain a non-naturaliy occurring cross-link which is cleavable by the analyte, or a non-naturally occurring cross-link along with a heterologous sequence in a polypeptide that is cleavable by the analyte. Where reassembly with a second component is involved, the component will contain a non- naturally occurring cross-link cleavable by the analyte, or a natural or non-naturally occurring cross link along with a heterologous sequence in a polypeptide that is cleavable by the analyte.

A component or combination of components that assemble to form the active enzyme complex are typically designed from a single proteinaceous enzyme. The enzyme may naturally occur in the active form as an assembly of homologous or heterologous peptide chains, or as a single chain form. The cross-linked reassembling enzyme component may comprise a cross-linked form of a single chain or chain fragment of the naturally occurring counterpart, or a fusion of multiple chains or chain fragments in a single polypeptide. Where reassembling involves association with a second component in the reaction mixture, the second component may be homologous or heterologous to the first, and where heterologous need not be cross-linked.

The enzymatic activity of the reassembled complex may be of any nature that can be used to generate a detectable or quantifiable signal that can be correlated either positively or negatively with the presence of analyte in the sample being tested. Typically, the enzyme complex will convert a substrate to a product with different light absorbing, fluorescent, or luminescent properties that can be measured in an appropriate spectrophotometric device. Alternative enzymatic activities contemplated include those that generate a signal by some other means, such as a change in structure of a substrate that can be subsequently assayed in a follow-on reaction, such as a chemical titration, a second enzymatic reaction, or an immunoassay. Also contemplated are cascading reactions, where the reassembled enzyme complex catalyses the activation of a second enzyme, which in turn provides a detectable signal.

The enzyme components of this invention comprise a recognition site for a catalytic analyte of interest. The nature of the recognition site depends upon the application to which the cross-linked enzyme components will be put. The recognition site may comprise a peptide sequence or a nucleic acid sequence that is cleavable by an enzyme or a specific protease, nuclease or endoglycosidase by virtue of containing a protease, nuclease or glycosidase recognition sequence. Alternatively, the recognition site may comprise a substrate recognition site for a specific hydrolase enzyme such as a phosphatase, glycosidase, amidase or esterase.

Where the recognition site is a peptide sequence, it is typically contained within the polypeptide backbone of the enzyme, incorporated during peptide synthesis or by recombinant expression. Where the recognition site is for a nuclease, endoglycosidase, or other non-protease, it is typically contained within the cross-linking agent itself. The nature and assembly of these components are described in the sections that follow.

Enzyme prototypes

The cross-linked enzyme components of this invention are typically based on a previously known naturally occurring or reengineered enzyme with known structure and substrate specificity. They comprise a polypeptide (optionally glycosylated) with amino acid residues that are cross-linked through their side chains. The cross-link may be a disulfide bond, an amide bond, or any bond that is formed by cross-linking agents with at least two linking positions.

A "peptide" is any compound formed by the linkage of two or more amino acids by amide

(peptide) bonds, usually a polymer of α-amino acids in which the α-amino group of each amino acid residue (except the NH₂-terminal) is linked to the α-carboxyl group of the next residue in a linear chain. The terms peptide, polypeptide and poly(amino acid) are used synonymously herein to refer to this class of compounds without restriction as to size. The larger members of this class are referred to as proteins.

Convenient prototypes for components of this invention are enzymes which naturally occur in multi-subunit form, or which can be disassembled or cleaved into subunits or fragments known to complement each other and reconstitute enzymatic activity.

A prototype enzyme with complementary components is β-galactosidase. A number of β-Galactosidase N-terminal enzyme donor sequences are known in the art. See U.S. Patent No.

4,708,929; Langley and Zabin, Biochemistry 75:4866 (1976); Zabin, Mol. and Cellular Biochem. 49:84 (1982); Henderson, Clin. Chemistry 32:1637 (1986); Khanna, Amer. Clin. Lab. 8:14 (1989) and

Coty, J. Clin. Immunoassay 77:144 (1994).

Certain embodiments of this invention relate to enzyme components that are "distinct" from β-galactosidase. This means that the enzyme activity constituted by homologous assembly or by heterologous assembly with other polypeptides is not β-galactosidase activity. Typically, such embodiments relate to enzyme components for which the amino acid sequence is less than 50%

(and frequently less than 30%) identical to the native β-galactosidase enzyme or the enzyme donor/acceptor combination ED28 and EA22 (U.S. Patent Nos. 5,362,625 and 4,708,929).

A number of enzymes are known or predicted to have complementing subunits or fragments.

Amongst them are the following. Dihydrofolate reductase (DHFR) regenerates tetrahydrofolate from dihydrofolate, using

NADPH as the reductant. Bacterial DHFR, such as that from E. coli, is monomeric. Roles of several amino acids in DHFR function have been elucidated. Gly-15 is involved in binding, and is highly conserved for all vertebrate species of DHFR. Dicker et al., 1993, Proc. Natl. Acad. Sci. U.S.A. 90:

11797-801. Leu22 is thought to lie in the active site of the enzyme and is involved in methotrexate binding. Dicker et al., 1990, J. Biol. Chem. 265: 8317-21. Phe91 is thought to be involved in the

DHFR active site in hydrophobic interactions with methotrexate. Srimatkandada et al., 1989, J. Biol.

Chem. 264: 3524-8.

Crystal structures of bacterial and chicken liver dihydrofolate reductase have been obtained.

McTigue et al., 1993, Biochemistry 32: 6855-62; Lee et al, 1996, Biochemistry 35: 7012-20. More recently, loop and subdomain movements in the mechanism of E. coli dihydrofolate reductase have been determined. The reaction catalyzed by £. coli dihydrofolate reductase (ecDHFR) cycles through five detectable kinetic intermediates. Isomorphous crystal structures analogous to these five intermediates and to the transition state (as represented by the methotrexate-NADPH complex) have been used to assemble a 2.1 A resolution movie depicting loop and subdomain movements during the catalytic cycle. The M20 loop is closed over the reactants in some complexes, and changes structure at various times in the cycle of binding. Sawaya et al, 1997, Biochemistry 36: 586-603. For additional analysis of DHFR's function and structure, see Schweitzer et al, 1990, FASEB J. 4: 2441-2452; Brown and Kraut, 1992, Faraday Discussions 1992: 217-224; Bystroff et al, 1990, Biochemistry 29: 3263-3277.

Bacterial luciferase (EC 1.14.14.3) catalyses a reaction between a long-chain aliphatic aldehyde, reduced flavin mononucleotide, and oxygen, which produces an activated FMN.H₂0 complex that breaks down with the emission of light. The role of several amino acids, including alpha W250 and alpha W194, in binding have been elucidated. Li et al, 1995, Biochemistry 34: 15084-90.

Luciferase, as isolated from Vibrio harveyi, is an alpha beta heterodimer. When allowed to fold in the absence of the alpha subunit, either in vitro or in vivo, the beta subunit of enzyme will form a kinetically stable homodimer. Sinclair et al. Nature Struct. Biol. 1: 320-326). The X-ray crystal structure of the beta 2 homodimer of luciferase from V. harveyi has been determined; a non-prolyl cis peptide bond between Ala74 and Ala75 in the alpha subunit may be important in creating a cavity at the active site. Fisher et al, 1996, J. Biol. Chem. 271 : 21956-68.. Thoden et al, 1997, Protein Sci 6: 13-23; Tanner et al, 1997, Biochemistry 36: 665-72; Baldwin et al, 1995, Curr. Opin. Struct. Biol. 5: 798-809. In addition, an active monomeric bacterial luciferase has been produced by fusing the coding segments of the alpha and beta subunits into a single monomeric coding segment. Escher et al, 1989, Proc. Natl. Acad. Sci. U.S.A. 86: 6528-32.

Alkaline phosphatase (EC 3.1.3.1) catalyses the removal of 5'-phosphate residues from nucleic acids. It is a dimeric glycoprotein consisting of two identical subunits (subunit Mr 69,000) and four atoms of zinc per molecule. Alkaline phosphatase may be obtained from E. coli (BAP) or calf intestine (CIP).

Alkaline phosphatase was the first zinc enzyme to be discovered in which three closely spaced metal ions (two Zn ions and one Mg ion) are present at the active center. The structure of this enzyme has been determined. Ser102, the residue phosphorylated during phosphate hydrolysis, lies in the required apical position to initiate a nucleophilic attack on the phosphorous. Coleman, 1992, Annu. Rev. Biophys. Biomol. Struct. 21: 441-83; Kim et al, 1990, Clin. Chim. Acta 186: 175-87. Based on the refined crystal structure of £ coli alkaline phosphatase, it appears that the active site and the core of the structure are retained in two Bacillus subtilis alkaline phosphatases. Hulett et al, 1991, J. Biol. Chem. 266: 1077-84. Membrane-bound human liver alkaline phosphatase solubilized by a non-ionic detergent has the molecular mass of a tetramer; however, it can be converted and purified as a dimer. Hawrylak et al, 1987, FEBS Lett. 212: 289-91. The hydrophobic core of the £. coli alkaline phosphatase has been successfully replaced with the core from the signal of the maltose-binding protein OmpA. Laforet et al, 1989, J. Biol. Chem. 264: 14478-85. Penicillin amidase (PA; penicillin amidohydrolase, EC 3.5.1.11) has been isolated from several organisms, including £ coli, Proteus rettgeri and Arthrobacter viscosus. Robak et al, 1981 , Acta Biochim. Pol. 28: 275-84; Konstantinovic et al, 1994, Gene 143: 79-83. £ coli PA is an enzyme without S-S bridges and a pH stability range of 4-9. Two molecular forms of penicillin amidase synthesized by £ coli. Szewczuk et al, 1987, Acta. Biochim. Pol. 34: 451-9. Mutant amidases with altered catalytic efficiency and specificities have been identified. Forney et al, 1989, Appl. Envir. Microb. 55: 2556-60; Forney et al, 1989, Appl. Envir. Microb. 55: 2550-5. β-lactamase is a bacterial penicillinase encoded by the bla gene, which is commonly available through popular plasmids such as pBR322 and pUC series plasmids. β-lactamase is monomeric. The crystal structure of Staphylococcus aureus β-lactamase has been determined. Zawadzke et al, 1996, Biochemistry 35: 16475-82. Several amino acids involved in activity have been identified. In a S70A mutant enzyme, the nucleophilic group that attacks the β-lactam carbonyl carbon atom was eliminated, and the K73H mutation eliminates activity. Chen et al, 1996, Biochemistry 35: 12251-58. Another study found that 43 out of the 263 amino acid residues do not tolerate substitutions and therefore are critical for the structure and activity of the enzyme. Huang et al, 1996, J. Mol. Biol. 258: 688-703.

Cytochrome c, an electron carrier in the respiratory chain of mitochondria, carries electrons from cytochrome reductase to cytochrome oxidase. Cytochrome c consists of a single polypeptide chain of 104 amino acid residues and a covalently attached heme group. The three-dimensional structures of the ferrous and ferric forms of cytochrome c from tuna have been elucidated at high resolution by Dickerson, 1972, Scientific American 226: 58-72; Pelletier and Kraut, 1992, Science 258: 1748-1755; Capaldi, 1990, Ann. Rev. Biochem. 59: 569-596. The octaheme cytochrome C3 (M(r) 26,000; cc3) from Desulfovibrio desulfuricans Norway is a dimeric cytochrome made up of two identical subunits, each containing four heme groups; the dimeric interface has been examined. Czjzek t al, 1996, Structure 4: 395-404. An active cytochrome c has also been reconstituted from subunits from different organisms. Corradin et al, 1979, J. Exp. Med. 149: 436-47.

