WO2002028999A2

WO2002028999A2 - Gene expression profiles in granulocytic cells

Info

Publication number: WO2002028999A2
Application number: PCT/US2001/030821
Authority: WO
Inventors: Yasmin Beazer-Barclay; Sherman M. Weissman; Shigeru Yamaga; Joseph Vockley
Original assignee: Gene Logic, Inc.
Priority date: 2000-10-03
Filing date: 2001-10-03
Publication date: 2002-04-11
Also published as: WO2002028999A3; AU2126502A

Abstract

The present invention identifies the global changes in gene expression associated with activation of granulocytes. The present invention also identifies expression profiles which serve as useful diagnostic markers as well as markers that can be used to monitor disease states, disease progression, drug toxicity, drug efficacy and drug metabolism.

Description

GENE EXPRESSION PROFILES IN GRANULOCYTIC CELLS

RELATED APPLICATION

This application is related to U.S. Provisional Application 60/237,189, filed on October 3, 2000, which is herein incorporated by reference in its entirety.

BACKGROUND OF THE INVENTION

Granulocytes (i.e., neutrophils, eosinophils and basophils) are involved in the immune response elicited by inflammation and infection. Inflammation is a localized protective response elicited by injury or destruction of tissues which serves to destroy, dilute or wall off both the injurious agent and the injured tissue. It is characterized by fenestration of the microvasculature, leakages of the elements of blood into the interstitial spaces, and migration of leukocytes into the inflamed tissue. On a macroscopic level, this is usually accompanied by the familiar clinical signs of erythema, edema, tenderness (hyperalgesia), and pain. During this complex response, chemical mediators such as histamine, 5-hydroxytryptamine, various chemotactic factors, bradykinin, leukotrienes, and prostaglandins are released locally. Phagocytic cells migrate into the area, and cellular lysosomal membranes may be ruptured, releasing lytic enzymes. All of these events may contribute to the inflammatory response.

Inflammation is initiated by, among other things, trauma, tissue necrosis, infection or immune reactions. The immediate response is temporary vasoconstriction.

Vasoconstriction is followed within seconds by the acute vascular response resulting in increased blood flow (hyperemia) and edema. The acute phase is also characterized by the margination of polymorphonuclear white blood cells (neutrophils) next to endothelial cells, followed by emigration of neutrophils into the adjacent tissue. Margination is recognized by the lining up of neutrophils along the endothelium of vessels. Emigration occurs by passage of the inflammatory cells between endothelial cells.

Neutrophils are the first wave of cellular attack on invading organisms and are the characteristic cells of acute inflammation. The appearance of neutrophils in areas of iriflarnmation may be caused by chemicals released from bacteria, factors produced nonspecifically from necrotic tissue or antibody reacting with antigen. Neutrophils use an actin-rich cytoskeleton to move in a directed manner along a chemotactic gradient from the bloodstream to an inflammatory site where they ingest particles (e.g. bacteria) and immune complexes bearing IgG (via FcR) and/or breakdown products of the complement component C3.

Neutrophils belong to a category of white blood cells known as polymorphonuclear white blood cells. The blood cells with single nuclei (mononuclear cells) form the white blood cell population that includes macrophages, T and B cells. White blood cells that contain segmented nuclei are broadly classified as polymorphonuclear. Polymoφhonuclear white blood cells (or "granulocytes") are further subdivided into three major populations on the basis of the staining properties of their cytoplasmic granules in standard hematologic smears or tissue preparations: neutrophils staining pink, eosinophils staining red and basophils staining blue.

Neutrophils (also referred to as polymorphonuclear neutrophils-PMNs) make up 50% to 70% of the white blood cells (WBCs) of the peripheral blood and may be found scattered diffusely in many tissues, although they are most frequently found in areas of acute inflammation or acute necrosis. Like other WBCs, neutrophils are produced from precursor cells in the bone marrow and released into the blood when mature. After entering the circulation, neutrophils are thought to last only 1 or 2 days. Neutrophils are characterized by numerous cytoplasmic granules that contain highly destructive enzymes that must be kept isolated from the cytoplasm. These granules contain a number of oxygen-independent enzymes as well as oxygen-dependent mechanisms of killing. Upon attraction to sites of inflammation, neutrophils attempt to engulf and digest bacteria coated with antibody and complement. Phagocytosis by neutrophils is also usually accompanied by release of the lysosomal enzymes into the tissue spaces, particularly if the organism is difficult for the neutrophil to digest.

At least three cytoplasmic granules are identifiable in neutrophils: specific granules containing lactoferrin, B cytochrome, the complement receptor CR3 and β₂-integrin; azurophilic granules containing acid hydrolases and other enzymes; and a third granule containing gelatinase.

In addition to the role neutrophils and other granulocytic cells play in immune response to pathogens, including bacterial infection, neutrophils and other granulocytic cells play an unwanted role in many chronic inflammatory diseases. There are many disease states in which excessive or unregulated granulocytic cell infiltration and activation are implicated in exacerbating and/or causing the disease. For instance, many inflammatory diseases are characterized by massive neutrophil infiltration, such as psoriasis, inflammatory bowel disease, Crohn's disease, asthma, cardiac and renal reperfusion injury, adult respiratory distress syndrome, rheumatoid arthritis, thrombosis and glomerulonephritis. All of these diseases are associated with increased IL-8 production which may be responsible for the chemotaxis of neutrophils into the inflammatory site.

While the role of neutrophil infiltration and activation in inflammation is well known, the biosynthetic responses of neutrophils to pathogens, chemotactic agents, promflammatory molecules, etc. are not as well understood. Neutrophils were once thought to be in a state of terminal differentiation, thereby lacking biosynthetic ability. This view is consistent with the relative scarcity in mature circulating neutrophils of ribosomes and endoplasmic reticulum and with the ability of neutrophils to ingest particles when RNA and/or protein synthesis has been inhibited. More recently it has been demonstrated that neutrophils perform more active roles in their response to environmental stimuli. Certain of the genes involved in this response have been identified (see Yerramilli, et al, WO 99/10536, specifically incorporated herein by reference).

It has thus recently been established that neutrophils synthesize de novo important macromolecules including, but not limited to interleukin (TL) 1, 11-6, 11-8, tumor necrosis factor (TNF ), granulocyte and macrophage colony-stimulating factors, interferon (IFN ), intercellular adhesion molecule (ICAM-1) and membrane and cystoskeletal molecules, such as major histocompatibility class I antigens and actin (Beaulieu et al (1992) J. Biolog. Chem. 267(l):426-432; Arnold et al. (1993) Infect. Immun. 61(6):2545-2552; and Eisner et al. (1995) Immunobiol 193:456-464). No study, however, has taken a systematic approach to assess the transcriptional response during neutrophil activation via contact with a pathogen or from neutrophils isolated from a subject with a sterile inflammatory disease.

Eosinophils are another granulocytic or polymorphonuclear white blood cell that are involved in the inflammatory response. Eosinophils are found predominately in two types of inflammation: allergy and parasite infections.

The role of eosinophils in the host response to parasites is thought to be mediated through the components of the eosinophilic granules. Eosinophils are cytotoxic to schistosome larvae through an antibody-dependent cell-mediated mechanism. Eosinopliil cationic proteins are highly toxic for schistosomes and may be responsible for binding of eosinophils to parasitic worms as well as fragmentation of the parasite.

The role of eosinophils in acute inflammation is not fully understood. On one hand, there is evidence that enzymes in eosinophils may serve to limit the extent of inflammation by neutralizing mediators of anaphylaxis, such as LTC4 , histamine and platelet-activating factor. On the other hand, there is increasing evidence that cationic proteins in eosinophilic granules are mediators of acute inflammation. Eosinopliil activation is associated with acute tissue injury and cause an intense vasoconstriction in lung microvasculature, followed by increased pulmonary vascular permeability and pulmonary edema.

Basophils or mast cells are the other major cell type characterized as a granulocytic or polymorphonuclear white blood cell. Mast cells contain granules with a variety of biologically active agents which, when released extracellularly (degranulation), cause dilation of the smooth muscle of arterioles (vasodilation), increased blood flow, and contraction of endothelial cells, thereby opening up vessel walls to permit egress of antibodies, complement or inflammatory cells into tissue spaces.

BRIEF SUMMARY OF THE INVENTION The present invention identifies the global changes in gene expression associated with the activation of granulocytic cells. The present invention also identifies expression profiles which serve as useful diagnostic markers as well as markers that can be used to monitor disease states, disease progression, drug toxicity, drug efficacy and drug metabolism. The present inventors have systematically assessed the transcriptional response from granulocytic cells activated through contact with a pathogen or from granulocytic cells isolated from a subject with a sterile inflammatory disease.

In one aspect, the present invention provides a method of detecting granulocyte activation comprising detecting the level of expression in a sample of one or more genes from Tables 2-8 and comparing the expression level to an expression level in an un- activated granulocyte, wherein differential expression of the genes in Tables 2-8 is indicative of granulocyte activation. The present invention also provides a method of modulating granulocyte activation comprising contacting a granulocyte with an agent, wherein the agent alters the expression of at least one gene in Tables 2-8 thereby modulating granulocyte activation. In a related aspect, the present invention provides a method of screening for an agent capable of modulating granulocyte activation comprising preparing a first gene expression profile of a cell population comprising granulocytes, wherein the expression profile determines the expression level of one or more genes from Tables 2-8, exposing the cell population to the agent, preparing a second gene expression profile of the agent-exposed cell population and comparing the first and second gene expression profiles.

In another aspect, the present invention provides a method of detecting inflamation in a tissue comprising detecting the level of expression in a sample of the tissue of one or more genes from Tables 2-8; wherein the level of expression of the genes in Tables 2-8 is indicative of inflammation. The present invention also provides a method of treating inflammation in a tissue comprising contacting a tissue undergoing n inflammatory response with an agent, wherein the agent alters the expression in the tissue of at least one gene in Tables 2-8 thereby treating the inflammation. In a related aspect, the present invention provides a method of screening for an agent capable of modulating inflammation in a tissue comprising preparing a first gene expression profile of a sample of the tissue, wherein the expression profile determines the expression level of one or more genes from Tables 2-8, exposing the tissue to the agent, preparing second gene expression profile of the agent-exposed tissue and comparing the first and second gene expression profiles. In some embodiments, the present invention provides a method of detecting a chronic inflamation in a tissue comprising detecting the level of expression in a sample of the tissue of one or more genes from Tables 2-8, wherein the level of expression of the genes in Tables 2-8 is indicative of a chronic inflammation. The present invention also provides a method of treating a chronic inflammation in a tissue comprising contacting a tissue having a chronic inflammation with an agent, wherein the agent alters the expression in the tissue of at least one gene in Tables 2-8 thereby treating the chronic inflammation. In a related aspect, the present invention provides a method of screening for an agent capable of modulating a chronic inflammation in a tissue comprising preparing a first gene expression profile of a sample of the tissue, wherein the expression profile determines the expression level of one or more genes from Tables 2-8, exposing the tissue to the agent, preparing second gene expression profile of the agent-exposed tissue and comparing the first and second gene expression profiles. Some embodiments of the present invention provide a method of detecting an allergic response in a subject comprising obtaining a sample from the subject, the sample comprising granulocytes, preparing a gene expression profile of the sample, wherein the expression profile determines the expression level of one or more genes from Tables 2-8, comparing the expression level to an expression level in a sample from a normal individual, wherein differential expression of the genes in Tables 2-8 is indicative of an allergic response. The invention also provides a method of treating an allergic response in a subject comprising administering to the subject an agent, wherein the agent alters the expression in the tissue of at least one gene in Tables 2-8 thereby treating the allergic response, h a related embodiment, the present invention provides a method of screening for an agent capable of modulating an allergic response in a subject comprising preparing a first gene expression profile of a sample from the subject wherein the expression profile determines the expression level of one or more genes from Tables 2-8, administering to the subject an agent, preparing a second gene expression profile of a sample from the agent- exposed subject and comparing the first and second gene expression profiles.

In some embodiments, the present invention is a method of detecting exposure of a subject to a pathogen comprising preparing a first gene expression profile of a granulocyte population from the subject wherein the expression profile determines the expression level of one or more genes from Tables 2-8, comparing the first gene expression profile to a second gene expression profile from a granulocyte population exposed to the pathogen and to a third gene expression profile from a granulocyte population not exposed to the pathogen, and determining whether the subject was exposed to the pathogen. In a related embodiment, the invention provides a method of treating a subject exposed to a pathogen comprising administering to the subject an agent, wherein the agent affects the expression of at least one gene in Tables 2-8 thereby treating the subject, another aspect, the invention provides a method of screening for an agent that modulates a response of a granulocyte population to a pathogen comprising preparing a first gene expression profile of a first sample from the granulocyte population wherein the expression profile determines the expression level of one or more genes from Tables 2-8, exposing a second sample of the granulocyte population to a pathogen and preparing a second gene expression profile from the second sample, contacting the pathogen-exposed granulocyte population with an agent and preparing a third gene expression profile from the agent- contacted pathogen-exposed population, comparing the first, second and third gene expression profiles and identifying agents that modulate the response of a granulocyte population to the pathogen.

In some embodiments, the present invention provides a method of detecting a sterile inflammatory disease in a subject comprising detecting the level of expression in a sample from the subject of one or more genes from Tables 2-8 wherein the level of expression of the genes in Tables 2-8 is indicative of a sterile inflammatory disease. In another aspect, the present invention provides a method of treating a sterile inflammatory disease in a subject comprising contacting the subject with an agent wherein the agent alters the expression in the tissue of at least one gene in Tables 2-8 thereby treating the sterile inflammatory disease. In a related embodiment, the present invention is a method of screening for an agent capable of modulating a sterile inflammatory disease in a subject comprising preparing a first gene expression profile of a sample from the subject wherein the expression profile determines the expression level of one or more genes from Tables 2- 8, exposing the subject to the agent, preparing a second gene expression profile of a sample obtained from the agent-exposed subject and comparing the first and second gene expression profiles.