Cytochrome oxidase, the last of the three proton-pumping assemblies of the respiratory chain, catalyzes the transfer of electrons from ferrocytochrome c (the reduced form) to molecular oxygen, the final acceptor. This reaction is carried out by a complex of 10 subunits, of which 2 (subunits I, II and III) are encoded by the mitochondrion's own genome. Cytochrome oxidase contains two heme A groups and two copper ions. The topology of the subunits of the mammalian cytochrome c oxidase is described by Zhang et al, 1991, Biochemistry 30: 3674-3681.

Treatment of cytochrome c oxidase with trypsin indicated that the hydrophilic domain of 26 kDa can be easily cleaved off from the hydrophobic anchor domain at the N-terminal region of subunit II, but remains attached to the rest of the enzyme upon gel-filtration in the presence of 0.2% lauroyl sarcosinate. Tashiro et al, 1995, J. Biochem. 117: 521-6. However, attempts to reconstitute cytochrome c oxidase after removal of subunit Vlb were unsuccessful. Weishaupt et al, 1992, Biochem. 31 : 11477-81. The thermal denaturation of membrane-reconstituted cytochrome c oxidase has also been examined. Rigell et al, 1987, Biochemistry 26: 4366-71. Cytochrome c oxidase has also been reconstituted in liposomes. Sone et al, 1982, J. Biol. Chem. 257: 12600-4; Solioz et al, 1982, J. Biol. Chem. 257: 1579-82; Muller et al, 1985, J. Bioenerg. Biomembr. 17: 385-93.

Lactose permease pumps lactose into bacterial cells by drawing on the proton-motive force. The enzyme is a 47-KDa integral membrane protein containing a proton-binding and a lactose- binding site. For review, see Kaback et al, 1990, Trends Biochem. Sci. 8: 309-314. Lactose permease is thought to comprise 10 membrane-spanning helices, which are either hydrophobic or amphipathic. Vogel et al, 1985, EMBO J. 4: 3625-31. Kluyveromyces lactis lactose permease encoded by the LAC12 gene is thought to be monomeric. Dornmair et al, 1985, EMBO J. 4: 3633-8; Sahin-Toth et al, 1994, Proc. Natl. Acad. Sci. USA 91: 5421-5. Several residues involved in lactose transport have been identified, including Cys148, Asp237, Asp240, Glu269, Arg302, Lys319, His322, Glu325, and Lys358. Sahin-Toth et al, 1992, Proc. Natl. Acad. Sci. USA 89: 10547-51 ; Wu et al, 1994, Biochemistry 33: 12166-71.

Complementation of lactose permease mutants by other permease mutants has been described. Bibi et al, 1990, Proc. Natl. Acad. Sci. USA 87: 4325-9; Bibi et al, 1992, Proc. Natl. Acad. Sci. USA 89: 1524-8; Wrubel et al, 1990, J. Bacteriol. 172: 5374-81.

The maltose permease, a protein required for the transport of maltose across the plasma membrane, is encoded by the MAL61 gene of Saccharomyces cerevisiae exhibits both sequence and structural homology to other sugar transporters. Hydropathy analysis suggests that the secondary structure consists of two blocks of six transmembrane domains separated by an approximately 71 residue intracellular region. The N-terminal and C-terminal domains of 100 and 67 residues in length, respectively, also appear to be intracellular. Cheng et al, 1989, Genetics 123: 477-84. The amino acid composition and sequence of the deduced protein shows that it is highly hydrophobic and has a size of 68.2 kDa. Computer-generated hydropathy profiles suggest that the MAL6T protein may have up to nine membrane-spanning regions. Yao et al, 1989, Gene 79: 189- 97.

SecA is one of several bacterial proteins that work in concert in protein translocation across the cell membrane of £ coli. This translocation is catalyzed by a soluble chaperone, SecB, and a membrane-bound, multi-subunit translocase. SecB keeps nascent chains in an unfolded or partially folded state to enable them to traverse the membrane. SecB presents the nascent chain to SecA, a peripheral membrane component of the translocase. SecA works in concert with SecY and SecE, the membrane-embedded portion of the translocase. Two forms of free energy drive protein translocation in £ coli: ATP and proton-motive force. SecA is an ATPase- the ATP state has high affinity for the protein undergoing translocation, whereas the ADP state has low affinity. Segments of the nascent chain are successively handed from SecA to the SecY-SecE chain as a result of multiple rounds of ATP hydrolysis.

A truncated Bacillus subtilis SecA protein consisting of the N-terminal 234 amino acid residues forms a complex with £ coli SecA51(ts) protein and complements the protein translocation defect of the secA51 mutant. Takamatsu et al, 1994, J. Biochem. 116: 1287-94; Klose et al, 1993, J. Biol. Chem. 268: 4504-10.

SecA analogues have also been reconstituted from amino-terminal and carboxyl-terminal fragments of SecA. Kimura et al, 1991 , J. Biol. Chem. 266: 6600-6. Alanine racemase is an enzyme important to bacterial cell wall synthesis. The crystal structure of alanine racemase from Bacillus stearothermophilus has been determined. The alanine racemase monomer is composed of two domains, an eight-stranded alpha/beta barrel at the N- terminus (residues 1-240), and a C-terminal domain essentially composed of beta-strand (residues 241-388). In the structure of the dimer the mouth of the alpha/beta barrel of one monomer faces the second domain of the other monomer. Shaw et al, 1997, Biochemistry 36: 1329-42. This enzyme also has a hinge structure essential for a catalytically efficiency and sensitive to active site geometry. The sequence at the hinge region is also conserved in alanine racemases from Gram-positive bacteria. Galakatos et al, 1987, Biochemistry 26: 8475-80.

The structure of cytochrome b5 reductase, a flavin-dependent reductase, has also been determined. The molecular structure of the cytochrome b5 reductase from pig liver reveals two domains, the FAD binding domain and the NADH domain. A large cleft lies between these two domains and contains the binding site for the FAD prosthetic group. The backbone structure of the FAD binding domain has a great similarity to that of ferredoxin-NADP+ reductase [Karplus et al, 1991 , Science 251 : 60-65], in spite of the relatively low sequence homology (about 15%) between the two enzymes. The electrostatic potential of the surface near the flavin-protruding side (dimethylbenzene end of the flavin ring) of NADH-cytochrome b5 reductase was positive over a wide area while that of the surface near the heme-binding site of cytochrome b5 was negative. This implied that the flavin-protruding side of NADH-cytochrome b5 reductase is suitable for interacting with its electron-transfer partner, cytochrome b5. Nishida et al, 1995, Biochemistry 34: 2763-7; Nishida et al, 1996, Proteins 26: 32-41.

The structure of staphylococcal nuclease (SNase) has also been determined, as has that of several mutants or nuclease enzymes containing deuterated amino acids; these studies revealed that Glu 43 acts a general basic catalyst to assist the attack of water on a phosphodiester substrate. Loll et al, 1989, Proteins: Struct, Fund, Genet. 5, 183; Pourmotabbed et al, 1990, Biochemistry 29: 3677-83; Hynes et al, 1991, Proteins 10: 92-105; Chuang et al, 1993, Proteins 17: 36-48; Keefe et al, 1994, Protein Sci. 3: 391-401; Gamble et al, 1994, Biophys. Chem. 53: 15-25. The equilibrium folding pathway of staphylococcal nuclease (SNase) has also been approximated using a statistical thermodynamic formalism that utilizes the high-resolution structure of the native state as a template to generate a large ensemble of partially folded states. Hilser et al, 1997, Proteins 27: 171-183.

Staphylococcal nuclease is a monomeric protein, although deletion of six amino acids from a surface loop transforms it into a stable dimer. Green et al, 1995, Nat. Struct. Biol. 2: 746-51. Two overlapping fragments of staph nuclease are able to complement each other. The complementing heterologous pair consists of a 42 amino acid polypeptide, designated nuclease T-P_M8, and a 100 amino acid residue, designated nuclease T-P_49ι50.₄₉. See Tamiuchi et al, 1969, J. Biol. Chem. 244:3864; Taniuchi et al, 1977, J. Biol. Chem. 252: 125-40; and EP patent application No. 0,243,797 Thioredoxin plays a key role in coordinating the light and dark reactions of photosynthesis.

Thioredoxin is a 12-KDa protein containing neighboring cysteine residues that cycle between a reduced sulfhydryl and an oxidize disulfide form. For reviews, see Holmgren, 1989, J. Biol. Chem. 264: 13963-13966; Eklund et al, 1991 , Proteins 11 : 13-28; Dyson et al, 1990, Biochemistry 29: 4129-4136. Thioredoxin exists in all organisms and is responsible for the hydrogen transfer to important enzymes for ribonucleotide reduction and the reduction of methionine sulphoxide and sulphate. Thioredoxins have also been shown to regulate enzyme activity in plants and are also involved in the regulation of transcription factors and several other regulatory activities. Thioredoxin from £ coli is a small hydrogen transport protein containing 108 amino acid residues and having in its oxidized form a single disulfide bond. Thioredoxin has also been purified from Corynebacterium nephridii. McFarlan et al, 1989, Eur. J. Biochem. 179: 389-398. The structures of thioredoxins from a number of species, including man and £ coli and cyanobacterium Anabaena, are known. Saarinen et al, 1995, Structure 3: 1097-108; Qin et al, 1996, Structure 4: 613-20. Human thioredoxin is dimeric, linked by S-S bridges of Cys73 of each monomer. Weichsel et al, 1996, Structure 4: 735. Thioredoxin has also been reconstituted from peptide fragments. Slaby et al, 1975, J. Biol.

Chem. 250: 1340-7; Tasayco et al, 1995, Proteins 22: 41-4.

Adenylate kinase is a monomeric enzymes that catalyzes the interconversion of ATP, ADP and AMP. Crystal structures have been determined for adenylate kinases from several organisms, including £ coli and yeast. Muller et al, 1992, J. Mol. Biol. 224: 159-77; Abele et al, 1995, Protein Sci. 4: 1262-71.

Barnase is a bacterial ribonuclease from the bacterium Bacillus amyloliquefaciens. The aspartate residues in the bridges Arg69-Asp93 and Arg83-Asp75 appear to be important in stability of the protein. Tissot et al, 1996, Biochemistry 35: 6786-94. Barnase comprises six modules: M1 , 1- 24; M2, 25-52; M3, 53-73; M4, 74-88; M5, 89-98; and M6, 99-110. Takahashi et al, 1997, FEBS Lett. 405: 47-54. Other amino acids are known to be important in the barnase active site. Meiering et al, 1992, J. Mol. Biol. 225: 585-9; Meiering et al, 1991, Biochemistry 30: 11348-56. Crystal structures have been determined for complexes of barnase and d(GpC), barnase and 3'GMP, barnase and barstar, which binds to and inhibits barnase, and barnase and a substrate analog, the tetradeoxynucleotide, CGAC (SEQ. ID NO:20). Baudet et al, 1991 , J. Mol. Biol. 219: 123-32; Guillet et al, 1993, FEBS Lett. 330: 137-140; Buckle et al, 1994, Biochemistry 33: 8878-89; Buckle et al, 1994, Biochemistry 33: 1644-53. A peptide corresponding to residues 1-22 of barnase that contains its major α-helix (residues 6-18) binds rapidly to the complementary peptide (residues 23-110) to form a catalytically active complex with near native structure. Kippen et al, 1995, Biochemistry 34:1464-1468.

Peptidase recognition sites

Cross-linked enzyme components of this invention for measuring peptidase analytes incorporate a specific amino acid sequence recognizable by the peptidase of interest.

In most embodiments of this invention, the recognition sequence is heterologous to the naturally occurring amino acid sequence of the enzyme prototype. It is "inserted" into the enzyme sequence during chemical synthesis or expression of a recombinant polynucleotide with the corresponding encoding region. Assembly of the chimeric sequence is described in more detail in a later section of this disclosure.

To prevent false-positive reactions, the recognition sequence is preferably unique to the analyte in comparison with other proteases that may occasionally be found in like samples. Conversely, the analyte protease will typically be highly specific for a particular amino acid sequence, usually at least 4 amino acids in length, such that cleavage of the component will occur in a predictable fashion and not unnecessarily diverted by other proteins that may be present in the reaction mixture. Of interest are recognition sequences for viral proteases, and for proteases overexpressed during inflammation, cancer or cellular apoptosis that is associated with clinical disease states. Of particular interest are recognition sequences for HIV protease, N. gonorrhea protease, Glu-C protease, ICE protease, Caspase, and IgA protease.

Viral proteases such as HIV-1 and HIV-2 protease, coxsackie virus protease and herpes virus protease recognize specific peptide substrate sequences of the host's cellular proteins. HIV-1 protease is of particular interest because it is responsible for the proteolytic processing of the gag and gag-pol proteins to form infectious virions. See Kramer, Science 237:1580 (1986) and Kohl, Proc. Natl. Acad. Sci. 85:4686 (1988). The HIV protease recognizes and cleaves the octapeptide sequence SQNYPIVQ (SEQ ID NO:1), corresponding to the Pr55 gag p 17/p24 cleavage site, and the decapeptide sequence VSFNFPQITL (SEQ ID NO:2), corresponding to the p6/PR cleavage site of the gag-pol protein. See Krausslich, Proc. Nat. Acad. Sci. 86:807-11 (1989). Thus, peptide sequences that are recognized and cleaved by such HIV proteases can be employed as the recognition site. See, for example, Baum, Proc. Nat. Acad. Sci. 87:10023-27 (1990) which discloses insertion of an HIV protease recognition site into a non-cross-linked β-galactosidase gene, and Liebig, Proc. Nat. Acad. Sci. 88:5979-83 (1991) which discloses fusion of a human rhinovirus proteinase with a non-cross-linked α-fragment of β-galactosidase.

Another exemplary analyte is interleukin-l-β converting enzyme (ICE protease), which plays a role in apoptosis (cell death). The protease plays a role in IL-1β processing and secretion. , and is a major mediator of inflammatory disease. ICE proteases have also be implicated in the programmed cell death of neuronal cells. Schwartz et al, 1996, Trends Neurosci. 19:555. For a description of the structure and function of the family of ICE proteases, see Tocci, 1997, Vitamins & Hormones 53:27. The ICE protease has a well-defined specificity for the sequence -X-Val-Y-Asp-Z- (SEQ ID

NO:3). Cleavage of the sequence by ICE protease occurs after the Asp. The minimal and best peptide substrate sequence found heretodate to elicit action of the ICE protease enzyme appears to be Ac-Tyr-Val-Ala-Asp-NH-CH₃ (SEQ ID NO:4). See Thornberry, Nature 356:768-74 (1992). A potent inhibitor of ICE protease contains the sequence Ac-Tyr-Val-Ala-Asp-* (SEQ ID NO:5), where * stands for chloromethylketone. See Nature 375:78-81 (1995). Incorporation of the ICE protease recognition site into a synthetic cross-linked enzyme component would permit the development of a simple, rapid assay for this important protease.

Another exemplary analyte is Caspase, a peptidase in the same death-domain containing family as ICE protease. Overexpression of Caspase-8 induces apoptosis in an manner that is dependent upon the cell surface marker CD95. Yuan, 1997, Current Opin. Cell Biol. 9:247, 1997. A potential recognition sequence for Caspase is DEVD (SEQ. ID NO:13).

Other exemplary analytes are proteases that are exquisitely specific for human IgA of the lgA1 subtype. The hinge region of lgA1 contains a tandem repeat of the sequence TPPTPSPS (SEQ. ID NO: 16), and this repeat is cleavable at several positions by enzymes secreted by infectious bacteria such as Neisseria gonorrhoeae, Neisseπa meningltidis, Hemophilus influenzae, Streptococcus pneumoniae, and Streptococcus sanguis. For general reviews of the IgA family of proteases, the reader is referred to Kornfeld et al, 1981 , Rev. Infect. Dis. 3:521 ; and Plaut, 1983, Annu. Rev. Microbiol. 37:603. IgA protease production can be used to distinguish pathogenic from harmless Niesseriaceae: Mulks et al, 1978, New Engl. J. Med. 299:973. Accordingly, assays for IgA protease production are potentially important in detecting and diagnosing microbial infection.

Cross-linking agents

Enzyme components of this invention contain a cross-link between amino acid residues. The term "cross-link" as used in this disclosure refers to the covalent chemical attachment of a cross-linking agent between two reactive amino acid residues in one or more polypeptide components of an active enzyme. The link may, for example, be in the form of a disulfide or peptide bond between amino acid side chains, or formed as a result of contacting the polypeptide with a multifunctional cross-linking agent. Where the cross-link is intramolecular, a "cyclic" enzyme polypeptide is created.

Cross-linked components of the invention comprise sequences that contain reactive amino acid residues that permit attachment of a cross-linking agent which comprises cross-linking moieties. Reactive amino acid residues permitting attachment to such moieties are α- or ε- amino groups (e.g., lysine), a-, β- or γ-carboxyl groups (e.g., aspartic acid or glutamic acid), thiol groups (e.g., cysteine), and aromatic rings (e.g., histidine or tyrosine). Other reactive groups found on amino acids include double bonds, alcohol groups, and the like.

The cross-linking moiety is an integral part of the cross-linking agent and comprises a chemical moiety or functional group that enables the cross-linking agent to covalently bond to reactive amino acid residues. For example, a cross-linking agent useful to covalently couple thiol groups of proteins and peptides is bis-maleimidohexane (BMH). This cross-linking agent comprises a hexamethylene moiety having maleimido cross-linking moieties attached to each end of the hexamethylene. Other exemplary cross-linking agents are described in Chemistry of Protein Conjugation and Cross-Linking, S.S. Wong, CRC Press, 1993.

The amine groups of reactive amino acids in the enzyme component polypeptide may be cross-linked by reaction with an amino group-reactive moiety of the cross-linking agent. N-hydroxysuccinimide, dimethylsuberimidate, phenyldiisocyanate, phenyldiisothiocyanate, difluorodinitrobenzene and cyanic chloride are exemplary amino group reactive moieties suitable for use in cross-linking agents. The thiol groups of reactive amino acids may be cross-linked by reaction with a sulfhydryl-reactive moiety of the cross-linking agent. Exemplary reactive groups are S-pyridyl, maleimide and bromoacetyl moieties. The carboxyl groups of reactive amino acids may be cross-linked by reaction with carbodiimide or hydrazide moieties.

The cross-linking moieties may be homo- or heterobifunctional, such that cross-linking between the appropriate residues, preferably at or near the N-terminal and C-terminal residues of the enzyme component, is accomplished. Thus, the cross-linking agent will have two reactive groups capable of covalent chemical attachment to the amino, thiol, carboxyl or aromatic groups of the desired amino acid residues of the enzyme component polypeptide.

When the polypeptide is formed by peptide synthesis, non-encoded amino acids may be inserted with activatable side-chains at particular points in the sequence. Upon activation, these residues will either link to an agent or to another point in the polypeptide chain. One example is the amino acid analog p-benzoyl-L-phenylalanine, the synthesis of which is described by Cauer et al. (J. Biol. Chem.26V.10695-10700, 1986.

If the desired analyte is a specific nucleotide sequence, i.e., a target nucleotide, the cross- linking agent can comprise a single-stranded oligonucleotide sequence complementary to the target nucleotide sequence. The complementary sequence is usually between 4 and 100 nucleotides in length, and is more typically about 20 to 40 nucleotides in length. The presence of the analyte nucleotide sequence results in hybridization between the single-stranded oligonucleotide sequence and the target nucleotide sequence. This newly formed duplex can then be cleaved by the addition of a double-stranded specific nuclease (for example a restriction endonuclease or RNAase H), resulting in the linearization of cross-linked enzyme components that have formed duplexes with complementary analyte nucleic acid sequences, permitting assembly of the reagent enzyme and production of an assay signal. Exemplary analytes include the nucleic acid sequences of infectious pathogens such as bacteria and viruses, including, for example, mycobacteria tuberculosis, streptococcus, N. gonorrhea, HIV, herpes viruses such as cytomegalovirus, Epstein Barr virus, varicella zoster virus and herpes simplex, hepatitis and chlamydia.

Several additional groups of analytes or chemical environmental conditions can also be detected or measured using this technology. For example, the cross-linking agent selected could be one that is sensitive to cleavage by a specific chemical or environmental condition (pH, temperature, oxidation, reduction, etc.). Enzymes which do not directly cleave the cross-linking agent but whose activity results in the production of a metastable linker which can subsequently undergo cleavage (indirect linker cleavage), are also detectable by this method. An example of this is a galactosyl- or phosphate-derivatized, acetal-containing, linker in which the activity of the enzymes β-galactosidase or phosphatase, respectively, result in a severely destabilized and ultimately cleaved cross-linker. In this embodiment, it should be noted that when the analyte is itself used as an enzyme label (for example β-galactosidase, alkaline phosphatase, peroxidase, etc.) the present invention is useful as a powerful signal amplification system, because upon cleavage of the first substrate, i.e., the cross-linked enzyme component containing enzyme cleavable cross-linker, an active enzyme is formed that can cleave multiple molecules of a second calorimetric, fluorescent or chemiluminescent substrate. Such cross-linkers have the formula W(CH₂)_n-X-CH(OY)-(CH₂)_n-Z wherein W and Z are each a functional group selected from the group consisting of maleimide, succinimide and thiocyanate; n is a number from 1 to 10; X is oxygen, sulfur or nitrogen; and Y is an enzymaticaliy cleavable moiety selected from the group consisting of galactose, mannose, glucose, phosphate, butyrate and acetate.

In embodiment where the analyte to be measured is an enzyme, the cross-linking agent may comprise a chemical moiety that acts as a substrate site for the analyte enzyme. The enzyme reacts with the substrate site to destabilize the cross-linking agent, causing it to spontaneously hydrolyze to yield linearized enzyme component. For example, acetal glycosides of aldehydes are known that, upon cleavage by a specific glycosidase enzyme, produce hydroxyacetals which spontaneously hydrolyze in aqueous solution to yield parent aldehydes. Based on this knowledge, a novel homobifunctional cross-linking agent was designed that contains a glycosyl acetal moiety. Upon removal of the glycosyl residue by the action of the glycosidase enzyme, the hydroxy acetal is generated which spontaneously hydrolyses. The net result is cleavage within the cross-linking agent and consequent linearization of the cross-linked enzyme component. These glycosyl-containing cross-linking agents have the formula

wherein each R is independently hydroxy or acetate.