In some preferred embodiments, the present invention provides a composition comprising at least two ohgonucleotides wherein each of the ohgonucleotides comprises a sequence that specifically hybridizes to a gene in Tables 2-8. In some preferred embodiments, the invention provides compositions comprising at least 3, 4, 5, 6, 7, 8, 9 or 10 or more ohgonucleotides wherein each of the ohgonucleotides comprises a sequence that specifically hybridizes to a gene in Tables 2-8. In some preferred embodiments, at least one oligonucleotide is attached to a solid support which may be a membrane, a glass support, a filter, a tissue culture dish, a polymeric material, a bead, a silica support or any other solid support known to those skilled in the art.

In some aspects, the present invention provides a solid support comprising at least two ohgonucleotides wherein each of the ohgonucleotides comprises a sequence that specifically hybridizes to a gene in Tables 2-8. The ohgonucleotides maybe attached covalently or non-covalently to the solid support and a given support may comprise both covalently attached and non-covalently attached ohgonucleotides. The solid supports of the present invention may comprise ohgonucleotides attached at varying densities, for example, at least 10 different ohgonucleotides may be attached in discrete locations per square centimeter, at least 100 different ohgonucleotides maybe attached in discrete locations per square centimeter, at least 1,000 different ohgonucleotides maybe attached in discrete locations per square centimeter, at least 10,000 different ohgonucleotides may be attached in discrete locations per square centimeter.

The present invention also provides a computer system comprising a database containing information identifying an expression level in a cell population comprising granulocytes of a set of genes comprising at least two genes in Tables 2-8 and a user interface to view the information. The computer system of the present invention may further comprise sequence information for the genes and/or information identifying the expression level for the set of genes in a cell population comprising non-activated granulocytes and/or information identifying the expression level of the set of genes in a cell population comprising activated granulocytes. In some preferred embodiments, the computer system of the present invention may comprise records including descriptive information from an external database (for example, GenBank), which information correlates said genes to records in the external database. The present invention also includes methods of using a computer system to present information identifying the expression level in a tissue or cell of at least one gene in Tables 2-8 comprising comparing the expression level of at least one gene in Tables 2-8 in the tissue or cell to the level of expression of the gene in the database. The methods may include comparison of the expression levels of 2, 3, 4, 5, 6, 7, 8, 9 or 10 or more genes in Tables 2-8. some preferred embodiments, the methods may comprise displaying the level of expression of at least one gene in the tissue or cell sample compared to the expression level in a cell population comprising activated granulocytes.

The present invention also includes a method of identifying virulence factor genes in a pathogen by preparing a first gene expression profile of a quiescent granulocyte population, preparing a second gene expression profile of a granulocyte population exposed to a virulent or avirulent bacterial strain, preparing a third gene expression profile from a granulocyte population exposed to a bacterial strain with a mutation in a putative bacterial virulence factor gene, comparing the first, second and third gene expression profiles and identifying a bacterial virulence factor gene.

DETAILED DESCRIPTION OF THE INVENTION

Many biological functions are accomplished by altering the expression of various genes through transcriptional (e.g., through control of initiation, provision of RNA precursors, RNA processing, etc.) and/or translational control. For example, fundamental biological processes such as cell cycle, cell differentiation and cell death, are often characterized by the variations in the expression levels of groups of genes.

Changes in gene expression also are associated with pathogenesis. Thus, changes in the expression levels of particular genes (e.g., oncogenes, tumor suppressors, cytokines and the like) serve as signposts for the presence and progression of various diseases.

Monitoring changes in gene expression may also provide certain advantages during drug screening development. Often drugs are screened and prescreened for the ability to interact with a major target without regard to other effects the drugs have on cells. Often such other effects cause toxicity in the whole animal, which prevent the development and use of the potential drug.

The present inventors have examined two sets of cell populations comprising quiescent and activated granulocytes to identify the global changes in gene expression associated with granulocyte, and in particular neutrophil, activation. These global changes in gene expression, also referred to as expression profiles, provide useful markers for diagnostic uses as well as markers that can be used to monitor disease states, disease progression, drug toxicity, drug efficacy and drug metabolism.

Expression profiles of genes in particular tissues, disease states or disease progression stages provide molecular tools for evaluating toxicity, drug efficacy, drug metabolism, development, and disease monitoring. Changes in the expression profile from a baseline profile can be used as an indication of such effects. Those skilled in the art can use any of a variety of known techniques to evaluate the expression of one or more of the genes and/or ESTs identified in the instant application in order to observe changes in the expression profile. The response of neutrophils to pathogens, including bacterial pathogens, is a subject of primary importance in view of the need to find ways to modulate the immune response to infection. Similarly, the response of neutrophils to agonists (pro-inflammatory molecules) is a subject of primary importance in view of the need to find better ways of controlling inflammation in various disease states. One means of assessing the response of neutrophils to pathogens and agonists is to measure the ability of neutrophils to synthesize specific RNA de novo upon contact with the pathogen or agonist.

The following discussion presents a description of the invention as well definitions for certain terms used herein. Definitions

Granulocytic cells, also known as polymorphonuclear white blood cells, include neutrophils, also known as polymorphonuclear neutrophils or peripheral blood neutrophils, eosinophils, and basophils, also referred to a mast cells.

The term "pathogen" refers to any infectious organism including bacteria, viruses, parasites, mycoplasma, protozoans, and fungi (including molds and yeast). Pathogenic bacteria include, but are not limited to Staphylococci (e.g. aureus), Streptococci (e.g. pneurnoniae), Clostridia (e.g. perfringens), Neisseria (e.g. gonorrhoeae), Enterobacteriaceae (e.g. coli as well as Klebsiella, Salmonella, Shigella, Yersinia and Proteus), Helicobacter (e.g. pylori), Vibrio (e.g. cholerae), Campylobacter (e.g. jejuni), Pseudomonas (e.g. aeruginosa), Haemophilus (e.g. influenzae), Bordetella (e.g. pertussis), Mycoplasma (e.g. pneurnoniae), Ureaplasma (e.g. urealyticum), Legionella (e.g. pneumophila), Spirochetes (e.g. Treponema, Leptospira and Borrelia), Mycobacteria (e.g. tuberculosis, smegmatis), Actinomyces (e.g. (israelii), Nocardia (e.g. asteroides),

Chlamydia (e.g. trachomatis), Rickettsia, Coxiella, Ehrilichia, Rochalimaea, Brucella, Yersinia, Fracisella, and Pasteurella.

The term "sterile inflammatory disease" refers to any inflammatory disease caused by immune or nonimmune mechanisms not directly linked to infection (see Stewart et al). Examples of sterile inflammatory diseases include, but are not limited to psoriasis, rheumatoid arthritis, glomerulonephritis, asthma, cardiac and renal reperfusion injury, thrombosis, adult respiratory distress syndrome, inflammatory bowel diseases such as Crohn's disease and ulcerative colitis and periodontal disease.

The phrase "solid support" refers to any support to which nucleic acids can be bound or immobilized. Preferred solid supports include, but are not limited to, nitrocellulose, nylon, glass, polymeric material, other solid supports which are positively charged and nanochannel glass arrays disclosed by Beattie (WO 95/1175). Solid supports may be in any convenient form including, but not limited to, a membrane, a filter, a tissue culture dish, a strip, a bead and the like. The phrase "gene expression profile", also referred to as a "differential expression profile" or "expression profile" refers to any representation of the expression of at least one mRNA species in a cell sample or population. A gene expression profile may be used to detect the level of expression of one or more genes of interest. The present invention provides compositions and methods to detect the level of expression of genes that may be differentially expressed dependent upon the state of the cell, i. e., quiescent versus activated. As used herein, the phrase "detecting the level of expression" is seen to include determining whether a gene of interest is expressed at all. Thus, an assay which provides a yes or no result without necessarily providing quantification of an amount of expression is seen to be an assay that requires "detecting the level of expression" as that phrase is used herein.

A gene expression profile can refer to an autoradiograph of labeled cDNA fragments produced from total cellular mRNA separated on the basis of size by known procedures. Such procedures include slab gel electrophoresis, capillary gene electrophoresis, high performance liquid chromatography, and the like. Digitized representations of scanned electrophoresis gels are also included as are two and three dimensional representations of the digitized data. A gene expression profile also can be prepared using "DNA chip" technology as described below. As used herein, oligonucleotide sequences that are complementary to one or more of the genes described herein, refers to ohgonucleotides that are capable of hybridizing under stringent conditions to at least part of the nucleotide sequence of said genes. Such hybridizable ohgonucleotides will typically exhibit at least about 75% sequence identity at the nucleotide level to said genes, preferably about 80% or 85% sequence identity or more preferably about 90% or 95% or more sequence identity to said genes.

"Bind(s) substantially" refers to complementary hybridization between a probe nucleic acid and a target nucleic acid and embraces minor mismatches that can be accommodated by reducing the stringency of the hybridization media to achieve the desired detection of the target polynucleotide sequence. The terms "background" or "background signal intensity" refer to hybridization signals resulting from non-specific binding, or other interactions, between the labeled target nucleic acids and components of the oligonucleotide array (e.g., the oligonucleotide probes, control probes, the array substrate, etc.). Background signals may also be produced by intrinsic fluorescence of the array components themselves. A single background signal can be calculated for the entire array, or a different background signal may be calculated for each target nucleic acid. In a preferred embodiment, background is calculated as the average hybridization signal intensity for the lowest 5% to 10% of the probes in the array, or, where a different background signal is calculated for each target gene, for the lowest 5% to 10% of the probes for each gene. Of course, one of skill in the art will appreciate that where the probes to a particular gene hybridize well and thus appear to be specifically binding to a target sequence, they should not be used in a background signal calculation. Alternatively, background may be calculated, as the average hybridization signal intensity produced by hybridization to probes that are not complementary to any sequence found in the sample (e.g., probes directed to nucleic acids of the opposite sense or to genes not found in the sample such as bacterial genes where the sample is mammalian nucleic acids). Background can also be calculated as the average signal intensity produced by regions of the array that lack any probes at all. The phrase "hybridizing specifically to" refers to the binding, duplexing or hybridizing of a molecule substantially to or only to a particular nucleotide sequence or sequences under stringent conditions when that sequence is present in a complex mixture (e.g., total cellular) DNA or RNA.

The term "mismatch control" or "mismatch probe" refer to a probe whose sequence is deliberately selected not to be perfectly complementary to a particular target sequence. For each mismatch (MM) control in a high-density array there typically exists a corresponding perfect match (PM) probe that is perfectly complementary to the same particular target sequence. The mismatch may comprise one or more bases.

While the mismatch(s) may be located anywhere in the mismatch probe, terminal mismatches are less desirable as a terminal mismatch is less likely to prevent hybridization of the target sequence, hi a particularly preferred embodiment, the mismatch is located at or near the center of the probe such that the mismatch is most likely to destabilize the duplex with the target sequence under the test hybridization conditions.

The term "perfect match probe" refers to a probe that has a sequence that is perfectly complementary to a particular target sequence. The test probe is typically perfectly complementary to a portion (subsequence) of the target sequence. The perfect match (PM) probe can be a "test probe", a "normalization control" probe, an expression level control probe and the like. A perfect match control or perfect match probe is, however, distinguished from a "mismatch control" or "mismatch probe." As used herein a "probe" is defined as a nucleic acid, capable of binding to a target nucleic acid of complementary sequence through one or more types of chemical bonds, usually through complementary base pairing, usually through hydrogen bond formation. As used herein, a probe may include natural (i.e., A, G, U, C or T) or modified bases (7- deazaguanosine, inosine, etc.). In addition, the bases in probes may be joined by a linkage other than a phosphodiester bond, so long as it does not interfere with hybridization. Thus, probes may be peptide nucleic acids in which the constituent bases are joined by peptide bonds rather than phosphodiester linkages. The term "stringent conditions" refers to conditions under which a probe will hybridize to its target subsequence, but with only insubstantial hybridization to other sequences or to other sequences such that the difference may be identified. Stringent conditions are sequence-dependent and will be different in different circumstances. Longer sequences hybridize specifically at higher temperatures. Generally, stringent conditions are selected to be about 5°C lower than the thermal melting point (Tm) for the specific sequence at a defined ionic strength and pH.

Typically, stringent conditions will be those in which the salt concentration is at least about 0.01 to 1.0 M sodium ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30°C for short probes (e.g., 10 to 50 nucleotide). Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide.

The "percentage of sequence identity" or "sequence identity" is determined by comparing two optimally aligned sequences or subsequences over a comparison window or span, wherein the portion of the polynucleotide sequence in the comparison window may optionally comprise additions or deletions (i.e., gaps) as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions at which the identical submit (e.g., nucleic acid base or amino acid residue) occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison and multiplying the result by 100 to yield the percentage of sequence identity. Percentage sequence identity when calculated using the programs GAP or BESTFIT (see below) is calculated using default gap weights.

Homology or identity is determined by BLAST (Basic Local Alignment Search Tool) analysis using the algorithm employed by the programs blastp, blastn, blastx, tblastn and tblastx (Karlin et al, (1990) Proc. Natl. Acad. Sci. USA 87, 2264-2268 and Altschul, (1993) J. Mol. Evol. 36, 290-300, fully incorporated by reference) which are tailored for sequence similarity searching. The approach used by the BLAST program is to first consider similar segments between a query sequence and a database sequence, then to evaluate the statistical significance of all matches that are identified and finally to summarize only those matches which satisfy a preselected threshold of significance. For a discussion of basic issues in similarity searching of sequence databases, see Altschul et al, (1994) Nature Genet. 6, 119-129) which is fully incorporated by reference. The search parameters for histogram, descriptions, alignments, expect (i.e., the statistical significance threshold for reporting matches against database sequences), cutoff, matrix and filter are at the default settings. The default scoring matrix used by blastp, blastx, tblastn, and tblastx is the BLOSUM62 matrix (Henikoff et al, (1992) Proc. Natl. Acad. Sci. USA 89, 10915- 10919, fully incoφorated by reference). Four blastn parameters were adjusted as follows: Q=10 (gap creation penalty); R=10 (gap extension penalty); wink=l (generates word hits at every wink^th position along the query); and gapw=16 (sets the window width within which gapped alignments are generated). The equivalent Blastp parameter settings were Q=9; R=2; wink=l; and gapw=32. A Bestfit comparison between sequences, available in the GCG package version 10.0, uses DNA parameters GAP=50 (gap creation penalty) and LEN=3 (gap extension penalty) and the equivalent settings in protein comparisons are GAP^δ and LEN=2.