Additionally, it is possible to construct cross-linking agents which are susceptible to cleavage by chemical or environmental conditions. For example, it is possible to select or design cross-linking agents having spacers between the cross-linking moieties which are cleaved by acid, base, oxidation, reduction, temperature, light and so forth. An exemplary cross-linking agent useful for this purpose is the acid-labile 2,2-bis-maleimidoethoxypropane (BMEP), which is cleaved by mild acid hydrolysis. Other such reagents are known in the art and may be employed in an analogous manner.

Design of cross-linked enzyme components

The development of a cross-linked reassembling enzyme component from a prototype enzyme involves the steps of: inserting the cross-linking agent into the enzyme, enzyme subunit, or enzyme fragment; and, if the cross-linking agent is not itself cleavable by the analyte, also inserting a cleavable heterologous sequence into a polypeptide of the component. (The term "inserting" refers to design of the structure of the component wherein the inserted component is not found in exactly the same context in nature; no implication is intended as to the method of manufacture of the component). Any arrangement of cross-link and heterologous sequence that prevents reassembly before cleavage, but permits reassembly after cleavage is suitable, and may be determined empirically.

A systematic approach to obtaining cross-linked reassembling enzyme components is to base the location of the cross-link and heterologous sequence upon known structural features of the prototype. The functional elements of prototype enzyme can be mapped onto their structure by other techniques known in the art, such as photoreactive cross-linking, characterization using a panel of monoclonal antibodies, and mutation analysis.

Ideally, full structural information of the prototype active enzyme is known by way of its amino acid sequence, its crystal structure, and the location of active site for the substrate. A large number of suitable enzymes (including many of those exemplified in the previous section) have been characterized in detail by way of crystal structure. Sequence and coordinate data is available through the Protein Database of the U.S. National Institutes of Health. Advanced computer algorithms are available (e.g., at the University of Oregon) for manipulating 3-dimensional projections of enzymes, determining interacting surfaces of enzyme subunits and the effects of making amino acid substitutions or insertions. Once structural features are known, possible positions for the cross-link are designed that prevent enzymatic activity when in place. For example, the cross-link may be positioned so as to prevent access of the substrate to the catalytic site, or to prevent access of an enzyme co-factor to its binding site.

More typically, the cross-link is positioned so as to prevent a portion of the enzyme from associating with a second portion (within or between polypeptide chains) so as to form the catalytic site. Particularly suitable are portions that are involved in an internal hydrophobic or other non- covalently bonded interface between subunits or regions of the molecule. Thus, the presence of the cross-link prevents the interface from forming until cleavage occurs.

The importance of subunit or fragment interfaces in assembling enzymatic activity is demonstrated in several types of experiments. Jones et al. (1985, Biochemistry 24:5852) showed reversible dissociation of dimeric tyrosyl-tRNA synthetase by mutagenesis at the subunit interface. Ward et al. (1987, Biochemistry 26:4131) prepared different heterodimeric enzymes of tyrosyl-tRNA synthetase by site-directed mutagenesis at the subunit interface to analyze the role of salt bridges, and found that such bridges affected specificity in dimerization. Babe et al. (1992, Protein Science 1 :1244, 1992) prepared synthetic interface peptides that altered dimeric assembly of the HIV 1 and 2 proteases.

Where the cross-link is not itself cleavable by the analyte, a heterologous sequence is positioned within the polypeptide so as to permit the cross-linked portion to move out of the way, allowing access of the substrate to the active site, or allowing the active site to form, for example, by formation of a subunit interface. Most usually, an inserted heterologous proteolytic cleavage recognition site is incorporated into the enzyme sequence internally, between the two reactive amino acid residues used for the cross-linking reaction.

In combination (or as an alternative) to these predictive modeling techniques, cross-linked enzyme components of this invention are identified or refined by empirical testing. A complementing subunit or fragment of an enzyme is pared down to the minimum number of amino acids necessary to assemble active enzyme complex. This is often more convenient with the smaller of the subunits in the assembled complex, in part, because of the ease of chemical synthesis of shorter sequences. Once the functional core of the component is identified, reactive amino acids can be added onto one or both ends that permit cross-linking around or back into the core. Generally, in any of the cross- linked enzyme components of this invention, the developer will aim for an activity reconstituted by the cross-linked enzyme of less than about 10% of the non-crosslinked equivalent, preferably less than about 1%. Once an inactive cross-linked form of the enzyme component has been successfully designed and obtained, a heterologous protein recognition sequence is optionally incorporated into the structure. A heterologous protease recognition sequence, if present, is conveniently inserted between the terminal reactive amino acid and the core, which helps ensure that cleavage by the analyte will open the cyclized component in a way that permits it to assemble into an enzyme complex. Short neutral linking peptide groups (polygly/ala or helix forming structures, or relatively shapeless sequences with a proportion of charged side chains) may be added between the reactive amino acid and the recognition site, or the recognition site and the enzyme core, to permit access of the analyte to the site or facilitate reconstitution. This approach is exemplified by the cyclized enzyme donor polypeptides described in the example section. In principle, the approach for generating a cyclized enzyme component based on another prototype enzyme is the same.

Another example of a cyclized enzyme component of this invention is based on the prototype enzyme ribonuclease. Bovine pancreatic ribonuclease (Rnase-A) is one of the best characterized RNAses, and consists of a single chain of 124 amino acids (13,683 mol wt). When subjected to limited digestion by subtilisin, the peptide bond between residues Ala 20 and Ser 21 is cleaved. The two fragments, S-peptide (residues 1-20) and S-protein (residues 21-124) can be separated and reconstituted to give the fully active complex ribonuclease S.

Figure 6 is a listing of the bovine RNAse S-peptide (SEQ. ID NO:18) and S-protein (SEQ. ID NO: 19), which complement each other to create enzymatic activity.

A number of studies interrelating RNAse structure and function have been published: See, e.g., Simonson et al, 1992, Biochemistry 31 :8661 ; Varadarajan et al, 1992, Biochemistry 31:12315; Kim et al, 1992, Biochemistry 31:12304. Ehrat et al. (1986, Clin. Chem. 32:1622) outline substrate- leash amplification systems using RNAse S-peptide and S-protein. U.S. Patent No. 5,106,950 describes polypeptide-labeled analyte analogs for use in immunoassays and capable of binding a polypeptide partner. The exemplary polypeptide pair of the disclosure is bovine S protein, and S peptide from dromedary, kangaroo, rat, or preferably bovine. Hapten analytes such as cortisol, dilantin and thyroxine are conjugated onto S-peptide at a location and in a manner that still permits it to form an active enzyme complex with S-protein. Substrates used for the complex include uridine-3'-α-naphthyl phosphate/p-diazoosulfanilic acid, which produces a chromophoric product, and 5'-0-acetyl uridine-3'-(4-methylumbelliferone-7-yl phosphate), which produces a fluorescent product.

Lysine residues at positions 1 and 7 of the S-peptide, and positions 31, 37, 41 , 61 , 66, 91 , 98, and 104 of the S-protein, are available for cross-linking using an amino-active crosslinking agent. Lysine residue 41 of the S-protein may be crucial for retention of catalytic activity. Glutamate residues at positions 2 and 9 and the aspartate residues at position 14 of the peptide are available for derivatization. No cysteines are present in S-peptide, and there are several disulfide linkages in S-protein: 26-84, 40-95, 58-110, and 65-72. In principle, most of these (except for residue 41) could be cross-linked to form an inactive enzyme component of this invention.

Cross-linking S-peptide is probably less complicated and likely to generate a larger proportion of inactive derivative because of its smaller size. The lysines can be cross-linked using an amino-reactive homobifunctional reagent. Alternatively, they can be thiolated with 2- iminothiolane and then cross-lined with a sulfhydryl-reactive crosslinking reagent. Another candidate enzyme component comprises a cysteine residue at either end of the S-peptide sequence, optionally through a short linker sequence, which are then cross-linked to tie the two ends of the S-peptide together. Heterologous protease recognition sequences can optionally be inserted during synthesis between one of the cysteines and the S-peptide core.

Various candidates for cyclized enzyme components based upon S-peptide or S-protein are then screened for low complementarity with the binding partner before cleavage, and high complementarity after cleavage, in an appropriate assay. During screening, the cyclized component containing the cleavable recognition sequence or linkage is typically preincubated with the model analyte. The binding partner is added next, followed by a substrate such as 3'-α-naphthyl phosphate/p-diazoosulfanilic acid, or 5'-0-acetyl uridine-3'-(4-methylumbelliferone-7-yl phosphate). Light absorbance or fluorescence is monitored as appropriate, preferably on a kinetic basis. The rate of the reaction should correlate with the amount of analyte present in the test mixture.

Preparation of cross-linked enzyme components

The assembly of the enzyme components and the more general practice of the invention will employ, unless otherwise indicated, conventional techniques of molecular biology, microbiology, cell biology, biochemistry and immunology, which are within the skill of the art. Such techniques are explained fully in such standard publications as "Molecular Cloning: A Laboratory Manual", second edition (Sambrook et al, 1989); "Oligonucleotide Synthesis" (M.J. Gait, ed, 1984); "Animal Cell Culture" (R.I. Freshney, ed, 1987); "Methods in Enzymology" (Academic Press, Inc.); "Handbook of Experimental Immunology" (D.M. Weir & C.C. Blackwell, eds.); "Gene Transfer Vectors for Mammalian Cells" (J.M. Miller & M.P. Calos, eds, 1987); "Current Protocols in Molecular Biology" (F.M. Ausubel et al, eds, 1987); "PCR: The Polymerase Chain Reaction", (Mullis et al, eds, 1994); "Current Protocols in Immunology" (J.E. Coligan et al, eds, 1991).

General methods for peptide synthesis are described inter alia in Stewart, J.M. and Young, J.D, "Solid Phase Peptide Synthesis", 2nd Ed, Pierce Chemical Company: Rockford, IL, 1984; Atherton, E. and Sheppard, R.C, "Solid Phase Peptide Synthesis: A Practical Approach", IRL Press: New York, 1989; Jones, J, "The Chemical Synthesis of Peptides" (International Series of Monographs on Chemistry, No. 23), Clarendon Press: Oxford, 1991 ; and Barany, G. and Merrifield, R.B, "Solid Phase Peptide Synthesis", Chapter 1 (pp. 1-284) of "The Peptides", Vol. 2, Academic Press: New York, 1979. Additional publications and supplies may be obtained from Calbiochem- Novabiochem, San Diego, CA.

General methods for preparing polynucleotide-peptide and peptide-peptide complexes and a spectrum of labeling strategies are described in Hermanson, G.T, "Bioconjugate Techniques", Academic Press: New York, 1996.

Enzyme components can be isolated from natural sources and disassociated or cleaved into complementing subunits by standard biochemical techniques. Alternatively, polypeptides below ~60 amino acids in length are conveniently prepared by chemical solid-phase synthesis. See, for example, U.S. Patent No. 4,493,795 and the scientific literature cited therein. Polypeptides of any length can be obtained by recombinant expression of the corresponding polynucleotide encoding region in a suitable prokaryotic or eukaryotic expression system.