Diagnostic Uses for the Granulocyte Activation Markers As described herein, the genes and gene expression information provided in Tables

2-8 may be used as diagnostic markers for the prediction or identification of activation state of granulocytes. For instance, a granulocyte-containing sample from a subject may be assayed by any of the methods described herein, and the expression levels from a gene or genes from the Tables, in particular the genes in Tables 2-8, may be compared to the expression levels found in activated and/or quiescent granulocytes. The samples obtained from subjects with a disease affecting granulocyte activation may be compared to similar samples from normal subjects. Differences and/or similarities of the expression profiles maybe used to diagnose diseases. Comparison of the expression data, as well as available sequence or other information may be done by researcher or diagnostician or may be done with the aid of a computer and databases as described herein. Use of the Granulocyte Activation Markers for Monitoring Disease Progression

As described herein, the genes and gene expression information provided in Tables 2-8 may also be used as markers for the monitoring of disease progression, for instance, the progress of an infection or a sterile inflammatory disease. For instance, a granulocyte- containing sample from a subject may be assayed by any of the methods described herein, and the expression levels in the sample from a gene or genes from Tables 2-8 may be compared to the expression levels found in activated and/or quiescent granulocytes. Expression profiles generated from a granulocyte-containing sample from normal or diseased subjects may be used, for instance, to monitor disease progression. Comparison of the expression data, as well as available sequence or other information may be done by researcher or diagnostician or may be done with the aid of a computer and databases as described herein.

Use of the Granulocyte Activation Markers for Drug Screening According to the present invention, the genes identified in Tables 2-8 may be used as markers to evaluate the effects of a candidate drug or agent on a cell, particularly a cell undergoing an inflammatory response. A candidate drug or agent can be screened for the ability to simulate the transcription or expression of a given marker or markers or to down- regulate or counteract the transcription or expression of a marker or markers. According to the present invention, one can also compare the specificity of drugs' effects by looking at the number of markers which the drugs have and comparing them. More specific drugs will have less transcriptional targets. Similar sets of markers identified for two drugs indicates a similarity of effects.

Agents that are assayed in the methods described herein can be randomly selected or rationally selected or designed. As used herein, an agent is said to be randomly selected when the agent is chosen randomly without considering the specific sequences involved in the association of the a protein of the invention alone or with its associated substrates, binding partners, etc. An example of randomly selected agents is the use a chemical library or a peptide combinatorial library, or a growth broth of an organism. As used herein, an agent is said to be rationally selected or designed when the agent is chosen on a nonrandom basis which takes into account the sequence of the target site and/or its conformation in connection with the agent's action. Agents can be rationally selected or rationally designed by utilizing the peptide sequences that make up these sites. For example, a rationally selected peptide agent can be a peptide whose amino acid sequence is identical to or a derivative of any functional consensus site.

The agents of the present invention can be, as examples, peptides, small molecules, vitamin derivatives, as well as carbohydrates. Dominant negative proteins, DNA encoding these proteins, antibodies to these proteins, peptide fragments of these protems or mimics of these proteins may be introduced into cells to affect function. "Mimic" as used herein refers to the modification of a region or several regions of a peptide molecule to provide a structure chemically different from the parent peptide but topographically and functionally similar to the parent peptide (see Grant, (1995) in Molecular Biology and Biotechnology Meyers (editor) VCH Publishers). A skilled artisan can readily recognize that there is no limit as to the structural nature of the agents of the present invention.

Assay Formats

The genes identified as being differentially expressed in quiescent versus activated granulocytes may be used in a variety of nucleic acid detection assays to detect or quantititate the expression level of a gene or multiple genes in a given sample. For example, traditional Northern blotting, nuclease protection, RT-PCR and differential display methods may be used for detecting gene expression levels. Those methods are useful for some embodiments of the invention. Gene expression profiles can be produced by any means known in the art, including, but not limited to the methods disclosed by: Liang et al. (1992) Science 257:967-971; Ivanova et al. (1995) Nucleic Acids Res. 23:2954-2958; Guilfoyl et al. (1997) Nucleic Acids Res. 25(9):1854-1858; Chee et al. (1996) Science 274:610-614; Velculescu et al. (1995) Science 270:484-487; Fischer et al (1995) Proc. Natl. Acad. Sci. USA 92(12):5331-5335; and Kato (1995) Nucleic Acids Res. 23(18):3685-3690.

Preferably, gene expression profiles are produced by the methods of Prashar et al (WO 97/05286) and Prashar et al. (1996) Proc. Natl. Acad. Sci. USA 93:659-663.

As an example, gene expression profiles as described herein are made to identify one or more genes whose expression levels are modulated in an activated granulocytic cell population such as one exposed to a pathogen or isolated from a subject having a sterile inflammatory disease. The assaying of the modulation of gene expression via the production of a gene expression profile may involve the production of cDNA from polyA RNA (mRNA) isolated from granulocytes as described below . The mRNAs are isolated from a granulocytic cell source. The cells may be obtained from an in vivo source, such as a peripheral blood. As is apparent to one skilled in the art, any granulocytic cell type may be used, however, neutrophils are preferred. Furthermore, the peripheral blood cells that are initially obtained may be subjected to various separation techniques (e.g., flow cytometry, density gradients). mRNAs are isolated from cells by any one of a variety of techniques. Numerous techniques are well known (see e.g., Sambrook et al, Molecular Cloning: A Laboratory Approach, Cold Spring harbor Press, NY, 1987; Ausubel et., Current Protocols in Molecular Biology, Greene Publishing Co. NY, 1995). In general, these techniques first lyse the cells and then enrich for or purify RNA. In one such protocol, cells are lysed in a Tris-buffered solution containing SDS. The lysate is extracted with phenol/chloroform, and nucleic acids are precipitated. Purification of poly(A)-containing RNA is not a requirement. The mRNAs may, however, be purified from crude preparations of nucleic acids or from total RNA by chromatography, such as binding and elution from oligo(dT)- cellulose or poly(U)-Sepharose®. As stated above, other protocols and methods for isolation of RNAs may be substituted.

The mRNAs are reverse transcribed using an RNA-directed DNA polymerase, such as reverse transcriptase isolated from AMV, MoMuLV or recombinantly produced. Many commercial sources of enzyme are available (e.g., Pharmacia, New England Biolabs, Stratagene Cloning Systems). Suitable buffers., cofactors, and conditions are well known and supplied by manufacturers (see also, Sambrook et al, supra; Ausubel et al, supra). Various ohgonucleotides are used in the production of cDNA. h particular, the methods utilize oligonucleotide primers for cDNA synthesis, adapters, and primers for amplification. Ohgonucleotides are generally synthesized as single strands by standard chemistry techniques, including automated synthesis. Ohgonucleotides are subsequently de-protected and may be purified by precipitation with ethanol, chromatographed using a sized or reversed-phase column, denaturing polyacrylamide gel electrophoresis, high- pressure liquid chromatography (HPLC), or other suitable method. In addition, within certain preferred embodiments, a functional group, such as biotin, is incoφorated. A biotin moiety may be incoφorated at any position in the oligonucleotide, for example, at the 5'- or 3'- terminal nucleotide or at internal nucleotide positions. In some embodiments, it may be desirable to incoφorate more than one biotin moiety into an oligonucleotide. A biotinylated oligonucleotide may be synthesized using pre-coupled nucleotides, or alternatively, biotin may be conjugated to the oligonucleotide using standard chemical reactions. Other functional groups, such as florescent dyes, radioactive molecules, digoxigenin, and the like, may also be incoφorated.

Partially-double stranded adaptors are formed from single stranded ohgonucleotides by annealing complementary single-stranded ohgonucleotides that are chemically synthesized or by enzymatic synthesis. Following synthesis of each strand, the two oligonucleotide strands are mixed together in a buffered salt solution (e.g., 1 M NaCl, 100 mM Tris-HCl pH.8.0, 10 mM EDTA) or in a buffered solution containing Mg²⁺ (e.g., 10 mM MgCl₂) and annealed by heating to high temperature and slow cooling to room temperature.

The oligonucleotide primer that primes first strand DNA synthesis comprises a 5' sequence incapable of hybridizing to a polyA tail of the mRNAs, and a 3' sequence that hybridizes to a portion of the polyA tail of the mRNAs and at least one non-polyA nucleotide immediately upstream of the polyA tail. The 5' sequence is preferably a sufficient length that can serve as a primer for amplification. The 5' sequence also preferably has an average G+C content and does not contain large palindromic sequence; some palindromes, such as a recognition sequence for a restriction enzyme, may be acceptable. Examples of suitable 5' sequences are CTCTCAAGGATCTACCGCT (SEQ ID No. 1370), CAGGGTAGACGACGCTACGC (SEQ ID No. 1371), and TAATACCGCGCCACATAGCA (SEQ ID No. 1372).

The 5' sequence is joined to a 3' sequence comprising sequence that hybridizes to a portion of the polyA tail of mRNAs and at least one non-polyA nucleotide immediately upstream. Although the polyA-hybridizing sequence is typically a homopolymer of dT or dU, it need only contain a sufficient number of dT or dU bases to hybridize to polyA under the conditions employed. Both oligo-dT and oligo-dU primers have been used and give comparable results. Thus, other bases may be interspersed or concentrated, as long as hybridization is not impeded. Typically, 12 to 18 bases or 12 to 30 bases of dT or dU will be used. However, as one skilled in the art appreciates, the length need only be sufficient to obtain hybridization. The non-polyA nucleotide is A, C, or G, or a nucleotide derivative, such as inosinate. If one non-polyA nucleotide is used, then three oligonucleotide primers are needed to hybridize to all mRNAs. If two non-polyA nucleotides are used, then 12 primers are needed to hybridize to all mRNAs. The 12 primers would have 3 '-terminal sequences capable of hybridizing to the two nucleotides immediately preceding the polyA tail of the mRNA, i. e., would end in AA, AC, AG, AT, CA, CC, CG, CT, GA, GC, GG, or GT. If three non-poly A nucleotides are used then 48 primers are needed (3 X 4 X 4). Although there is no theoretical upper limit on the number of non-polyA nucleotides, practical considerations make the use of one or two non-polyA nucleotides preferable.

For cDNA synthesis, the mRNAs are either subdivided into three (if one non- polyA nucleotide is used) or 12 (if two non-polyA nucleotides are used) fractions, each containing a single oligonucleotide primer, or the primers may be pooled and contacted with a mRNA preparation. Other subdivisions may alternatively be used. Briefly, first strand cDNA is initiated from the oligonucleotide primer by reverse transcriptase (RTase). As noted above, RTase may be obtained from numerous sources and protocols are well known. Second strand synthesis may be performed by RTase (Gubler and Hoffman, Gene 25: 263, 1983), which also has a DNA-directed DNA polymerase activity, with or without a specific primer, by DNA polymerase 1 in conjunction with RNaseH and DNA ligase, or other equivalent methods. The double-stranded cDNA is generally treated by phenol: chloroform extraction and ethanol precipitation to remove protein and free nucleotides.

Double-stranded cDNA is subsequently digested with an agent that cleaves in a sequence-specific manner. Such cleaving agents include restriction enzymes. Restriction enzyme digestion is preferred; enzymes that are relatively infrequent cutters (e.g., 5 bp recognition site) are preferred and those that leave overhanging ends are especially preferred. A restriction enzyme with a six base pair recognition site cuts approximately 8% of cDNAs, so that approximately 12 such restriction enzymes should be needed to digest every cDNA at least once. By using 30 restriction enzymes, digestion of every cDNA is assured.

The adapters for use in the present invention are designed such that the two strands are only partially complementary and only one of the nucleic acid strands that the adapter is ligated to can be amplified. Thus, the adapter is partially double-stranded (i.e., comprising two partially hybridized nucleic acid strands), wherein portions of the two strands are non-complementary to each other and portions of the two strands are complementary to each other. Conceptually, the adapter is "Y-shaped" or "bubble- shaped." When the 5' region is non-paired, the 3' end of other strand cannot be extended by a polymerase to make a complementary copy. The ligated adapter can also be blocked at the 3' end to eliminate extension during subsequent amplifications. Blocking groups include dideoxynucleotides or any other agent capable of blocking the 3'-OH. hi this type of adapter ("Y-shaped"), the non-complementary portion of the upper strand of the adapters is preferably a length that can serve as a primer for amplification. As noted above, the non-complementary portion of the lower strand need only be one base, however, a longer sequence is preferable (e.g., 3 to 20 bases; 3 to 15 bases; 5 to 15 bases; or 14 to 24 bases). The complementary portion of the adapter should be long enough to form a duplex under conditions of litigation.

For "bubble-shaped" adapters, the non-complementary portion of the upper strands is preferably a length that can serve as a primer for amplification. Thus, this portion is preferably 15 to 30 bases. Alternatively, the adapter can have a structure similar to the Y- shaped adapter, but has a 3' end that contains a moiety that a DNA polymerase cannot extend from.

Amplification primers are also used in the present invention. Two different amplification steps are performed in the preferred aspect, hi the first, the 3' end

(referenced to mRNA) of double stranded cDNA that has been cleaved and ligated with an adapter is amplified. For this amplification, either a single primer or a primer pair is used. The sequence of the single primer comprises at least a portion of the 5' sequence of the oligonucleotide primer used for first strand cDNA synthesis. The portion need only be long enough to serve as an amplification primer, the primer pair consists of a first primer whose sequence comprises at least a portion of the 5' sequence of the oligonucleotide primer as described herein; and a second primer whose sequence comprises at least a portion of the sequence of one strand of the adapter in the non-complementary portion. The primer will generally contain all the sequence of the non-complementary potion, but may contain less of the sequence, especially when the non-complementary portion is very long, or more of the sequence, especially when the non-complementary portion is very short. In some embodiments, the primer will contain sequence of the complementary portion, as long as that sequence does not appreciably hybridize to the other strand of the adapter under the amplification conditions employed, for example, in one embodiment, the primer sequence comprises four bases of the complementary region to yield a 19 base primer, and amplification cycles are performed at 56 °C (annealing temperature), 72 °C (extension temperature), and 94 °C (denaturation temperature). In another embodiment, the primer is 25 bases long and has 10 bases of sequence in the complementary portion. Amplification cycles for this primer are performed at 68 °C (annealing and extension temperature) and 94 °C (denaturation temperature). By using these longer primers, the specificity of priming is increased.

The design of the amplification primers will generally follow well-known guidelines, such as average G-C content, absence of hanpin structures, inability to form primer-dimers and the like. At times, however, it will be recognized that deviations from such guidelines may be appropriate or desirable.

After amplification, the lengths of the amplified fragments are determined. Any procedure that separate nucleic acids on the basis of size and allows detection or identification of the nucleic acids is acceptable. Such procedures include slap get electrophoresis, capillary gel electrophoresis, high performance liquid chromatography, and the like.

Electrophoresis is technique based on the mobility of DNA in an electric flied. Negatively charged DNA migrates towards a positive electrode at a rate dependent on their total charge, size, and shape. Most often, DNA is electrophoresed in agarose or polyacrylamide gels. For maximal resolution, polyacrylamide is preferred and for maximal linearity, a denaturant, such as urea is present. A typical get setup uses a 19:1 mixture of acrylamide:bisacrylamide and a Tris-borate buffer. DNA samples are denatured and applied to the gel, which is usually sandwiched between glass plates. A typical procedure can be found in Sambrook et al (Molecular Cloning: A Laboratory

Approach, Cold Spring Harbor Press, NY, 1989) or Ausubel et al. (Current Protocols in Molecular Biology, Greene Publishing Co., NY, 1995). Variations maybe substituted as long as sufficient resolution is obtained.

Capillary electrophoresis (CE) in its various manifestations (free solution, isotachophoresis, isoelectric focusing, polyacrylamide get. micellar electrokinetic "chromatography") allows high resolution separation of very small sample volumes. Briefly, in capillary electrophoresis, a neutral coated capillary, such as a 50 μm X 37 cm column (eCAP neutral, Beckman Instruments, CA), is filled with a linear polyacrylamide (e.g., 0.2% polyacrylamide), a sample is introduced by high-pressure injection followed by an injection of running buffer (e.g., IX TBE). The sample is electrophoresed and fragments are detected. An order of magnitude increase in sensitivity may be achieved with the use of capillary electrophoresis. Capillaries may be used in parallel for increased throughput (Smith et al. (1990) Nuc. Acids. Res. 18:4417; Mathies and Huang (1992) Nature 359:167). Because of the small sample volume that can be loaded onto a capillary, a sample may be concentrated to increase level of detection. One means of concentration is sample stacking (Chien and Burgi (1992) Anal. Chem 64:489A). In sample stacking, a large volume of sample in a low concentration buffer is introduced to the capillary column. The capillary is then filled with a buffer of the same composition, but at higher concentration, such that when the sample ions reach the capillary buffer with a lower electric field, they stack into a concentrated zone. Sample stacking can increase detection by one to three orders of magnitude. Other methods of concentration, such as isotachophoresis, may also be used. High-performance liquid chromatography (HPLC) is a chromatographic separations technique that separates compounds in solution. HPLC instruments consist of a reservoir of mobile phase, a pump, an injector, a separation column, and a detector. Compounds are separated by injecting an aliquot of the sample mixture onto the column. The different components in the mixture pass through the column at different rates due to differences in their partitioning behavior between the mobile liquid phase and the stationary phase. IP-RO-HPLC on non-porous PS/DNB particles with chemically bonded alkyl chains can also be used to analyze nucleic acid molecules on the basis of size (Huber et al (1993) Anal Biochem. 121:351; Huber et al. (1993) Nuc. Acids Res. 21:1061; Huber et al (1993) Biotechniques 16:898). In each of these analysis techniques, the amplified fragments are detected. A variety of labels can be used to assist in detection. Such labels include, but are not limited to, radioactive molecules (e.g., S, P, P) fluorescent molecules, and mass spectrometric tags. The labels may be attached to the oligonucleotide primers or to nucleotides that are incoφorated during DΝA synthesis, including amplification. Radioactive nucleotides may be obtained from commercial sources; radioactive primers may be readily generated by transfer of label from γ- P-ATP to a 5'-OH group by a kinase (e.g., T4 polynucleotide kinase). Detection systems include autoradiograph, phosphor image analysis and the like.

Fluorescent nucleotides maybe obtained from commercial sources (e.g., ABI, Foster city, CA) or generated by chemical reaction using appropriately derivatized dyes. Oligonucleotide primers can be labeled, for example, using succinimidyl esters to conjugate to amine-modified ohgonucleotides. A variety of florescent dyes maybe used, including 6 carboxyfluorescein, other carboxyfluorescein derivatives, carboxyrhodamine derivatives, Texas red derivatives, and the like. Detection systems include photomultiplier tubes with appropriate wave-length filters for the dyes used. DNA sequence analysis systems, such as produced by ABI (Foster City, CA), may be used.

After separation of the amplified cDNA fragments, cDNA fragments which correspond to differentially expressed mRNA species are isolated, reamplified and sequenced according to standard procedures. For instance, bands conesponding the cDNA fragments can be cut from the electrophoresis gel, reamplified and subcloned into any available vector, including pCRscript using the PCR script cloning kit (Stratagene). The insert is then sequenced using standard procedures, such as cycle sequencing on an ABI sequencer.

In addition to the methodology described above, gene expression profiles may be prepared using a hybridization assay format. Any hybridization assay format may be used, including solution-based and solid support-based assay formats.

Oligonucleotide probe anays for expression monitoring can be made and used according to any techniques known in the art (see for example, Lockhart et al, (1996) Nat. Biotechnol. 14, 1675-1680; McGall et al, (1996) Proc. Nat. Acad. Sci. USA 93, 13555- 13460). Such probe anays may contain at least two or more ohgonucleotides that are complementary to or hybridize to two or more of the genes described herein. Such anays may also contain ohgonucleotides that are complementary or hybridize to at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 50, 70 or more the genes described herein. Assays and methods of the invention may utilize available formats to simultaneously screen at least about 100, preferably about 1000, more preferably about 10,000 and most preferably about 1,000,000 different nucleic acid hybridizations.

The genes which are assayed according to the present invention are typically in the form of mRNA or reverse transcribed mRNA. The genes may be cloned or not and the genes may be amplified or not. The cloning itself does not appear to bias the representation of genes within a population. However, it may be preferable to use polyA+ RNA as a source, as it can be used with less processing steps.

The sequences of the expression marker genes are in the public databases, i. e., GenBank. Tables 2-8 provide the GenBank Accession numbers and name for each of the sequences. The sequences of the genes in GenBank have been submitted on an electronic medium in computer readable form in compliance with Al § 801(a) of the PCT and are expressly incoφorated by reference as are identical or related sequences with difference GenBank numbers.

Assays to monitor the expression of a marker or markers as defined in Tables 2-8 may utilize any available means of monitoring for changes in the expression level of the nucleic acids of the invention. As used herein, an agent is said to modulate the expression of a nucleic acid of the invention if it is capable of up- or down-regulating expression of the nucleic acid in a cell.

In one assay format, gene chips containing probes to at least two genes from Tables 2-8 may be used to directly monitor or detect changes in gene expression in the treated or exposed cell as described in more detail above. In another format, cell lines that contain reporter gene fusions between the open reading frame of a gene in Tables 2-8 and any assayable fusion partner may be prepared. Numerous assayable fusion partners are known and readily available including the firefly luciferase gene and the gene encoding chloramphenicol acetyltransferase (Alam et al, (1990) Anal. Biochem. 188, 245-254). Cell lines containing the reporter gene fusions are then exposed to the agent to be tested under appropriate conditions and time. Differential expression of the reporter gene between samples exposed to the agent and control samples identifies agents which modulate the expression of the nucleic acid.

Additional assay formats may be used to monitor the ability of the agent to modulate the expression of a gene identified in Tables 2-8. For instance, as described herein, mRNA expression may be monitored directly by hybridization of probes to the nucleic acids of the invention. Cell lines are exposed to the agent to be tested under appropriate conditions and time and total RNA or mRNA is isolated by standard procedures such those disclosed in Sambrook et al, (1989) Molecular Cloning - A Laboratory Manual, Cold Spring Harbor Laboratory Press).

In another assay format, cells or cell lines are first identified which express the gene products of the invention physiologically. Cell and/or cell lines so identified would be expected to comprise the necessary cellular machinery such that the fidelity of modulation of the transcriptional apparatus is maintained with regard to exogenous contact of agent with appropriate surface fransduction mechanisms and/or the cytosolic cascades. Further, such cells or cell lines may be transduced or transfected with an expression vehicle (e.g., a plasmid or viral vector) construct comprising an operable non-translated 5'- promoter containing end of the structural gene encoding the instant gene products fused to one or more antigenic fragments, which are peculiar to the instant gene products, wherein said fragments are under the transcriptional control of said promoter and are expressed as polypeptides whose molecular weight can be distinguished from the naturally occurring polypeptides or may further comprise an immunologically distinct tag. Such a process is well known in the art (see Sambrook et al, (1989) Molecular Cloning - A Laboratory Manu'al, Cold Spring Harbor Laboratory Press).

Cells or cell lines transduced or transfected as outlined above are then contacted with agents under appropriate conditions; for example, the agent comprises a pharmaceutically acceptable excipient and is contacted with cells comprised in an aqueous physiological buffer such as phosphate buffered saline (PBS) at physiological pH, Eagles balanced salt solution (BSS) at physiological pH, PBS or BSS comprising serum or conditioned media comprising PBS or BSS and serum incubated at 37°C. Said conditions may be modulated as deemed necessary by one of skill in the art. Subsequent to contacting the cells with the agent, said cells will be disrupted and the polypeptides of the lysate are fractionated such that a polypeptide fraction is pooled and contacted with an antibody to be further processed by immunological assay (e.g., ELISA, immunoprecipitation or Western blot). The pool of proteins isolated from the agent- contacted sample will be compared with a control sample where only the excipient is contacted with the cells and an increase or decrease in the immunologically generated signal from the "agent-contacted" sample compared to the control will be used to distinguish the effectiveness of the agent.

Another embodiment of the present invention provides methods for identifying agents that modulate at least one activity of a protein(s) encoded by the genes in Tables 2- 8. Such methods or assays may utilize any means of monitoring or detecting the desired activity.

In one format, the relative amounts of a protein of the invention between a cell population that has been exposed to the agent to be tested compared to an un-exposed control cell population may be assayed. In this format, probes such as specific antibodies are used to monitor the differential expression of the protein in the different cell populations. Cell lines or populations are exposed to the agent to be tested under appropriate conditions and time. Cellular lysates may be prepared from the exposed cell line or population and a control, unexposed cell line or population. The cellular lysates are then analyzed with the probe, such as a specific antibody. Probe design

One of skill in the art will appreciate that an enormous number of anay designs are suitable for the practice of this invention. The high density array will typically include a number of probes that specifically hybridize to the sequences of interest. See WO 99/32660 for methods of producing probes for a given gene or genes. In addition, in a prefened embodiment, the array will include one or more control probes.

High density array chips of the invention include "test probes." Test probes may be ohgonucleotides that range from about 5 to about 45 or 5 to about 500 nucleotides, more preferably from about 10 to about 40 nucleotides and most preferably from about 15 to about 40 nucleotides in length. In other particularly prefened embodiments the probes are 20 or 25 nucleotides in length, hi another prefened embodiment, test probes are double or single strand DNA sequences. DNA sequences are isolated or cloned from natural sources or amplified from natural sources using natural nucleic acid as templates. These probes have sequences complementary to particular subsequences of the genes whose expression they are designed to detect. Thus, the test probes are capable of specifically hybridizing to the target nucleic acid they are to detect.

Probes based on the sequences of the genes described herein may be prepared by any commonly available method. Oligonucleotide probes for assaying the tissue or cell sample are preferably of sufficient length to specifically hybridize only to appropriate, complementary genes or transcripts. Typically the oligonucleotide probes will be at least 10, 12, 14, 16, 18, 20 or 25 nucleotides in length, h some cases longer probes of at least 30, 40, or 50 nucleotides will be desirable.

In addition to test probes that bind the target nucleic acid(s) of interest, the high density array can contain a number of control probes. The control probes fall into three categories refened to herein as (1) normalization controls; (2) expression level controls; and (3) mismatch controls.

Normalization controls are oligonucleotide or other nucleic acid probes that are complementary to labeled reference ohgonucleotides or other nucleic acid sequences that are added to the nucleic acid sample. The signals obtained from the normalization controls after hybridization provide a control for variations in hybridization conditions, label intensity, "reading" efficiency and other factors that may cause the signal of a perfect hybridization to vary between arrays, h a prefened embodiment, signals (e.g. , fluorescence intensity) read from all other probes in the anay are divided by the signal (e.g., fluorescence intensity) from the control probes thereby normalizing the measurements.

Virtually any probe may serve as a normalization control. However, it is recognized that hybridization efficiency varies with base composition and probe length. Prefened normalization probes are selected to reflect the average length of the other probes present in the array, however, they can be selected to cover a range of lengths. The normalization control(s) can also be selected to reflect the (average) base composition of the other probes in the array, however in a prefened embodiment, only one or a few probes are used and they are selected such that they hybridize well (i.e., no secondary structure) and do not match any target-specific probes.