Chimeric enzyme components can be made employing recombinant DNA methodologies by genetic insertion of the gene encoding the desired recognition site into the gene encoding the enzyme sequence at a suitable endonuclease recognition site. Plasmid vectors containing enzyme encoding DNA sequences are well known in the art. Recombinant polymerase chain reaction cloning can be performed employing oligonucleotide primers containing the coding sequence of interest and suitable restriction enzyme cloning sites to construct mutant enzyme components having an internal protease susceptible sequence. Alternatively, chemical synthesis of the enzyme component polypeptide and a protease recognition site from amino acid starting material by sequential addition of amino acids or protected amino acids to a growing peptide chain can be employed.

The enzyme components of the invention are then cross-linked using the agent of choice and the purified. An inert, or non-cleavable, cross-linking moiety (for example bis-maleimidohexane) is usually employed where the enzyme component contains a protease recognition site. Otherwise, a cross-linking agent cleavable by a nuclease, glycosidase, phosphatase, amidase, esterase, or other enzyme or environmental agent may be used. Such cross-linking agents are described in more detail elsewhere in this disclosure..

The cross-linking typically involves reacting the polypeptide component with a cross-linking agent under reaction conditions suitable to cause the cross-linking agent to covalently attach to two reactive amino acid residues of the polypeptide and isolating the cross-linked peptide from the reaction mixture. Heterobifunctional cross-linking agents are convenient in many instances for linking between two different polypeptide chains or for positioning at least one end of the cross-link within the polypeptide. Thiol-reactive cross-linkers are also suitable for exact positioning by reacting with cysteine residues produced selectively from internal disulfide bonds by mild reduction. Alternatively, thiol groups can be introduced into the polypeptide by reaction with commercially available reagents such as 2-iminothiolane; or amino acids with reactive groups can be introduced into the polypeptide during synthesis. Subsequently, the cross-linked peptide mixture is separated into fractions by techniques such as HPLC or adsorption chromatography, and assayed for the desired activity, thereby removing unreacted, polymerized, and inappropriately cross-linked contaminants.

Assay methods

The assays of the invention are usually conducted in an assay medium comprising the desired reagents in a suitable buffer. The buffer formulation is generally not critical but must allow interaction between the analyte of interest and the intramolecularly cross-linked enzyme components in such a way as to effect activation of the components in the presence of the analyte. In general, any buffer compatible with complementation of the subunits is acceptable including phosphate buffer, MOPS buffer and the like. In one embodiment of the invention, the buffer has a concentration of about 100 mM to about 300 mM sodium phosphate, about 100 mM to about 500 mM sodium chloride, about 1 mM to about 6 mM magnesium chloride, about 5 mM to about 15 mM EGTA (ethylene glycol tetraacetic acid) or EDTA (ethylenediamine tetraacetic acid) and about 5 mM to about 200 mM sodium azide having a pH of about 6 to about 8.

A chelating agent can be added to any polypeptide or protein containing cysteine or methionine residues to protect against metal catalyzed oxidation. Addition of a stabilizing amount of chelating agent for metal ions (such as EDTA or EGTA) is desirable. A bactericide, such as sodium azide, can be present to prevent bacterial growth, especially during storage.

Other materials can be present including but not limited to magnesium ions or other ions for enzyme activity, reagents to prevent degradation of cysteine residues such as dithiothreitol (DTT), solubilizing agents such as ethylene glycol, and nonionic surfactants such as fatty acid condensation products of sorbitol and ethylene oxide, e.g., TWEEN 20 (® ICI Americas, Inc.), and the like. Methionine and bovine serum albumin (BSA) can also be present.

The storage stable assay medium is typically aqueous. The enzyme component is usually present at a concentration from about 2 pM to about 5 mM. Any heterologous component needed for full complementation of activity is usually present in molar excess.

The sample can be obtained from any source of interest, organic or inorganic. The sample will generally be a liquid but can also be an extract of a solid material. The amount of the sample that can be used in conjunction with the present invention depends, among other things, upon the concentration of the analyte, the nature of the sample, and the sensitivity of the assay.

In a typical assay procedure, the sample, and at least one cross-linked enzyme component are combined in a suitable buffer or reaction medium to form a reaction mixture. The cross-linked enzyme component used at this stage contains a recognition site for the analyte of interest. The mixture will usually be incubated for at least 0.2 minutes and usually not more than about 300 minutes, preferably from about 1 minute to about 10 minutes. The temperature and duration of the incubation will be compatible with the ability of the analyte or chemical condition of interest to exert its ability to result in the cleavage of the appropriate cross-linked enzyme component if the analyte is present. Where complementation of enzyme activity requires assembly of a plurality of heterologous components, the additional components can be added after cleavage of the cross- linked component by the analyte has already taken place, in which case an additional short incubation period may be necessary. Where complementation background in the absence of analyte is minimal, it is generally more convenient to provide all enzymatic components (including the cross-linked component) as a single reagent mixture at the outset of the reaction with the analyte.

Finally, once cleavage by the analyte has taken place and assembly of the components has been allowed to take place, complementation activity is measured by conversion of the substrate to product by the active enzyme complex formed. The substrate may be present in the initial reaction mixture, or can be added after the analyte has converted the enzyme component into the active form.

Preferred enzyme substrates are those which, when cleaved by the assembled enzyme, results in a detectable change in the amount of light absorbance (optical density) or emission. That is, cleavage of the substrate results in the appearance or disappearance of a colored, chemiluminescent or fluorescent product suitable for spectrophotometric, chemical or fluorometric analysis. Substrates suitable for use with β-galactosidase include but are not limited to p-aminophenyl-β-D-galactopyranoside, 2'-N-(hexadecanol)-N-(amino-4'-nitrophenyl)-β-D- galactopyranoside, 4-methylumbelliferyl-β-D-galactopyranoside, naphthyl-A-S-B1-β-D- galactopyranoside, 2-naphthyl-A-S-B1-β-D-galactopyranoside monohydrate, o-naphthyl-β-D- galactopyranoside, p-naphthyl-β-D-galactopyranoside, phenyl-β-D-galactopyranoside, 5-bromo-4- chloro-3-indolyl-β-D-galactopyranoside, resorufin-β-D-galactopyranoside, 7-hydroxy-4- trifluoromethylcoumarin, ω-nitrostyryl-β-D-galactopyranoside, fluorescein-β-D-galactopyranoside, chlorophenol red β-galactoside and the like. Preferred substrates are chlorophenol red β-galactoside (CPRG) and o-nitrophenyl-β-D-galactoside (ONPG). Incubation with the enzyme substrate results in the cleavage of the substrate to produce a product that is detectable, preferably by color.

Colorimetric substrates for enzyme components of this invention based on enzymes other than β-galactosidase are chosen based on published model substrates appropriate for the corresponding enzyme prototype, or designed by introduction of suitable chromophores into a homoiog of the natural substrate.

It will be recognized that basic reactions of the type described can be employed as part of a cascade or serial reaction in which the analyte of interest is measured indirectly. Cascading enzyme reactions is one example of this, and described elsewhere in this application. Another example is the measurement of an analyte which is an enzyme inhibitor. The reaction mixture is set up with a second enzyme capable of cleaving the recognition sequence in the polypeptide or cross-linking moiety of the cross-linked enzyme component. The mixture can then be used for detecting or measuring the presence of an inhibitor for the second enzyme, by premixing with the second enzyme. Increasing amounts of inhibitor in the test sample decreases activity of the second enzyme, which decreases the rate of cleavage of the cross-linked enzyme component, inhibiting the formation of active enzyme complex and the conversion of substrate to product.

Unless specified otherwise above, the relative amounts of reagents used in the invention can vary widely to provide for concentrations of the reagents which can substantially optimize the sensitivity of the assay method. The reagents can be provided as dry powders, usually lyophilized, including any excipients, which on dissolution will provide for a reagent solution having the appropriate concentration for performing the assay method of the invention.

Further illustration of the development and use of reagents and assays according to this invention are provided in the Example section below. The examples are provided as a further guide to a practitioner of ordinary skill in the art, and are not meant to be limiting in any way.

EXAMPLES

Example 1: Intramolecular cross-linking of ED28 via native cysteine residues

ED28 is an enzyme donor polypeptide comprising 90 amino acids and containing two cysteine residues at amino acid positions 23 and 68. Positions 23 through 73 comprise the N-terminus of native β-galactosidase (using the convention of numbering the N-terminal Met residue "1"). The sequence of ED28 is also disclosed in U.S. Patent No. 4,708,929, which describes how to make it. It was intramolecularly linked by forming a disulfide bond between the two cysteine residues at amino acid positions 23 and 68.

ED28, 2.5 mg, was dissolved in 50 mM sodium phosphate buffer, pH 8.5, containing 30% acetonitrile (0.5 ml). The solution was applied to a prepacked SEPHADEX™ G25 high molecular weight purification column (NAP5, ® Pharmacia, Inc.) which had been previously equilibrated with 5 column volumes of 30 mM sodium phosphate, pH 8.5, containing 39% acetonitrile. The ED28 was eluted with 1 ml of the same buffer. This procedure ensured removal of any low molecular weight reducing agents, such as dithiothreitol, which would prevent disulfide bond formation. The resultant solution was incubated with stirring for 12 hours, after which time the ED28 was about 95% converted to a disulfide-bonded molecule. The cross-linked ED was purified by reverse-phase HPLC on a C4 RPLC column (Vydac

Protein C4, 25 cm x 10 mm). The column was developed at a flow rate of 4 ml/minute. A 23 to 33% gradient was established over a 45 minute time period using concentrations beginning with weak eluent of 0.1% trifluoroacetic acid (TFA) in H₂0 and ending with strong eluent of 0.1% TFA in acetonitrile. A sample of the purified, intramolecularly cross-linked material was treated with a 10 mM solution of the reducing agent DTT and reinjected onto the HPLC. As expected, the elution profile corresponded to the linearized material.

To confirm inhibition of the complementation activity of the cysteine-linked ED28 polypeptide, a CEDIA assay (® Microgenics Corp, Concord, CA) was performed using this material in the presence and in the absence of DTT. Solutions of cross-linked and linear ED28 (20 pmol) were prepared and incubated with enzyme acceptor EA22 (20 U/test), which comprises the complementing β-galactosidase fragment with a deletion of the amino acids from positions 13 to 40, and CPRG (2 mg/ml) in a buffered solution (dipotassium hydrogen phosphate, 210 mM; potassium dihydrogen phosphate, 150 mM; sodium chloride, 400 mM; EGTA, 10 mM; magnesium acetate, 2 mM; methionine, 10 mM; TWEEN 20, 0.05 %; PLURONIC™ 101 (® BASF Corporation), 0.001%; Dextran T40, 4%; bovine serum albumin, 0.1%; sodium azide, 10 mM; pH 6.95) at 37°C for 4 minutes. The rate in absorbance at 574 nm was measured per minute between 4 and 6 minutes. The results are shown in Table I below.

TABLE I

Enzyme Donor Reducing Agent mAU/min @ 574 nm

Cross-linked ED28 None 42

Cross-linked ED28 DTT 344.5

Linear ED28 None 346

Linear ED28 DTT 345.2

These results demonstrate that the complementation activity of the cysteine-linked ED28 polypeptide was 12% of the ED28 which had been linearized by chemical reduction with DTT. The presence or absence of DTT had no effect on fresh, reconstituted linear ED28.