Expression level controls are probes that hybridize specifically with constitutively expressed genes in the biological sample. Virtually any constitutively expressed gene provides a suitable target for expression level controls. Typical expression level control probes have sequences complementary to subsequences of constitutively expressed "housekeeping genes" including, but not limited to the β-actin gene, the transferrin receptor gene, the GAPDH gene, and the like.

Mismatch controls may also be provided for the probes to the target genes, for expression level controls or for normalization controls. Mismatch controls are oligonucleotide probes or other nucleic acid probes identical to their conesponding test or control probes except for the presence of one or more mismatched bases. A mismatched base is a base selected so that it is not complementary to the corresponding base in the target sequence to which the probe would otherwise specifically hybridize. One or more mismatches are selected such that under appropriate hybridization conditions (e.g., stringent conditions) the test or control probe would be expected to hybridize with its target sequence, but the mismatch probe would not hybridize (or would hybridize to a significantly lesser extent). Prefened mismatch probes contain a central mismatch. Thus, for example, where a probe is a twenty-mer, a conesponding mismatch probe will have the identical sequence except for a single base mismatch (e.g., substituting a G, a C or a T for an A) at any of positions 6 through 14 (the central mismatch).

Mismatch probes thus provide a control for non-specific binding or cross hybridization to a nucleic acid in the sample other than the target to which the probe is directed. Mismatch probes also indicate whether a hybridization is specific or not. For example, if the target is present the perfect match probes should be consistently brighter than the mismatch probes. In addition, if all central mismatches are present, the mismatch probes can be used to detect a mutation. The difference in intensity between the perfect match and the mismatch probe (I(PM) - I(MM>) provides a good measure of the concentration of the hybridized material.

Nucleic Acid Samples

As is apparent to one of ordinary skill in the art, nucleic acid samples used in the methods and assays of the invention may be prepared by any available method or process. Methods of isolating total mRNA are also well known to those of skill in the art. For example, methods of isolation and purification of nucleic acids are described in detail in Chapter 3 of Laboratory Techniques in Biochemistry and Molecular Biology: Hybridization With Nucleic Acid Probes, Part I Theory and Nucleic Acid Preparation, Tijssen, (1993) (editor) Elsevier Press. Such samples include RNA samples, but also include cDNA synthesized from a mRNA sample isolated from a cell or tissue of interest. Such samples also include DNA amplified from the cDNA, and an RNA transcribed from the amplified DNA. One of skill in the art would appreciate that it is desirable to inhibit or destroy RNase present in homogenates before homogenates can be used.

Biological samples may be of any biological tissue or fluid or cells from any organism as well as cells raised in vitro, such as cell lines and tissue culture cells. Frequently the sample will be a "clinical sample" which is a sample derived from a subject. In some prefened embodiments, subjects may be mammalian, preferably human. Typical clinical samples include, but are not limited to, sputum, blood, blood-cells (e.g., white cells), tissue or fine needle biopsy samples, urine, peritoneal fluid, and pleural fluid, or cells therefrom.

Biological samples may also include sections of tissues, such as frozen sections or formalin fixed sections taken for histological puφoses.

Solid Supports Solid supports containing oligonucleotide probes for differentially expressed genes of the invention can be filters, polyvinyl chloride dishes, silicon or glass based chips, etc. An solid or semi-solid material conventionally used to immobilize nucleic acids may be used. Solid supports containing oligonucleotide probes for differentially expressed genes of the invention can be filters, polyvinyl chloride dishes, sihcon or glass based chips, etc. Such wafers and hybridization methods are widely available, for example, those disclosed by Beattie (WO 95/11755). Any solid surface to which ohgonucleotides can be bound, either directly or indirectly, either covalently or non-covalently, can be used. A prefened solid support is a high density array or DNA chip. These contain a particular oligonucleotide probe in a predetermined location on the array. Each predetermined location may contain more than one molecule of the probe, but each molecule within the predetermined location has an identical sequence. Such predetermined locations are termed features. There maybe, for example, from 2, 10, 100, 1000 to 10,000; 100,000 or 400,000 of such features on a single solid support. The solid support, or the area within which the probes are attached may be on the order of a square centimeter.

Methods of forming high density arrays of ohgonucleotides with a minimal number of synthetic steps are known. The oligonucleotide analogue array can be synthesized on a solid substrate by a variety of methods, including, but not limited to, light-directed chemical coupling, and mechanically directed coupling (see Pirrung et al, (1992) U.S. Patent No. 5J43, 854; Fodor et al, (1998) U.S. Patent No. 5,800,992; Chee et al, (1998) 5,837,832 h brief, the light-directed combinatorial synthesis of oligonucleotide arrays on a glass surface proceeds using automated phosphoramidite chemistry and chip masking tecliniques. In one specific implementation, a glass surface is derivatized with a silane reagent containing a functional group, e.g., a hydroxyl or amine group blocked by a photolabile protecting group. Photolysis through a photolithogaphic mask is used selectively to expose functional groups which are then ready to react with incoming 5' photoprotected nucleoside phosphoramidites. The phosphoramidites react only with those sites which are illuminated (and thus exposed by removal of the photolabile blocking group). Thus, the phosphoramidites only add to those areas selectively exposed from the preceding step. These steps are repeated until the desired array of sequences have been synthesized on the solid surface. Combinatorial synthesis of different oligonucleotide analogues at different locations on the anay is determined by the pattern of illumination during synthesis and the order of addition of coupling reagents.

In addition to the foregoing, additional methods wliich can be used to generate an array of ohgonucleotides on a single substrate are described in Fodor et al, (1993). WO 93/09668. High density nucleic acid arrays can also be fabricated by depositing premade or natural nucleic acids in predetermined positions. Synthesized or natural nucleic acids are deposited on specific locations of a substrate by light directed targeting and oligonucleotide directed targeting. Another embodiment uses a dispenser that moves from region to region to deposit nucleic acids in specific spots.

Hybridization

Nucleic acid hybridization simply involves contacting a probe and target nucleic acid under conditions where the probe and its complementary target can form stable hybrid duplexes through complementary base pairing (see Lockhart et al, (1999) WO 99/32660). The nucleic acids that do not form hybrid duplexes are then washed away leaving the hybridized nucleic acids to be detected, typically through detection of an attached detectable label.

It is generally recognized that nucleic acids are denatured by increasing the temperature or decreasing the salt concentration of the buffer containing the nucleic acids. Under low stringency conditions (e.g., low temperature and/or high salt) hybrid duplexes (e.g., DNA-DNA, RNA-RNA or RNA-DNA) will form even where the annealed sequences are not perfectly complementary. Thus specificity of hybridization is reduced at lower stringency. Conversely, at higher stringency (e.g., higher temperature or lower salt) successful hybridization requires fewer mismatches. One of skill in the art will appreciate that hybridization conditions may be selected to provide any degree of stringency, i a prefened embodiment, hybridization is performed at low stringency, in this case in 6x SSPE-T at 37°C (0.005% Triton x-100) to ensure hybridization and then subsequent washes are performed at higher stringency (e.g., lx SSPE-T at 37°C) to eliminate mismatched hybrid duplexes. Successive washes may be performed at increasingly higher stringency (e.g., down to as low as 0.25x SSPET at 37°C to 50°C until a desired level of hybridization specificity is obtained. Stringency can also be increased by addition of agents such as formamide. Hybridization specificity may be evaluated by comparison of hybridization to the test probes with hybridization to the various controls that can be present (e.g., expression level control, normalization control, mismatch controls, etc.). hi general, there is a tradeoff between hybridization specificity (stringency) and signal intensity. Thus, in a preferred embodiment, the wash is performed at the highest stringency that produces consistent results and that provides a signal intensity greater than approximately 10% of the background intensity. Thus, in a prefened embodiment, the hybridized array may be washed at successively higher stringency solutions and read between each wash. Analysis of the data sets thus produced will reveal a wash stringency above which the hybridization pattern is not appreciably altered and which provides adequate signal for the particular oligonucleotide probes of interest.

Signal Detection

The hybridized nucleic acids are typically detected by detecting one or more labels attached to the sample nucleic acids. The labels may be incoφorated by any of a number of means well known to those of skill in the art (see Lockhart et al, (1999) WO 99/32660).

Databases

The present invention includes relational databases containing sequence information, for instance for the genes of Tables 2-8, as well as gene expression information in various granulocyte-containing samples. Databases may also contain information associated with a given sequence or tissue sample such as descriptive information about the gene associated with the sequence information, or descriptive information concerning the clinical status of the tissue sample, or the subject from which the sample was derived. The database may be designed to include different parts, for instance a sequences database and a gene expression database. Methods for the configuration and construction of such databases are widely available, for instance, see Akerblom et al, (1999) U.S. Patent 5,953,727, which is herein incoφorated by reference in its entirety.

The databases of the invention may be linked to an outside or external database. In a prefened embodiment, as described in Tables 2-8 the external database is GenBank and the associated databases maintained by the National Center for Biotechnology Information (NCBI).

Any appropriate computer platform may be used to perform the necessary comparisons between sequence information, gene expression information and any other information in the database or provided as an input. For example, a large number of computer workstations are available from a variety of manufacturers, such has those available from Silicon Graphics. Client-server environments, database servers and networks are also widely available and appropriate platforms for the databases of the invention.

The databases of the invention maybe used to produce, among other things, electronic Northerns to allow the user to determine the cell type or tissue in which a given gene is expressed and to allow determination of the abundance or expression level of a given gene in a particular tissue or cell.

The databases of the invention may also be used to present information identifying the expression level in a tissue or cell of a set of genes comprising at least one gene in Tables 2-8 comprising the step of comparing the expression level of at least one gene in Tables 2-8 in the tissue to the level of expression of the gene in the database. Such methods may be used to predict the physiological state of a given tissue by comparing the level of expression of a gene or genes in Tables 2-8 from a sample to the expression levels found in tissue from normal liver, malignant liver or hepatocellular carcinoma. Such methods may also be used in the drug or agent screening assays as described below. Without further description, it is believed that one of ordinary skill in the art can, using the preceding description and the following illustrative examples, make and utilize the compounds of the present invention and practice the claimed methods. The following working examples therefore, specifically point out the preferred embodiments of the present invention, and are not to be construed as limiting in any way the remainder of the disclosure.

EXAMPLES

Example 1: Preparation of Cells

Expression profiles of RNA expression levels from neutrophils exposed to various pathogens, in particular, bacteria offer a powerful means of identifying genes that are specifically regulated in response to infection. As an example, the production of expression profiles from neutrophils exposed to E. coli and Y. pestis allow the identification of neutrophil genes that are specifically regulated in response to bacterial infection. Neutrophils may be isolated from normal donor peripheral blood following any protocol known to those skilled in the art. The LPS-free method of isolation is described below. Peripheral blood is isolated using a butterfly needle and a syringe containing 5 cc ACD, 5 cc of 6% Dextran (in normal saline). After 30 minutes of settling, plasma is collected and HBSS (without Ca^"*^""1" or Mg") is added to a total volume of 40 ml. The plasma was centrifuged (1500 φm, for 15 m at 4°C), the supernatant decanted and cold HBSS added to resuspend the cells. The cell suspension was then layered onto a cold Ficoll Hypaq, centrifuged at 500xg for 30m at 4°C. The pellet contains polymoφhonuclear neutrophils. Neutrophils can also be isolated by other commonly used methods such as those disclosed in Current Protocols of Immunology (John Wiley & Sons, Inc.), Babior et al. (1981) ϊn:Leokocyte Function, Cline, MJ. Εd., p.1-38 (Church Livingstone, NY), and Haslett et al. (1985) Am. J. Pathol. 119:101-110.

Following isolation, neutrophils were incubated with E. coli or one of three strains of 7. pestis ypoH, KTM5 or KIM6 for 30 minutes or two hours and then total RNA was isolated using a standard guanidine«HCl method. Before incubation, bacteria are harvested and washed in phosphate buffered saline and opsonized with either autologous human serum or complement factor C7 deficient human serum (SIGMA). Incubation was at a ratio of approximately a PMN:bacteria ratio of 1 :20 in RPMI 1640 (HΕPΕS buffered) with heat inactivated Fetal Bovine Serum at 37°C with gentle mixing in a rotary shaker bath.

As controls, neutrophils were incubated with either bacterial lipopolysaccharide (LPS) or latex beads. LPS was added to approximately 3.38 x 10⁸ cells in 100 ml of RPMI containing 6% autologous serum to a final concentration of 1 ng/ml to 1 μg/1. Incubation proceeded for two hours with gentle rotation in disposable polycarbonate Εrlenmeyer flasks at 37°C. After incubation, the cells were spun down and washed once with HBSS and frozen until RNA isolation.

The neutrophils extracted from blood were examined for purity by flow microfluorometry. Preparations with >0.5% monocytes contamination were rejected. Samples of mRNA were later examined for specific expression markers for induced monocytes to bacterial exposure. The neutrophils were cultured with the non-pathogenic bacteria, E. coli, or three pathogenic strains of Yersinia pestis, KTM5, KIM6, and yopH (Perry et al.(1991) Clin. Microbiology Reviewsl0(l):35-66), respectively, and after 2 hours total RNA was extracted by the standard guanidine«HCl method.

Example 2; Sample Preparation for DNA Chip Analysis

The total RNA was processed for the Affymetrix oligonucleotide GeneChip microarrays following Affmetrix's protocol. The final product, cRNA, was hybridized on the 42K array set (a combination of the full-length genes and EST's) and the HuGU95A array, containing ~12,000 full length known genes. The data was analyzed to determine present/absent calls, gene expression levels, and expression differences. A gene identified as present or absent has been calculated by an algorithm in the Affymetrix analysis software. Gene expression levels have been measured as average differences. Gene expression changes have been calculated as the ratios of the expressed genes in uninduced/induced neutrophils. Expression differences with a ratio of ± > 3 fold have been analyzed.

With minor modifications, the sample preparation protocol followed the Affymetrix GeneChip Expression Analysis Manual. Frozen cells were first ground to powder using the Spex Certiprep 6800 Freezer Mill. Total RNA was then extracted using Trizol (Life Technologies). The total RNA yield for each sample (average tissue weight of 300 mg) was 200-500 μg. Next, mRNA was isolated using the Oligotex mRNA Midi kit (Qiagen). Since the mRNA was eluted in a final volume of 400 μl, an ethanol precipitation step was required to bring the concentration to 1 μg/μl. Using 1-5 μg of mRNA, double stranded cDNA was created using the Superscript Choice system (Gibco- BRL). First strand cDNA synthesis was primed with a T7-(dT ₄) oligonucleotide. The cDNA was then phenol-chloroform extracted and ethanol precipitated to a final concentration of 1 μg/μl. From 2 μg of cDNA, cRNA was synthesized using Ambion' s T7 MegaScript in vitro Transcription Kit. To biotin label the cRNA, nucleotides Bio-11-CTP and Bio- 16- UTP (Enzo Diagnostics) were added to the reaction. After a 37°C incubation for six hours, the labeled cRNA was cleaned up according to the Rneasy Mini kit protocol (Qiagen). The cRNA was then fragmented (5x fragmentation buffer: 200 mM Tris- Acetate (pH 8.1), 500 mM KOAc, 150 mM MgOAc) for thirty-five minutes at 94°C.

As per the Affymetrix protocol, 55 μg of fragmented cRNA was hybridized on the human 42K set and the HuGU95A array for twenty-four hours at 60 rpm in a 45°C hybridization oven. The chips were washed and stained with Streptavidin Phycoerythrin (SAPE) (Molecular Probes) in Affymetrix fluidics stations. To amplify staining, SAPE solution was added twice with an anti-streptavidin biotinylated antibody (Vector

Laboratories) staining step in between. Hybridization to the probe arrays was detected by fluorometric scanning (Hewlett Packard Gene Array Scanner). Following hybridization and scanning, the microanay images were analyzed for quality confrol, looking for major chip defects or abnormalities in hybridization signal. After all chips passed QC, the data was analyzed using Affymetrix GeneChip software (v3.0), and Experimental Data Mining Tool (EDMT) software (vl.O).

All samples were prepared as described and hybridized onto the Affymetrix HuGU95A anay, which represents nearly 12,000 full length human genes, and the Human 42K set of anays (a combination of ESTs and full length genes). Each chip contains 16-20 oligonucleotide probe pairs per gene or cDNA clone. These probe pairs include perfectly matched sets and mismatched sets, both of which are necessary for the calculation of the average difference. The average difference is a measure of the intensity difference for each probe pair, calculated by subtracting the intensity of the mismatch from the intensity of the perfect match. This takes into consideration variability in hybridization among probe pairs and other hybridization artifacts that could affect the fluorescence intensities. Using the average difference value that has been calculated, the GeneChip software then makes an absolute call for each gene or EST.

Example 3: Gene Expression Analysis

1182 genes have been identified to be present in the uninduced neutrophils. In neutrophils exposed to bacteria, the number of genes present generally decreased, hi neutrophils exposed to E. coli 819 genes were called present. In neutrophils exposed to 7. pestis strain yopH 698 genes were identified and those exposed to strain KIM5 expressed 696 genes, hi contrast, neutrophils exposed to KIM6 expresssed 1258 genes (Table 1).

A comparison of the genes called present in the three 7. pestis exposed neutrophil populations identified 526 genes as present in all three. 192 genes were switched on or off, with 121 of those with a ratios > 3. A comparison of all four bacteria-exposed neutrophil populations identified 428 genes that were called present in both E. coli and the three 7. pestis induced neutrophils. A number of genes were identified by the comparison of the different induction conditions. Fourteen genes were called absent in uninduced neutrophils and present in all bacteria-exposed neutrophils (Table 2). Twelve genes were called absent in uninduced neutrophils and E. coli exposed neutrophils, and present in the three Y. pestis strains exposed neutrophils (Table 3) and thus were specifically induced by contact with 7. pestis. 135 genes were called absent in uninduced neutrophils, present in E. coli exposed neutrophils, and showed variable expression in the three different 7. pestis exposed neutrophils (Table 4).

123 genes were called present in uninduced neutrophils, absent in all bacteria- exposed neutrophils (Table 5).

47 genes were called present in both uninduced neutrophils and bacteria-exposed neutrophils and showed varying expression level in the bacteria-exposed neutrophils. (Table 6).

Analyzing genes that match up in all four induction experiments revealed a set of genes that play an important role in bacterial exposure. Four genes with an increase in expression level in the bacteria-exposed neufrophils have been identified. TRAF3 (TNF receptor-associated factor 3) has been linked to cell growth and death signal pathways (Mosialos et al. (1995) Cell 80:389-399). Dual specificity phosphatase 2 (DUSP2) encodes a nuclear protein, PAC1, that is stringent for MAP kinase. MAP phosphorylation and subsequent activation are important for signal fransduction of growth factors. DUSP2 down regulates intracellular signal fransduction through the dephosphorylation of MAP kinases.

Solute carrier family & (cationic amino acid transporter, y+ system), member 5 (SLC7A5) has been shown to be up regulated in induced myeloid and lymphoid cells, it is a membrane protein connected with membrane transportation (Mastroberardino et al. (1998) Nature 395:288-91). GRO2 gene encodes a cytokine involved with inflammatory response and growth regulation (Haskill et al. (1990) Proc. Natl Acad. Sci. 87 '-.1132-1136).

Three genes (see Table 3) were up regulated in neutrophils exposed to 7 pestis but not in neutrophils exposed to E. coli cyclin-dependent kinase inhibitor lA(p21, Cipl) (CDKΝ1 A), CD44 antigen (CD44) and tumor suppressing subtransferable (TSSC3). Cyclin-dependent kinase inhibitor lA(p21, Cipl) (CDKΝ1A), is an inhibitor of Gl cyclin-dependent kinases (Εl-Deiry et al. (1993) Cell 75:817-825).

CD44 antigen (CD44) is up regulated in induced lymphoblastoid cell line, KCA (Εl-Deiry et al (1993) Cell 75:817-825).

Colony stimulating factor 3 (granulocyte) (CSF3) has been identified in haematopoietic cell proliferation and differentation (Dougherty et al. (1991) J. Exp. Med 174: 1-5). Pentaxin-related gene, rapidly induced by IL-1 beta (PTX3) is an inflammatory cytokine identified in stimulated fibroblast cell lines (Souza et al. (1986) Science 232:61- 65). Nuclear factor (erythroid-derived 2), 45kD (NFE2) has been identified in hematopoietic cell lines (Lee et al. (1992) J. Cell Biol. 116:545-557). hitegrin, beta 2 (antigenCDlδ (p95), lymphocyte function-associated antigen 1; macrophage antigen 1 (mac-1) beta subunit) (ITGB2) has been identified with cell surface signaling (Pischedda et al. (1995) Proc. Natl Acad. Sci. 92:3511-3515).

A complete list of all genes identified in bacteria-exposed neutrophils is presented in Table 7. The table also provides the ratio of the expression observed in the bacteria- exposed neutrophils to the expression level in quiescent neutrophils.

Genes differentially expressed in quiescent neutrophils as compared to neutrophils exposed to bacteria are genes that are responsive to an induction from various sources.

The genes discussed are genes that are specific to cellular induction. Genes not expressed in E. coli exposed neutrophils but expressed in 7 pestis exposed neutrophils are genes which may make the cell susceptible to infection. The 7. pestis bacterium is pathogenic triggering gene expression of genes that inhibit the phagocytic response in neutrophils. Genes expressed in E. coli but not in 7 pestis exposed neutrophils provide another set of genes that are affected by the pathogenic capacity of 7 petis. The genes that were down regulated when neutrophils were exposed to bacteria are genes involved in progression of cell development. One of the many neutrophilic responses to bacteria is the suppression of genes involved in normal cell cycle, this allows the cell to respond to the infection. The identity of the genes in Tables 2-8 allow one skilled in the art to select an appropriate set of genes in order to assay for exposure to a specific bacterium or strain, hi addition those skilled in the art can select an appropriate gene set from the list of affected genes to conduct assays for agents that modulate the activation response of bacteria- exposed neutrophils. Table 1 shows that a large number of genes are affected in a short amount of time (two hours or less). This quick and complex response is consistent to the nature of neutrophils and the expected response in vivo. The present invention has identified numerous genes that were not previously known to be involved in the neutrophil response to bacterial contact. The present invention also allows the selection of gene sets specific to different strains of bacteria.

Example 4: Gene Expression Analysis Using Restriction Enzyme Analysis of Differentially Expressed Sequences

Ten micrograms of total RNA, the amount obtainable from about 3xl0⁶ neutrophils, is sufficient for a complete set of cDNA expression profiles.

Synthesis of cDNA was performed as previously described by Prashar et al. in WO 97/05286 and in Prashar et al. (1996) Proc. Natl. Acad. Sci. USA 93:659-663. Briefly, cDNA was synthesized according to the protocol described in the GIBCO/BRL kit for cDNA synthesis. The reaction mixture for first-strand synthesis included 6 μg of total RNA, and 200 ng of a mixture of 1-base anchored oligo(dT) primers with all three possible anchored bases.

(ACGTAATACGACTCACTATAGGGCGAATTGGGTCGACTTTTTTTTTTTTTTTTT V wherein V=A or C or G, SEQ ID NO: 1373) along with other components for first- strand synthesis reaction except reverse transcriptase. This mixture was incubated at 65°C for 5 minutes, chilled on ice and the process repeated. Alternatively, the reaction mixture may include lOμg of total RNA, and 2 p ol of 1 of the 2-base anchored oligo(dT) primers such as RP5.0 (CTCTCAAGGATCTTACCGCT(T)₁₈AT, SEQ ID NO: 1374), or RP6.0 (TAATACCGCGCCACATAGCA(T)₁₈CG, SEQ ID NO: 1375), or RP9.2 (CAGGGTAGACGACGCTACGC(T)₁₈GA, SEQ ID NO: 1376) along with other components for first-strand synthesis reaction except reverse transcriptase. This mixture was then layered with mineral oil and incubated at 65 °C for 7 min followed by 50 °C for another 7 min. At this stage, 2 μl of Superscript reverse transcriptase (200 units/ μl; GIBCO/BRL) was added quickly and mixed, and the reaction continued for 1 hr at 45-50 °C. Second-strand synthesis was performed at 16 °C for 2 hr. At the end of the reaction, the cDNAs were precipitated with ethanol and the yield of cDNA was calculated, h our experiments, 200 ng of cDNA was obtained from 10 μg of total RNA.

The adapter oligonucleotide sequences were Al (TAGCGTCCGGCGCAGCGACGGCCAG, SEQ ID NO: 1377) and A2 (GATCCTGGCCGTCGGCTGTCTGTCGGCGC, SEQ ID NO: 1378). One microgram of oligonucleotide A2 was first phosphorylated at the 5' end using T4 polynucleotide kinase (PNK). After phosphorylation, PNK was heated denatured, and 1 μg of the oligonucleotide Al was added along with 10X annealing buffer (1 M NaCl/100 mM Tris-HCl, ρH8.0/10 mM EDTA, pH8.0) in a final vol of 20 μl. This mixture was then heated at 65 °C for 10 min followed by slow cooling to room temperature for 30 min, resulting in formation of the Y adapter at a final concentration of 100 ng/ μl. About 20 ng of the cDNA was digested with 4 units of Bgl II in a final vol of 10 μl for 30 min at 37 °C. Two microliters ( 4 ng of digested cDNA) of this reaction mixture was then used for ligation to 100 ng ( 50-fold) of the Y-shaped adapter in a final vol of 5 μl for 16 hr at 15 °C. After ligation, the reaction mixture was diluted with water to a final vol of 80 μl (adapter ligated cDNA concentration, 50 pg/μl) and heated at 65 °C for 10 min to denature T4 DNA ligase, and 2 μl aliquots (with 100 pg of cDNA) were used for PCR. The following sets of primers were used for PCR amplification of the adapter ligated 3 '-end cDNAs:

TGAAGCCGAGACGTCGGTCG(T)ι₈VN (wherein V = A or C or G, N = A or C or G or T; SEQ ID NO: 1379) as the 3' primer with Al as the 5' primer or alternatively RP 5.0, RP 6.0, or RP 9.2 were used as 3'- primers with primer A1J serving as the 5' primer. To detect the PCR products on the display gel, 24 pmol of oligonucleotide Al or Al.l was 5 '-end-labeled using 15 μl of [γ -³² P]ATP (Amersham; 3000 Ci/mmol) and PNK in a final volume of 20 μl for 30 min at 37 C. After heat denaturing PNK at 65 °C for 20 min, the labeled oligonucleotide was diluted to a final concentration of 2 μM in 80 μl with unlabeled oligonucleotide AIJ. The PCR mixture (20 μl) consisted of 2 μl ( 100 pg) of the template, 2 μl of 10X PCR buffer (100 mM Tris-HCl, pH 8.3/500 mM KCl), 2 μl of 15 mM MgCl₂ to yield 1.5 mM final Mg²⁺ concentration optimum in the reaction mixture, 200 M dNTPs, 200 nM each 5' and 3' PCR primers, and 1 unit of Amplitaq Gold. Primers and dNTPs were added after preheating the reaction mixture containing the rest of the components at 85 °C. This "hot start" PCR was done to avoid amplification artifacts arising out of arbitrary annealing of PCR primers at lower temperature during transition from room temperature to 94 °C in the first PCR cycle. PCR consisted of 5 cycles of 94 °C for 30 sec, 55 °C for 2 min, and 72 °C for 60 sec followed by 25 cycles of 94 °C for 30 sec, 60 °C for 2 min, and 72 °C for 60 sec. A higher number of cycles resulted in smeary gel patterns. PCR products (2.5 μl) were analyzed on 6% polyacrylamide sequencing gel. For double or multiple digestion following adapter ligation, 13.2 μl of the ligated cDNA sample was digested with a secondary restriction enzyme(s) in a final vol of 20 μl. From this solution, 3 μl was used as template for PCR. This template vol of 3 μl carried 100 pg of the cDNA and 10 mM MgCl₂ (from the 10X enzyme buffer), which diluted to the optimum of 1.5 mM in the final PCR vol of 20 μl. Since Mg²⁺ comes from the restriction enzyme buffer, it was not included in the reaction mixture when amplifying secondarily cut cDNA. Bands were extracted from the display gels as described by Liang et al. (1995 Curr. Opin. Immunol. 7:274-280), reamplified using the 5' and 3' primers, and subcloned into pCR-Script with high efficiency using the PCR-Script cloning kit from Stratagene. Plasmids were sequenced by cycle sequencing on an ABI automated sequencer.