Example 2: Intramolecular cross-linking of ED28 with a homobifunctional, acid-labile cross- linking moiety

The acid-labile, homobifunctional cross-linking agent 2,2 bis-maleimidoethoxypropane (BMEP), which can be made following the method of Srinivasvachar, Biochemistry 28:2501 (1989), was used to cross-link ED28. This cross-linking agent contains two maleimide groups, which react rapidly and specifically with sulfhydryl groups to form stable covalent bonds. The linkage between the two maleimide groups contains a ketal moiety that renders the cross-linker acid-labile. This cross-linking agent was used to form an intramolecular cross-link between the two cysteine residues of ED28.

ED28, 1.0 mg, was dissolved in 50 mM sodium phosphate buffer, pH 7.0, containing 39% acetonitrile (0.5 mi) to remove any low molecular weight reducing agents such as DTT which would prevent cross-linking. The solution was applied to a prepacked SEPHADEX™ G25 column previously equilibrated with 5 column volumes of 30 mM sodium phosphate, pH 7.5, containing 30% acetonitrile. The ED28 was eluted with 1 ml of the same buffer. To the eluent was added 11 x 0.1 equivalent aliquots of BMEP in acetonitrile (5 μl total volume) over a 30 minute time period. The reaction mixture was then incubated for 1 hour at room temperature, after which time the starting material was completely converted to cross-linked product. The BMEP cross-linked ED28 was purified by reverse-phase HPLC on a C4 RPLC column.

The column was developed at a flow rate of 4 ml/minute. Using a strong eluent isochratic profile of 24.5%, the purified material was eluted using concentrations of weak eluent of 100 mM triethylammonium acetate (TEAA) in H₂0 and strong eluent of acetonitrile. The purified material was lyophilized and stored at -80°C. A sample of the purified material was reconstituted in water and the pH adjusted to 2.0 with 0.1 M HCl and incubated for 3 minutes at room temperature. The pH was then adjusted to 6.8 employing a buffered solution (see Example 1) and the complementation activity with enzyme acceptor protein determined as described in Example 1. The results are shown in Table II below.

TABLE

Enzyme Donor Treatment mAU/min @ 574 nm

Cross-linked ED28 None 22.5

Cross-linked ED28 pH 2.0 for 3 min 925

Linear ED28 None 930

Linear ED28 pH 2.0 for 3 min 927

These results demonstrate that the untreated BMEP-linked ED28 has 2.5% of the complementation activity of the acid treated BMEP-linked ED28. Thus, the cross-linked ED28 can be linearized by mild acid hydrolysis of the chemical cross-linking moiety. A control experiment employing linear ED28 demonstrates that the 3 minute acidic pretreatment had no effect on the complementation of linear ED28.

Example 3: Intramolecular cross-linking of ED28 via a homobifunctional cross-linker and protease cleavage ofthe cross-linked ED28 with endoprotease Glu-C

This example describes the construction and use of an enzyme donor polypeptide that is cross-linked using a moiety that is not cleavable under assay conditions. In this example, the recognition sequence for a protease analyte of interest is not incorporated into the cross-linker but rather into the amino acid sequence of the enzyme donor or attached to its N- or C-terminus. This can be accomplished by recombinant DNA techniques or by solid phase peptide synthesis techniques, both of which are well known to those of skill in the art. The action of the protease cleaves the cross-linked enzyme donor at the protease recognition site, thereby linearizing the intramolecularly cross-linked peptide and enabling its complementation with enzyme acceptor. Demonstrating this concept, ED28 was cross-linked with the homobifunctional cross-linking agent bis-maleimidohexane. Use of this reagent results in the irreversible cross-linking of sulfhydryl moieties under mild conditions. See Partis, J. Prof. Chem. 2:263-77 (1983). ED28, 1.0 mg, was dissolved in 50 mM sodium phosphate buffer, pH 7.0, containing 30% acetonitrile (0.5 ml). The solution was applied to a prepacked SEPHADEX™ G25 previously equilibrated with 5 column volumes of 30 mM sodium phosphate, pH 7.0, containing 30% acetonitrile. The ED28 was eluted with 1 ml of the same buffer. To the eluent was added 11 x 0.1 equivalent aliquots of BMH in acetonitrile (5 μl total volume) over a 30 minute time period. The reaction mixture was then incubated for 2 hours at room temperature, after which time the starting material was completely converted to cross-linked product.

The BMH cross-linked ED28 was purified by reverse-phase HPLC on a C4 RPLC column. The column was developed at a flow rate of 4 ml/minute. Using a strong eluent isochratic profile of 28.5%, the purified material was eluted using concentrations of weak eluent of 0.1% trifluoroacetic acid (TFA) in H₂0 and strong eluent of 0.1% TFA in acetonitrile. The purified material was lyophilized and reconstituted in 25 mM ammonium carbonate buffer, pH 7.8. The buffered sample was then incubated with 10 μg endoproteinase Glu-C protease (from S. aureus V8, Boehringer Mannheim) for 1 hour at room temperature. Enzyme acceptor protein (50 μl, 500 U/ml) and CPRG solution (50 μl, 3 mg/ml) were added, the plate was incubated at 37°C and the absorbance at 570 nm was measured. The results are shown in Table III below.

TABLE III

Sample mAU/min @ 570 nm Without protease treatment 25

With protease treatment 713

This Glu-C protease specifically cleaves peptides at the C-terminal side of glutamic acid residues. Hence, the specificity of this protease for glutamic acid residues 62 and 63 of ED28 was exploited to linearize the BMH cross-linked ED28 at those positions rather than via the BMH moiety. Upon treatment of the cross-linked enzyme donor polypeptide with Glu-C protease, activity was increased dramatically, about 24-fold, indicating that cleavage had occurred.

Example 4: Preparation of homobifunctional bis-maleimidoacetal cross-linking agent

Synthesis of N-(2-trimethylsiloxyethyl)-maleimide

As shown in Figure 1, to a solution of ethanolamine (1.8 g, 29.5 mmol) in saturated sodium bicarbonate solution (100 ml) was added N-methoxycarbonylmaleimide (95 g, 32.3 mmol) in portions with vigorous stirring at 0°C. The mixture was allowed to warm to room temperature and stirred for

1 hour. The pH of the mixture was adjusted to 6-7 by careful addition of concentrated sulfuric acid

(5 ml). The resultant solution was freeze dried and the solid residue extracted with ethyl acetate (2 x 400 ml) by stirring for 30 min. with each extraction. The ethyl acetate extracts were collected by filtration and evaporated in vacuo to afford N-(2-hydroxyethyl)maieimide (formula I) as a white solid (4.0 g, 96% yield); thin layer chromatography (TLC), Rf = 0.27, ethyl acetate/petroleum ether 1:1.

To a solution of N-(2-hydroxyethyl)maleimide (0.2 g, 1.41 mmol) in dry dichloromethane (10 ml) and triethylamine (0.22 ml, 1.57 mmol) at 0°C was added chlorotrimethylsilane (TMS-CI, 0.2 ml, 1.57 mmol). After stirring for 1 hour at room temperature, TLC analysis (ethyl acetate/petroleum ether 1 :1) indicated one spot (Rf = 0.67). Solvent was removed in vacuo and the residue was dissolved in dichloromethane and filtered through a small silica gel column eluting with dichloromethane. The fractions containing product were pooled and evaporated in vacuo to afford N-(2-trimethylsiloxyethyl)-maleimide (formula II) as colorless flakes (0.3 g; 100% yield).

Synthesis of 4-maleimidobutyraldehyde

As shown in Figure 2, to a solution of 4-aminobutyraldehyde diethylacetal (5 g, 31 mmol) in 100 ml of saturated bicarbonate was added N-methoxycarbonylmaleimide (4.91 g, 31.6 mmol) at 0°C (icebath). After 15 minutes, tetrahydrofuran (100 ml) was added at room temperature and the resultant mixture stirred for 1 hour. The resultant mixture was then acidified with 1 N hydrochloric acid to pH 6-7 and extracted with ethyl acetate (3 x 200 ml). The combined organic extracts were dried (MgS0₄) and evaporated in vacuo. The crude product was purified by chromatography on silica gel 60 eluting with ethyl acetate/petroleum ether 1 :2 to yield 4-maleimidobutyraldehyde diethylacetal as a yellow oil (4.31 g; 58%), TLC Rf = 0.65, ethyl acetate/hexane 1:1. 4-Maleimidobutyraldehyde diethylacetal (2 g, 8.29 mmol) in tetrahydrofuran (20 ml) and water (0.5 ml) was stirred under argon and DOWEX™ 50X8 ion exchange resin (H⁺, 2 g, ®Dow Chemical Co.) was added. After 12 hours stirring at room temperature, the solvent was decanted, dried (MgS0₄) and evaporated in vacuo to afford 4-maleimidobutyraldehyde (formula III) as a yellow oil which rapidly solidified on standing (1.38 g, 99%); TLC Rf = 0.4, ethyl acetate/hexane 1:1. The 4-maieimidobutyraldehyde turned out to be extremely unstable, so that it was necessary to do all work-up at low temperatures (0°C) and under complete exclusion of oxygen (inert atmosphere).

Synthesis of 1, 7-bismaleimido-4-0-(tetraacetyl-β-D-galactopyranosyl)-5-oxaheptane

As shown in Figure 3, to a stirred solution of 4-maleimidobutyraldehyde (1.82 g, 11 mmol), N-(2-trimethylsiloxyethyl)-maleimide (0.79 g, 3.5 mmol), 1-trimethylsilyloxy-2,3,4,6-tetra-0-acetyl-β- D-galactopyranose (1.52 g, 3.5 mmol) and molecular sieve [4 A] in 40 ml dry dichloromethane was added TMSOTf (trimethylsilyl triflate, 0.67 ml, 3.5 mmol) at -78°C under rigorous dry conditions and inert atmosphere (argon). The reaction mixture was quenched by addition of 1.5 ml triethylamine/methanol (1:1) after two days. The solvent was removed in vacuo after CELITE (® Celite Corp.) filtration (5 g). The crude product was chromatographed (ethylacetate/light petroleum, 1 :1) to give 1 ,7-bismaleimido-4-0-(tetraacetyl-β-D-gaiactopyranosyl)-5-oxaheptane (formula IV) (1.78 g, 2.7 mmol) in 77% yield. Deprotection of 1, 7-bismaleimido-4-0-(tetraacetyl-β-D-galactopyranosyl)-5-oxaheptane

To a stirred solution of 1 ,7-bismaleimido-4-0-(tetraacetyl-β-D-galactopyranosyl)-5- oxaheptane (200 mg, 0.3 mmol) in 20 ml dry methanol was added Zn(OAc)₂ (60 mg, 0.3 mmol). The solution was refluxed for 9 hours under rigorous dry conditions. Tert-butylmethylether (20 ml) was added at room temperature. CELITE filtration (5 g) with 200 ml tert-butylmethylether/methanol (1 :1), evaporation of solvent in vacuo, followed by chromatography (ethylacetate/methanol/triethylamine, 4:1:1) gave a mixture of 1 ,7-bismaleimido-4-0-(β-D-galactopyranosyl)-5-oxaheptane (formula IV) and 1 ,7-bis-(3'-methoxysuccinimido)-4-0-(β-D-galactopyranosyl)-5-oxaheptane (formula V) in a ratio of 1 :2 (145 mg, 0.29 mmol) in 99% yield. Zn(OAc)₂ was dried at 80°C (p=0.001 Torr) for 24 hours. The 1 ,7-bismaleimido-4-0-(tetraacetyi-β-D-galactopyranosyl)-5-oxaheptane was used to prepare cyclic fusion peptides comprised of β-galactosidase enzyme donor and HIV gag sequences, constructed as set forth in Example 5 below.

Example 5: Preparation of double Cys- HIV peptide-containing enzyme donors

Double cysteine-containing enzyme donor polypeptides which also contained an HIV protease recognition site were prepared by recombinant DNA techniques and by solid phase peptide synthesis.

E. Coli strain AMA1004 (Casadaban, Methods in Enzymology 100:293, 1983) was used for expression of EA, ED, and complemented β-galactosidase. E. coli strain MC1061 (Meissner, Proc Nat Acad Sci 84:4171 , 1987) was used for isolation of recombinant clones. Oligonucleotide primers were designed to amplify the β-galactosidase alpha region known as ED7 from the plasmid pl87 with the addition of either the 8 residue (p17/p24) or 10 residue (p6/PR) HIV protease recognition sites carrying a Hindlll restriction site for clone selection. The N-terminal primer for amplification of the ED7-HIV pl7/p24 gene (5'- GATACGAATTCTCAGAACTATCCGATCGTTCAGTCACTGGCCGTCGTTTTACAA-3') (SEQ ID NO:6) contained the 8 residue HIV protease recognition site.

The N-terminal primer for amplification of the ED7-HIV p6/PR gene (5'GATACG TTCTGT GCTTTMCTTTCCGCAGATCACCCTGCTGGCCGTCGTTTTACAA-3') (SEQ ID NO:7) contained the 10 residue HIV protease recognition site. Both amplifications used the C-terminal primer KM1 (5'-CTGGCTTAACTATGCGGCATC-3') (SEQ ID NO:8). PCR amplifications were run in an MJ Research minicycler PTC-150 beginning with denaturation at 94°C for 1 minute followed by 40 cycles of 92°C for 40 seconds, 65°C for 40 seconds, and 75°C for 1.5 minutes and a final elongation step of 75°C for 5 minutes. Reactions were 100 μl volumes and run as hot starts using PCR Gems (Perkin/Elmer).

Amplified DNA was cleaned by phenol-chloroform extractions and precipitated in ethanol. Resuspended material was trimmed by EcoRI and Sail digestion and purified by agarose gel electrophoresis. Gel purified insert DNA was ligated into pl87 EcoR1/Sal vector. The resulting clone carried the ED7 gene with either the HIV pl7/p24 or p6/PR cleavage site as an internal gene fusion cassette inserted at an EcoRI site located near the 3' end of the ED7 gene. The correct clone was identified by the presence of the Hindlll site located in the PCR product and verified by DNA sequencing. For expression and purification, the ED7-HIV genes were transferred by BamH1/Sal1 digestion into a BamH1/Sal1 vector (p43) carrying the large fragment of β-galactosidase, EA46, which complements in vivo with the ED7-HIV gene products.

ED7-HIV pl7/24, ED7-HIV p6/PR and EA46 proteins were induced at 40°C from the lambda PL promotor through inactivation of the plasmid CI857 repressor. The cells were harvested after 4 hours of induction, and the complemented β-galactosidase was purified by a 40% ammonium sulfate precipitation followed by ion exchange chromatography on Q-SEPHAROSE™. The complemented enzyme was denatured in 10 M urea, and the recombinant ED-HI V proteins were separated from denatured EA46 by size exclusion chromatography in 6 M urea. Fractions containing the ED-HIV proteins were concentrated with an Amicon stir cell and dialyzed into a neutral TRIS buffer. Any residual contaminating proteins were removed through ion exchange chromatography on Q-SEPHAROSE.

The target peptides were also synthesized on an Applied Biosystems (ABI) Model 431A solid phase peptide synthesizer, using Fmoc protected amino acids activated with 2-1 H- benzotriazol-1-yl)-1 ,1 ,3,3-tetramethyluronium hexafluorophosphate (HBTU; ABI user bulletin #33). The synthesis was carried out at 0.25 mmol scale, and a preloaded HMP resin was used as the solid phase. The deprotection and coupling times were extended from the standard times recommended by the manufacturer. The following amino acids were used: Fmoc-Ala, Fmoc-Arg (Pmc), Fmoc-Asn (Trt), Fmoc-Asp (OtBu), Fmoc-Cys (Trt), Fmoc-GIn (Trt), Fmoc-Glu (OtBu), Fmoc-Gly, Fmoc-His (Trt), Fmoc-Leu, Fmoc-Lys (Boc), F moc-Phe, Fmoc-Pro, and Fmoc-Ser (tBu). The N-terminus was not acetylated and the C-terminus was left as the carboxy form. Cleavage of the crude peptide-resin was accomplished by incubation for 3 hours in a solution of TFA containing the carbonium scavengers, water (4%), thioanisole (4%), phenol (1.5%), and 1 ,2-ethane dithiol (2%). The mixture was filtered, evaporated to an oil and precipitated with cold diethyl ether. Purification of the crude peptide was done by reverse-phase HPLC, using a Vydac 2.2 x 300 mm C18 column and a 16-41% acetonitrile/water gradient, with 0.1% TFA as the counter- ion. The purified peptide was designated SED35 and contained the VSFNFPQITL (SEQ ID NO:2) protease cleavage site.

Example 6: Cross-linking ED7-HIV fusion peptide with 1,7-bismaleimido-4-0-(tetraacetyl-β-D- galactopyranosyl)-5-oxaheptane

The ED7-HIV fusion peptide from Example 5 was then cross-linked by the covalent linkage of 1 ,7-bismaleimido-4-0-(tetraacetyl-β-D-galactopyranosyl)-5-oxaheptane between residues 10 and 53 of the fusion peptide. The ED7-HIV fusion peptide ED7-HIV pl7/p24 was reconstituted in 50 mM sodium phosphate buffer, pH 7.0(1 ml), and the solution was applied to a prepacked SEPHADEX™ G25 column. The fusion peptide was eluted with the same buffer (1.5 ml). To the eluent containing 362 μg/ml of the fusion peptide (97% recovery) was added 11 x 0.1 equivalent aliquots of 1 ,7- basmaleimido-4-0-(tetraacetyl-β-D-galactopyranosyl)-5-oxaheptane in acetonitrile (5 μl total volume; 38 μg total) over a 30 minute time period. The reaction mixture was then incubated for 30 minutes at room temperature.

The cross-linked ED-HIV fusion peptide was purified by HPLC employing a Vydac Protein C4 (25 cm x 10 mm) semi-preparative HPLC column using 100 mM TEAA, pH 6.5 as solvent A and acetonitrile as solvent B. The column was developed at a flow rate of 4 ml/minute. A 22 to 40% gradient of solvent B was established over a 15 minute time period. Linear ED-HIV fusion peptide exhibited a retention time of 13 minutes. Cross-linked ED-HIV fusion peptide exhibited a retention time of 14.2 minutes. Fractions containing the product were pooled and lyophilized. The yield of cross-linked ED-HIV fusion peptide was 155 micrograms. To test for complementation activity, samples of the linear ED-HIV fusion peptide and the cross-linked ED-HIV fusion peptide were reconstituted in assay buffer and serially diluted across a microliter plate. Enzyme acceptor (2050 U/ml) and CPRG (1 mg/ml), 50 μl each, were added to each well and the change in absorbance at 570 nm monitored every 30 seconds in a V max plate reader. The results are shown in Table IV below:

TABLE IV

Enzyme Donor Concentration mAU/min @ 570 nm

Linear ED-HIV fusion peptide 1.84 pmols 57.25

Cyclic ED-HIV fusion peptide 1.84 pmols 1.29

Linear ED-HIV fusion peptide 3.68 pmols 85.18

Cyclic ED-HIV fusion peptide 3.68 pmols 2.17

These results demonstrate that the complementation activity of the cross-linked enzyme donor was 2.5% that of the linear enzyme donor. A second HPLC purification was carried out using the once-purified material and the repurified cyclic ED-HIV fusion peptide tested again in this assay. In this test, the cyclic ED-HIV fusion peptide exhibited only 0.04% of the complementation activity exhibited by the linear ED-HIV fusion peptide, indicating that the higher activity seen after only one HPLC purification is likely due to the presence of linear ED-HIV contaminant.

Example 7: Cross-linking SED35-HIV fusion peptide with 1, 7-bismaleimido-4-0-(tetraacetyl-β-D- galactopyranosyl)-5-oxaheptane

SED35 is a 60 residue fusion peptide produced by solid phase peptide synthesis that contains a 14 residue N-terminai sequence composed of the decapeptide VSFNFPQITL (SEQ ID NO:2) corresponding to the p6/PR HIV-1 protease cleavage site and amino terminal residues GGGC in the HIV gag/pol polypeptide and a 46 residue C-terminal sequence composed of residues 28 through 73 of ED28.

SED35, (0.5 mg, 75 nmols) in 100 mM phosphate buffer, pH 6.5, containing 5 mM EDTA and 30% acetonitrile was combined with 5 μl aliquots of 6 x 0.2 mol equivalents of 1 ,7-bismaleimido- 4-0-(tetraacetyl-β-D-galactopyranosyl)-5-oxaheptane in acetonitrile (57 μg total) over a 30 minute period of time. The reaction mixture was then allowed to incubate 30 minutes at room temperature.

The cross-linked ED-HIV fusion peptide was purified by HPLC employing a Vydac Protein C4 (25 cm x 10 mm) semi-preparative HPLC column using 100 mM TEAA, pH 6.5 as solvent A and acetonitrile as solvent B. The column was developed at a flow rate of 4 ml/minute. A 35 to 40% gradient of solvent B was established over a 20 minute time period. Fractions containing the cross- linked ED-HIV fusion peptide were pooled.

Example 8: ELISA assay format for determining HIV-1 protease inhibitor

An ELISA plate format was used to determine IC₅₀ values (concentration of inhibitor that causes a 50%) reduction in enzyme activity) of various inhibitors using a kinetic microliter plate reader.

A stock solution of the cross-linked chimeric peptide SED35-HIV p6/PR containing HIV-1 substrate sequence VSFNFPQITL (SEQ ID NO:2) corresponding to the p6/PR cleavage site of the HIV gag/pol polypeptide was prepared at a concentration of 1 μg/ml in protease assay buffer (100 mM NaOAc, 1 M NaCl, 0.1% BSA, 1 mM EDTA, pH 5.0). Recombinant HIV protease was prepared at a concentration of 10 μg/ml, also in protease assay buffer. HIV protease inhibitors were dissolved in dimethyl sulfoxide (DMSO) and diluted to working concentrations in protease assay buffer containing 10% DMSO. β-Galactosidase enzyme acceptor protein EA22 was prepared in β-galactosidase assay buffer to give a final concentration of 500 U/ml. CPRG was dissolved in β-galactosidase assay buffer at a concentration of 3 mg/ml.