A comparison of quiescent neutrophils to bacteria-exposed neutrophils identified numerous genes with altered expression levels. Table 8 lists the genes identified by this technology.

Without further description, it is believed that one of ordinary skill in the art can, using the preceding description and the following illustrative examples, make and utilize the compounds of the present invention and practice the claimed methods. The following working examples therefore, specifically point out the prefened embodiments of the present invention, and are not to be construed as limiting in any way the remainder of the disclosure. All patents, patent applications and references refened to in this application are herein incoφorated by reference in their entirety.

Table 1. The number of present genes.

Table 2. Selected genes that are called absent in neutrophils and called present in bacteria exposed neutrophils.

*EGR1 was called absent in KIM6

Call for Call for Call for Call for Call for ratio ratio ratio ratio

Genbank Seq ID Gene name Symbol neutrophil E.coli K1 5 KI 6 yopH E.coli KIM5 KIM6 yopH

L11329 394 Dual specificity phosphatase 2 DUSP2 A P P P P 78.8 151.4 147.4 44.6 Protease inhibitor 8 (ovalbumin

L40377 465 type) PI8 A P P P P 3.1 33.4 21.5 17.2

M36820 589 GR02 oncogene GR02 A P P P P 119.6 114.1 252.0 66.0

M63978 634 Vascular endothelial growth factor VEGF A P P P P 8.0 203.5 298.4 191.3 Solute carrier family 7(cationic amino acid transporter,

M80244 654 y+system), member 5 SLC7A5 A P P P P 39.7 61.6 46.2 30.1 Nuclear receptor subfamily 4,

U 12767 800 group A, member 3 NR4A3 A P P P P 4.1 49.9 63.1 45.4

U19261 826 TNF receptor-associated factor 3 TRAF3 A P P P P 27.4 20.7 8.9 10.8

Small inducible cytokine subfamily

U64197 964 A (Cys-Cys), member 20 SCYA20 72.0 50.3 57.9 13.2

Nuclear factor of kappa light polypeptide gene enhancer in B-

U91616 1047 cells inhibitor, epsilon NFKBIE A P P P P 8.1 69.0 37.7 51.4 X52541 1133 Early growth response 1 EGR1 A P A* P P 30.5 9.8 12.8 16.4

Pleckstrin homology-like domain,

Z50194 1358 family A, member 1 PHLDA1 A 27.9 24.0 16.4 8.5

Table 3. Selected genes called absent in neutrophils and E. coli exposed neutrophils and present in Y. pestis exposed neutrophils.

Call Call Call

Call for Call for for for for ratio ratio ratio ratio

Genbank Seq lD Gene name Symbol neutrophil E.coli KIM5 KIM6 yopH E.coli KIM5 KIM6 yopH

AF001294 37 Tumor suppressing subransferable candidate 3 TSSC3 A A P P P 2.6 46.2 34.0 13.1 CD44 antigen (homing function and Indian blood

M59040 614 group system) CD44 A A P P P 4.4 49.3 56.4 33.0

U03106 758 Cyclin-dependent kinase inhibitor 1A(p21 , Cipl) CDKN1 A A A P P P 5.4 55.5 53.5 30.7

Table 4. Selected genes called absent in neutrophils and called present in E. coli exposed neutrophils.

Call for Call for Call for Call for Call for ratio ratio ratio ratio

Genbank Seq ID Gene name Symbol neutrophil E.coli KIM5 KIM6 yopH E.coli KIM5 KIM6 yopH

N-acetyltransferase2 (arylamine N-

D90042 312 acetyltransferase) NAT2 A P A A A 13.3 7.0 -15 1.0

L19871 422 Activating transription factor 3 ATF3 A P A A A 10.8 1.0 3.3 3.9 Pentaxin-related gene, rapidly induced by IL-

M31166 561 1 beta PTX3 A P P P A 11.3 10.9 6.1 3.3

U26403 848 Ephrin-A5 EFNA5 A P A A A 13.3 3.1 1.0 1.1

Human clone 121711 defective mariner

U92014 1050 transposon Hsmar2 mRNA sequence A P A P A 11.7 1.0 2.7 1.0

X03656 1071 Colony stimulating factor 3 (granulocyte) CSF3 A P A A A 16.4 -4.0 -4.0 -4.0

X52213 1131 Leukocyte tyrosine kinase LTK A P A A A 11.8 6.4 3.4 6.2 Biphenylhydrolase-like (serine hydrolase;

X81372 1257 breast epithelial mucin-associated antigen) BPHL A A A 11.1 13.5 3.0 3.4

ABO blood group (transferase A. alph 1-3-N- acetylgalactosaminyltransferase; transferase

X84746 1265 B, alpha 1-3-galactosyltransferse) ABO A 10.0 7.0 4.1 4.7

Table 5. Selected genes that are called present in neutrophils and are either called absent or present in bacteria exposed neutrophils.

Call for Call for Call for Call for Call for ratio ratio ratio ratio

Genbank Seq ID Gene name Symbol neutrophil E.coli KIM5 KIM6 yopH E.coli KIM5 KI 6 yopH

AF000152 34 OS-4 protein P A A A A -25.5 -66.8 -66.8 -66.8 D13640 167 KIAA0015 gene product P A A A A -62.4 -39.7 -9.1 -3.0

DiGeorge syndrome critical region gene

D79985 270 2 DGCR2 A A A -2.0 -42.1 -42.1 -42.1

Nuclear factor (erythroid-derived 2),

S77763 731 45kD NFE2 A A A A -3.0 -90.4 -90.4 -22.4

Table 6. Selected genes that are called present in all conditions.

Call for Call for Call for Call for Call for ratio ratio ratio ratio

Genbank Seq ID Gene name Symbol neutrophil E.coli KIM5 KI 6 yopH E.coli KI 5 KIM6 yopH

D14874 178 Adrenomedullin ADM P P P P P 2.3 5.5 4.2 2.5

L20941 424 Ferritin, heavy polypeptide 1 FTH1 P P P P P 3.2 4.0 1.1 3.6

Integrin, beta 2 (antigenCD18 (p95), lymphocyte function-associated antigen 1;

M 15395 505 macrophage antigen 1 (mac-1) beta subunit) ITGB2 P P P P P -5J -4.0 -3.5 -4.2

X17042 1118 Proteoglycan 1 , secretory granule PRG1 P P P P P 1.9 4.4 3.2 1.9

Table 7. Genes identified by DNA chip analysis.

ratio ratio ratio ratio

Affy ID Genbank Seq ID Gene Bank Names E.coli KIM5 KIM6 yopH zk72a10.s1 Soares_pregnant_uterus_NbHPU Homo sapiens cDNA clone IMAGE:488346

39830_at AA044823 3' similar to gb:L19527 60S RIBOSOMAL PROTEIN L27 (HUMAN);, mRNA sequence. -1.3 -1.5 -2.3 -9.0 zn31a06.s1 Stratagene endothelial cell 937223 Homo sapiens cDNA clone IMAGE:549010

3' similar to gb:L25085 PROTEIN TRANSPORT PROTEIN SEC61 BETA SUBUNIT

32564_at AA083129 (HUMAN);, mRNA sequence. -6.5 -9.8 -1.8 -2.4 zo16d05.r1 Stratagene colon (#937204) Homo sapiens cDNA clone IMAGE:587049 5'

34319_at AA131149 similar to gb:X65614 SJ00P PROTEIN (HUMAN);, mRNA sequence. 1.2 1.9 1.5 1.2 zx57e04.r1 Soares_fetalJiver_spleen_ 1NFLS_S1 Homo sapiens cDNA clone

IMAGE:446622 5' similar to gb:M13755 INTERFERON-INDUCED 17 KD PROTEIN

38432 at AA203213 (HUMAN);, mRNA sequence. -2.0 J9.2 -19.2 -19.2 zv98d05.r1 Soares_NhHMPu_S1 Homo sapiens cDNA clone IMAGE:767817 5' similar to

SW:RPB6_HUMAN P41584 DNA-DIRECTED RNA POLYMERASE II 14.4 KD

36027_at AA418779 5 POLYPEPTIDE ;, mRNA sequence. 1.2 -1.3 -2.0 -1.6 nf38c11.s1 NCI_CGAP_Pr2 Homo sapiens cDNA clone IMAGE:916052 similar to

39581_at AA570193 6 gb:X05978 CYSTATIN A (HUMAN);, mRNA sequence. -1.1 3.4 -1.5 2.3 nz82h06.s1 NCI_CGAP_GCB1 Homo sapiens cDNA clone IMAGE:1302011 3' similar to gb:M94556 SINGLE-STRANDED DNA-BINDING PROTEIN MITOCHONDRIAL

39086_g_at AA768912 7 PRECURSOR (HUMAN);, mRNA sequence. 1.4 2.0 -1.2 -3.0 nw16h03.s1 NCI_CGAP_GCB0 Homo sapiens cDNA clone IMAGE:1240661 3' similar to

38287_at AA808961 8 gb:Z14977_rna1 PROTEASOME CHAIN 7 (HUMAN);, mRNA sequence. -2.3 -1.8 -2.6 -2.5 oh79b10.s1 NCI_CGAP_Kid3 Homo sapiens cDNA clone IMAGE.1473211 3' similar to

36347_f_at AA873858 9 gb:X57138_ma1 HISTONE H2B.2 (HUMAN);, mRNA sequence. -1.0 1.2 -1.1 1.0 oo67b04.s1 NCI_CGAP_GC4 Homo sapiens cDNA clone IMAGEJ571215 3' similar to gb:M54911_rna1 IG HEAVY CHAIN PRECURSOR V-ll REGION (HUMAN);, mRNA

35607_at AA934573 10 sequence. 2.8 1.0 1.0 1.0 oq35c12.s1 NCI_CGAP_GC4 Homo sapiens cDNA clone IMAGE: 1588342 3' similar to

41764_at AA976838 11 gb:X00570 APOLIPOPROTEIN C-l PRECURSOR (HUMAN);, mRNA sequence. 2.5 1.2 1.0 1.0 oq25a04.s1 NCI_CGAP_GC4 Homo sapiens cDNA clone IMAGEJ 587342 3' similar to

33116 f at AA977163 12 gb:X5350540S RIBOSOMAL PROTEIN S12 (HUMAN);, mRNA sequence. 1.2 -1.7 -1.3 -2.9

Table 7. Genes identified by DNA chip analysis.

ratio ratio ratio ratio

Affy ID Genbank Seq ID Gene Bank Names E.coli KI 5 KIM6 yopH oq25a04.s1 NCI_CGAP_GC4 Homo sapiens cDNA clone 1MAGE:1587342 3' similar to

33117 r at AA977163 12 gb:X53505 40S RIBOSOMAL PROTEIN S12 (HUMAN);, mRNA sequence. 1.2 -17.0 -13 -3.9 oq55e04.s1 NCI_CGAP_Kid5 Homo sapiens cDNA clone IMAGE:1590270 3' similar to gb:X15822 CYTOCHROME C OXIDASE POLYPEPTIDE VIIA-LIVER PRECURSOR

41760_at AA978033 13 (HUMAN);, mRNA sequence. -1.5 1.5 -1.3 -1.1

378_s_at AB000381 14 Homo sapiens DNA for GPI-anchored molecule-like protein, complete cds. 5.1 1.0 1.0 1.0

32180_s_at AB000461 16 Homo sapiens mRNA, complete cds, clone:RES4-22C. 1.3 1.9 1.0 -2.8

35777_at AB000468 17 Homo sapiens mRNA for zinc finger protein, complete cds, clone:RES4-26. 1.8 J3.9 -13.9 -13.9

32801 _at AB002315 18 Human mRNA for KIAA0317 gene, complete cds. -1.4 2.2 1.2 -6.6

32487_s_at AB002533 19 Homo sapiens mRNA for Qip1 , complete cds. -2.0 -1.6 -18 -1.8

38259_at AB002559 20 Homo sapiens mRNA for hunc18b2, complete cds. 1.1 -1.4 -2.1 -1.6

32775_r_at AB006746 21 Homo sapiens hMmTRAIb mRNA, complete cds. -10.5 1.2 2.4 1.4

766_at AB006782 22 Homo sapiens mRNA for galectin-9 isoform, complete cds. -1.5 -36.1 -19 -4.4

31936_s_at AB007890 23 Homo sapiens mRNA for KIAA0430 protein, partial cds. -44.6 -3.7 -5.0 -5.8

32335_r_at AB009010 24 Homo sapiens mRNA for polyubiquitin UbC, complete cds. -1.5 2.7 -6.1 2.8

38735_at ABO 11085 25 Homo sapiens mRNA for KIAA0513 protein, complete cds. -11.0 -2.3 -2.5 -3.5

38809_s_at AB011091 26 Homo sapiens mRNA for KIAA0519 protein, complete cds. -13.2 -2.4 -2.8 -2.0

36623_at ABO 11406 27 Homo sapiens mRNA for alkalin phosphatase, complete cds. -1.2 -1.9 -3.1 -2.1

4-1193_at AB013382 28 Homo sapiens mRNA for DUSP6, complete cds. 2.5 6.5 2.3 1.0

36231_at AC002073 30 #N/A 1.0 1.9 1.1 -2.7

31676 at AC003973 31 Homo sapiens DNA from chromosome 19, BAC 33152, complete sequence. 3.4 1.0 1.0 1.0

32901 _s_at AC005192 32 Homo sapiens BAC clone CTB-163K11 from 7q31 , complete sequence. -7.8 -2.4 -2.0 -2.2