HIV protease inhibitors 94-001, 94-002, 94-003, 94-004 and 94-005 were dissolved in DMSO to give stock concentrations of 394 nM, 78.8 nM and 15.76 nM. See Ghosh et. al, J. Med. Chem. 37:1177-88 (1994) and Ghosh et. al, J. Med. Chem. 37:2506-8 (1994). Recombinant HIV-1 protease (homodimer, Mr = 22,000) stock solution (10 μl, 4.54 pmols), protease inhibitor stock solutions (10 μl), cyclic ED-HIV stock solution (25 μl, 3.57 pmols), EA22 solution (50 μl, 25 U) and CPRG solution (50 μl) were pipetted into the wells of a polystyrene microtiter plate. The plate was incubated for 5 min. at 37°C and then the absorbance at 570 nm monitored for 20 min. The IC₅₀ value for each of the inhibitors was determined from graphs of Vmax vs time. (The IC₅₀ is proportional to the Ki value for the inhibitor). The relative IC₅₀ values found for each of the inhibitors is given in Table V. TABLE V

Inhibitor Relative /C_∞ (nM)

94-001 5

94-002 4

94-003 2.5

94-004 3

94-005 7.5

Example 9: COBAS MIRA assay format for determining HIV-1 protease inhibitor

A three reagent assay system was used to determine IC₅₀ concentrations of various inhibitors. A COBAS MIRA analyzer (® Roche Diagnostic Systems, Inc., Nutley, NJ) was used.

Sample (inhibitor 94-001, 94-002, 94-003 or 94-004) was diluted with an HIV protease buffer (10 mM sodium acetate, 1 M NaCl, 1 mM EDTA, 0.1% BSA, pH 5.0) modified with 10% DMSO to give final reagent inhibitor concentrations of 45.3 mM to 4.53 nM by dilution factors of ten.

Reagent 1 (R1) contained HIV protease diluted to a reagent concentration of 45 nM in HIV protease buffer.

Reagent 2 (R2) contained cross-linked enzyme donor SED35 at 0.30 mM and CPRG at 43 mg/ml in HIV protease buffer.

Reagent 3 (R3) contained EA22 diluted to a reagent concentration of 1315 U/ml.

The COBAS MIRA apparatus was programmed to deliver 10 μl of sample and 100 ml of R1 at time point one (T=0 minutes), 10 ml of R2 at time point two (T=2 minutes), and 95 ml of R3 at time point three (T=7 minutes). Rate values (absorbance changes within various time periods) were taken at time point four (T=9 to 11 minutes). These values were used to construct rate versus the log of inhibitor concentration graphs to determine IC₅₀ values. All assays were performed at 37°C. The data given in Table VI for inhibitor 94-001 is exemplary.

TABLE VI

Inhibitor Concentration (M) Rate (mAU/min)

2.1 x 10^"7 849

2.1 x 10-⁵ 247

2.1 x 10^"3 90

Using this data, a rate versus log inhibitor concentration graph was constructed and a curve fitting program was applied to generate a logarithmic line equation, in this case f(x) =

-169*1 n(x)+602, or f(y) = -9.19^*1n(y)+60.9. The midpoint of the rate data (50% response) was then determined and this value inserted into the f(y) equation to generate the IC₅₀ concentration. Here, the midpoint value was 470 mAU/min and the IC₅₀ value was 4.35 nM. The results for the assay are given in Table VII.

TABLE VII

Inhibitor it- ICso (nM) reference 9.00

1 4.35

2 5.11

3 4.30

4 4.41

Example 10: Cross-linked enzyme components with alternative protease recognition sequences

Alternative enzyme components were prepared in which the HIV protease recognition sequence was substituted with the recognition sequence for another protease. The recognition sequence is conveniently added to the N-terminal side of the core enzyme polypeptide sequence, since this is near the last few cycles of peptide synthesis. The sequences are then capped through a polyglycine linker to a second cysteine that permits cross-linking via a thio-reactive cross-linking agent.

Figure 4 provides sequence listings and related data for three such enzyme components that have been prepared. The first enzyme component (SEQ. ID NO:9) contains the ICE protease recognition sequence YVAD (SEQ. ID NO:10) linked onto the β-galactosidase enzyme donor core. The second enzyme component (SEQ. ID NO:12) contains the Caspase recognition sequence DEVD (SEQ. ID NO:13) linked onto the enzyme donor core. The third enzyme component (SEQ. ID NO:15) contains the IgA protease recognition sequence TPPTPSPS (SEQ. ID NO: 16), linked onto the enzyme donor core.

In trial reactions, the enzyme component with recognition site for ICE protease was crosslinked using bis-N-maleimido-1 ,6-hexane (BMH) or N,N'-bis(3-maleimidopropionyl)-2-hydroxy- 1,3-propanediamine (BMP); homobifunctional cross-linking agents with specificity for sulfhydryl groups. The reaction mixtures were fractionated by HPLC using a gradient of acetonitrile to remove unreacted component and components that were dimerized via inter-chain linkage. Fractions were reconstituted in 250 μL 0.1% TFA in H₂0. The fractions were then tested in enzyme complementation assays, in which the ICE protease, the complementing enzyme component (β-galactosidase enzyme "acceptor"), and the chromogenic β-galactosidase substrate CPRG were supplied.

In one experiment, the assay system was tested for the effect of the buffer on the reaction. CEDIA® type enzyme immunoassays are typically performed in a standard buffer containing potassium phosphate (pH 6.9), NaCl, EGTA, magnesium acetate, sodium azide, and the detergent TWEEN™ 20. ICE protease reactions have been described as optimally performed in a buffer of 100 mM HEPES (pH 7.5), 10% sucrose, 0.1% CHAPS™ detergent, and 10 mM dithiothreitol (DTT). Results for fractions "W11" and "W13" are shown below.

TABLE VIII

Buffer Fraction Absorbance 570-650 nm reference -0.1

ICE W11 296

CEDIA W11 85.1

ICE W13 4.0

CEDIA W13 25.2

With the W11 fraction, the ICE buffer was found to support somewhat better β-galactosidase activity than the standard CEDIA buffer.

In another experiment, various cross-linked enzyme components were compared. 10 μL of a crude ICE protease preparation was combined with 20 μL ICE buffer and 5 μL enzyme component, and incubated for 10 min at 37°C. After the first incubation, 55 μL CEDIA buffer, 50 μL of the enzyme acceptor EA22, and 50 μL of CPRG (2 mg/mL) were added, and the reaction mixture was incubated a further 20 min at room temperature. Absorbance was measured at 570-650 nm. Results are shown in Table IX:

TABLE IX

ICE protease Fraction W11 BMH BMD dilution (uncrosslinked) Fraction 4 Fraction 6

0 85.1 80.4 232

Neat 62.6 348 473

1:10 67.4 225 336

1:100 18.2 105 237

1:1000 42.7 65.6 229

No enzyme donor 0.0 0 0

The results show that amongst the fractions tested, BMH Fraction 4 had the best signahnoise ratio (i.e., difference in activity in the absence and presence of ICE protease).

In another experiment, the incubation of ICE protease with the enzyme donor was extended to 30 min before the acceptor and substrate were added, and several of the BMH fractions were compared with each other. A kinetic read was performed at 570-650 nm. Results are shown in Figure 5. The upper panel is a chart of absorption data for BMH fractions 4, 5, 6, and 7, compared with fraction W11. Good signal:noise ratios were observed_, for both fractions 4 and 5. The lower panel shows the time-course of the β-galactosidase product observed for BMH cross-linked enzyme donor fraction 5 preincubated in the absence (open symbols) or presence (closed symbols) of ICE protease. The reaction reaches a constant velocity within a few minutes and is dependent on the presence of ICE protease in the original assay mixture.

The invention now being fully described, it will be apparent to one of ordinary skill in the art that many changes and modifications can be made thereto without departing from the spirit or scope of the appended claims.

Claims

1. A cross-linked enzyme component, having an inserted enzyme recognition site in a polypeptide of the component and at least one covalent intrachain cross-link between amino acid side chains of the polypeptide, wherein the cross-linked enzyme component forms an enzymaticaliy active complex with a second enzyme component upon cleavage of the enzyme recognition site, but is inhibited from forming such an active complex prior to cleavage, and wherein the enzymaticaliy active complex has enzyme activity different from that of ╬▓-galactosidase.

2. The cross-linked enzyme component of claim 1, wherein the enzyme recognition site is cleavable by a protease selected from the group consisting of HIV protease, N. gonorrhea protease, Glu-C protease, ICE protease, Caspase, and IgA protease.

3. The cross-linked enzyme component of claim 1 or claim 2, wherein the intrachain cross-link is a disulfide bond between cysteine residues or thiolated amino groups.

4. A cross-linked enzyme component, having a polypeptide with a cross-linking moiety covalently bonded between amino acids of the polypeptide, wherein the cross-linking moiety comprises a cleavable site, and wherein the cross-linked enzyme component forms an enzymaticaliy active complex with a second enzyme component upon cleavage of the cleavable site, but is inhibited from forming such an active complex prior to cleavage, and wherein the enzymaticaliy active complex has enzyme activity different from that of ╬▓- galactosidase.

5. The cross-linked enzyme component of claim 4, wherein the intrachain cross-link is formed by contacting the polypeptide with a homo- or heterobifunctional cross-linking agent.

6. The cross-linked enzyme component of either of claims 4-5, wherein the cross-linking moiety comprises a polynucleotide sequence with a recognition site for a nuclease.

7. The cross-linked enzyme component of either of claims 4-5, wherein the cleavable site is cleavable by an endoglycosidase.

8. The cross-linked enzyme component of either of claims 4-5, formed by contacting the polypeptide with a cross-linking agent of the formula W-(CH₂)ΓÇ₧-X-CH(OY)-(CH₂)_n-Z wherein:

W and Z are a nucleophilic leaving group; n is a number from 1 to 10; X is oxygen, sulfur or nitrogen; and

Y is an enzymaticaliy cleavable moiety selected from the group consisting of glycosides, acetylated glycosides, phosphate, butyrate and acetate.

9. A method for determining an analyte in a sample, comprising the steps of: a) preparing a reaction mixture containing the analyte, a cross-linked enzyme component according to any of claims 1-3, and a substrate for the active enzyme complex; wherein the enzyme recognition sequence is cleavable by the analyte; and b) detecting or measuring any product formed from the substrate by active enzyme present in the mixture.

10. The method of claim 9, wherein the analyte is a viral protease.

11. A method for determining an analyte in a sample, comprising the steps of: a) preparing a reaction mixture containing the analyte, a cross-linked enzyme component according to any of claims 4-8, and a substrate for the active enzyme complex; wherein the cleavable site is cleavable by the analyte; and b) detecting or measuring any product formed from the substrate by active enzyme present in the mixture.

12. The method of claim 11 , wherein the analyte is selected from the group consisting of proteases, nucieases, phosphatases, glycosidase, amidase and esterase.

13. A method for determining an analyte in a sample, wherein the analyte is a target polynucleotide with a particular sequence, comprising the steps of: a) preparing a reaction mixture containing the analyte, a cross-linked enzyme component according to any of claims 4-6 having a polynucleotide sequence complementary to the sequence of the target polynucleotide, and a substrate for the active enzyme complex; wherein the cleavable site is cleavable by the analyte; and b) detecting or measuring any product formed from the substrate by active enzyme present in the mixture.

14. A method for determining an analyte in a sample, wherein the analyte is an enzyme inhibitor, comprising the steps of: a) preparing a reaction mixture containing the analyte, a cross-linked enzyme component according to any of claims 1-8, a second enzyme that cleaves the enzyme recognition site in a manner inhibitible by the analyte, and a substrate for the active enzyme complex formed by cleavage of the cross-linked enzyme; and b) detecting or measuring any product formed from the substrate by active enzyme present in the mixture.