32490_at AC005955 33 Homo sapiens chromosome 19, cosmid R32065, complete sequence. -3.9 -1.4 -2.4 -1.8

41202_s_at AF000152 34 Homo sapiens OS-4 protein (OS-4) mRNA, complete cds. -25.5 -66.8 -66.8 -66.8

37967_at AF000424 35 Homo sapiens LST1 mRNA, cLST1/C splice variant, complete cds. -1.1 -18 -2.9 -19

38110_at AF000652 36 Homo sapiens syntenin (sycl) mRNA, complete cds. - 2 1.6 1.4 -1.1

31888_s_at AF001294 37 Homo sapiens IPL (IPL) mRNA, complete cds. 2.6 46.2 34.0 13.1

39688_at AF001433 38 Human requiem (HREQ) mRNA, complete cds. -10 -29.3 15 2.0

41819 at AF001862 40 Homo sapiens FYN binding protein mRNA, complete cds. 1.2 -3.3 -4.6 -14.9

36172 s at AF002163 41 Homo sapiens delta-adaptin mRNA, complete cds. -5.0 -1.7 12 11

Table 7. Genes identified by DNA chip analysis.

ratio ratio ratio ratio

Affy ID Genbank Seq ID Gene Bank Names E.coli KIM5 KIM6 yopH

Homo sapiens monocyte/macrophage Ig-related receptor MIR-7 (MIR cl-7) mRNA,

35926 s at AF004230 42 complete cds. 1.1 -1.9 -2.1 -1.8

337 at AF005043 43 Homo sapiens poly(ADP-ribose) glycohydrolase (hPARG) mRNA, complete cds. 9.7 1.0 1.0 1.0

38270 at AF005043 43 Homo sapiens poly(ADP-ribose) glycohydrolase (hPARG) mRNA, complete cds. 9.7 1.0 1.0 1.0

39997_at AF005664 44 Homo sapiens properdin (PFC) gene, complete cds. -1.5 -2.2 -2.8 -2.5

Homo sapiens caspase-like apoptosis regulatory protein 2 (clarp) mRNA, alternatively

1867_at AF005775 45 spliced, complete cds. 4.0 2.0 13 1.1

Homo sapiens caspase-like apoptosis regulatory protein (clarp) mRNA, alternatively

1868 g at AF005775 45 spliced, complete cds. 4.0 1.6 1.5 1.1

34691 f at AF006087 47 Homo sapiens Arp2/3 protein complex subunit p20-Arc (ARC20) mRNA, complete cds. -1.1 1.9 1.5 1.1

34692 r at AF006087 47 Homo sapiens Arp2/3 protein complex subunit p20-Arc (ARC20) mRNA, complete cds. -11 1.2 -11 1.5

40045_g_at AF009425 48 Homo sapiens clone 22 mRNA, alternative splicing variant alpha-2, complete cds. 1.0 19.7 3.0 1.9

37311 at AF010400 50 Homo sapiens transaldolase-related protein gene, exons 3-8 and complete cds. -1.8 -2.8 -4.0 -2.9

31408 at AF012270 51 Homo sapiens visual pigment-like receptor peropsin (Rrh) mRNA, complete cds. 3.2 1.2 4.5 9.7

33689_s_at AF012434 52 Homo sapiens D-dopachrome tautomerase (DDT) gene, exon 3 and complete cds. 12 -3.8 -3.8 2.2 Homo sapiens cytochrome c oxidase subunit IV precursor (COX4) gene, nuclear gene

39027 at AF017115 53 encoding mitochondrial protein, complete cds. 1.1 -1.4 -6.9 -2.2

32810 at AF019369 54 Human thiopurine methyltransferase (TPMT) gene, exon 10 and complete cds. 6.7 2.9 17 2.4

38974 at AF021819 55 Homo sapiens RNA-binding protein regulatory subunit mRNA, complete cds. -3.5 -4.0 -4.0 -3.6

35094_f_at AF025527 56 Homo sapiens leucocyte immunoglobulin-like receptor-4 (LIR-4) mRNA, complete cds. -2.2 -2.4 -2.3 -2.2

35095 r at AF025527 56 Homo sapiens leucocyte immunoglobulin-like receptor-4 (LIR-4) mRNA, complete cds. -2.2 -1.3 J5.6 -1.3

38584 at AF026939 58 Homo sapiens C1G49 (cig49) mRNA, complete cds. -5.7 -4.0 -6.4 -10.2

34481 at AF030227 59 Homo sapiens vav proto-oncogene, exon 27, and complete cds. -1.4 -1.3 -2.4 -1.3

36417_s_at AF035295 60 Homo sapiens clone 23623 mRNA, partial cds. -5.3 -1.3 -1.3 -1.4

Homo sapiens neuroblastoma apoptosis-related RNA binding protein (NAPOR-1) mRNA,

32851 at AF036956 61 complete cds. -1.1 -18.7 -18.7 -18.7

Table 7. Genes identified by DNA chip analysis.

ratio ratio ratio ratio

Affy ID Genbank Seq ID Gene Bank Names E.coli KIM5 KIM6 yopH

33668_at AF037643 62 Homo sapiens 60S ribosomal protein L12 (RPL12) pseudogene, partial sequence. 1.2 -16.1 -6.2 -1.6

34281_at AF039555 63 Homo sapiens visinin-like protein 1 (VSNL1) mRNA, complete cds. 1.0 15.0 -11 3.1

39075_at AF040958 64 Homo sapiens lysosomal neuraminidase precursor, mRNA, complete cds. 2.1 2.1 4.3 3.1

37715_at AF045184 65 Homo sapiens nuclear receptor coactivator NCoA-62 mRNA, complete cds. -5.6 -3.5 -2.4 -2.0

37215_at AF046798 66 Homo sapiens glycogen phosphorylase (PYGL) gene, exon 20 and complete cds. -1.1 -46.4 -2.7 -3.6

33422 at AF052155 67 Homo sapiens clone 24761 mRNA sequence. -2.1 1.9 -2.3 -18

38831 f_at AF053356 68 #N/A -1.3 -1.5 -1.6 -1.7

38832_r_at AF053356 68 #N/A -13 1.1 -2.4 -1.4

39740_g_at AF054187 69 Homo sapiens alpha NAC mRNA, complete cds. -3.1 -19 -2.0 -4.3

39739_at AF054187 69 Homo sapiens alpha NAC mRNA, complete cds. -3J -3.3 -1.7 -8.2

Homo sapiens erythroid K:CI cotransporter splicing isoform 2 (KCC1) mRNA, complete

38624 at AF054506 70 cds. 3.9 9.1 4.1 4.9

39733_at AF055001 71 Homo sapiens clone 24560 unknown mRNA, complete cds. -13.1 1.4 1.1 1.5

36570_at AF068862 73 Homo sapiens BAC clone 157K21 from 8q21, complete sequence. 4.5 1.0 1.0 1.0 Homo sapiens clone 24433 myelodysplasia/myeloid leukemia factor 2 mRNA, complete

37719_at AF070539 74 cds. -1.1 1.3 1.1 -1.2

36981_at AF070649 76 Homo sapiens clone 24452 mRNA sequence. -5.8 -5.8 -4.3 -5.8

40998_at AF071309 77 Homo sapiens OPA-containing protein mRNA, complete cds. -1.3 -1.1 -12 1.1

38035_at AF072928 78 Homo sapiens myotubularin related protein 6 mRNA, partial cds. -2.9 1.1 1.4 -3.6 Homo sapiens lectin-type oxidized LDL receptor (OLR1) gene, exons 4, 5, and 6, and

37233_at AF079167 79 complete cds. 7.4 193.0 100.1 53.0

36378_at AF085807 80 Homo sapiens uroplakin la mRNA, partial cds. 1.0 13 -1.4 1.3

32804_at AF091263 81 Homo sapiens RNA binding motif protein 5 (RBM5) mRNA, complete cds. -12.4 -21.5 -9.7 -215

41153_f_at AF102803 82 Homo sapiens alphaE-catenin (CTNNA1) gene, exon 18 and complete cds. -15 -4.2 -1.8 -7.4 qd77c05.x1 Soares_testis_NHT Homo sapiens cDNA clone IMAGE:1735496 3' similar to

41096 at AI126134 83 gb:A12027_cds1 CALGRANULIN A (HUMAN);, mRNA sequence. 2.8 -15 -1.1 -2.3 qd04h11.x1 Soares_placenta_8to9weeks_2NbHP8to9W Homo sapiens cDNA clone IMAGE:1722789 3' similar to SW:RB31_HUMAN Q13636 RAS-RELATED PROTEIN RAB-

33372 at AH 89226 84 31 J1] ;, mRNA sequence. -7.8 -12 -15 -17

Table 7. Genes identified by DNA chip analysis.

ratio ratio ratio ratio

Affy ID Genbank Seq ID Gene Bank Names E.coli KIM5 KIM6 yopH qm11h01.x1 NCI_CGAP_Lu5 Homo sapiens cDNA clone IMAGE: 1881553 3' similar to

41793_at AI288757 85 SW:SUR_HUMAN Q09428 SULFONYLUREA RECEPTOR. ;, mRNA sequence. 1.8 7.2 1.8 7.2 qp51f08.x1 NCI_CGAP_Co8 Homo sapiens cDNA clone IMAGEJ926567 3' similar to

37389_at AI346580 86 TR:O00193 000193 SMALL ACIDIC PROTEIN. ;, mRNA sequence. -1.1 1.9 1.2 -11 qy39a10.x1 NCI_CGAP_Brn23 Homo sapiens cDNA clone IMAGE:2014362 3' similar to

39689_at AI362017 87 gb:X52255_rna1 CYSTATIN C PRECURSOR (HUMAN);, mRNA sequence. -1.4 -15 -2.4 -2.6 tj25g10.x1 NCI_CGAP_Gas4 Homo sapiens cDNA clone IMAGE:2142594 3' similar to

31776 at AI446234 88 TR.Q07604 Q07604 PRE-T/NK CELL-ASSOCIATED PROTEIN 1F6 ;, mRNA sequence. -4.5 17 -8.3 -3.3 th60h07.x1 NCI_CGAP_Ov23 Homo sapiens cDNA clone IMAGE:2122717 3' similar to

SW:P15_HUMAN P53999 ACTIVATED RNA POLYMERASE II TRANSCRIPTIONAL

36171_at AI521453 89 COACTIVATOR P15 ;, mRNA sequence. -1.3 2.5 2.9 1.0

39133_at AI525379 90 PT1.1_06JH01.r tumorl Homo sapiens cDNA 5', mRNA sequence. -12 -4.4 -1.4 -1.0

41194_at AI525652 91 PT1.3_04j-.04.r tumorl Homo sapiens cDNA 5", mRNA sequence. -11 -1.4 -18 -2.6

38080_at AI525665 92 PT1.3_04JD06.r tumorl Homo sapiens cDNA 5', mRNA sequence. -1.5 1.1 -1.4 -4.3

39345_at AI525834 93 PT1.3_06JD01.r tumorl Homo sapiens cDNA 5', mRNA sequence. -10 -1.3 1.2 -1.3

32744_at AI526078 94 DU3.2-7.G08.r DU-145 Homo sapiens cDNA 5', mRNA sequence. -18 1.2 -16 -4.4

39921 _at AI526089 95 DU3.2-7.H07.r DU-145 Homo sapiens cDNA 5", mRNA sequence. -12 -2.4 -2.8 -3.1

41206_r_at AI540925 96 PEC1.2_15_A02.r ecnorm Homo sapiens cDNA 5', mRNA sequence. -12 -15 -1.9 -2.8

34891_at AI540958 97 PEC1.2_15_H0lr ecnorm Homo sapiens cDNA 5', mRNA sequence. 2.2 14 1.4 -3.6

38061_at AI541256 98 ped .2-3. F11.r ecnorm Homo sapiens cDNA 5', mRNA sequence. -1.1 1.2 -1.1 -1.2

35278 at AI541542 99 libtest16.A02.r bvnorm Homo sapiens cDNA 5', mRNA sequence. -11 1.2 -11 -13

39081_at AI547258 100 PN001_AH_H08.r yodnorm Homo sapiens cDNA 5', mRNA sequence. 12 9.4 1.5 4.0

34893_at A1557064 101 PT2.1_13 Vl2.r tumor2 Homo sapiens cDNA 3', mRNA sequence. -1.7 -13 -2.7 -2.2

32748_at AI557852 102 P6test.G05.r misc Homo sapiens cDNA 5', mRNA sequence. 2.1 1.6 1.8 -1.2 ts89f11.x1 NCI_CGAP_GC6 Homo sapiens cDNA clone IMAGE:2238477 3' similar to

37782_at AI636761 103 gb:J00306_cds1 SOMATOSTATIN I PRECURSOR (HUMAN);, mRNA sequence. 4.5 14 2.8 6.4 tz21b11.x1 NCI_CGAP_Ut2 Homo sapiens cDNA clone IMAGE.2289213 3' similar to

36992 at AI653621 104 gb:X77584 THIOREDOXIN (HUMAN);, mRNA sequence. 1.1 -3.3 -2.8 -2.8

Table 7. Genes identified by DNA chip analysis.

ratio ratio ratio ratio

Affy ID Genbank Seq ID Gene Bank Names E.coli KIM5 KIM6 yopH tw53e07.x1 NCI_CGAP_Ut1 Homo sapiens cDNA clone IMAGE:2263428 3' similar to

SW:RPBY_MOUSE 008740 DNA-DIRECTED RNA POLYMERASE II 13.3 KD

38055_at AI683748 105 POLYPEPTIDE ;, mRNA sequence. 1.2 -7.0 -6.8 -1.2 wc92f08.x1 NCI_CGAP_Co3 Homo sapiens cDNA clone IMAGE:2326119 3' similar to

33458_r_at AI688098 106 gb:M60750_cds1 HISTONE H2B (HUMAN);, mRNA sequence. -1.2 -4.4 -2.4 -2.0 as86g0lx1 Barstead colon HPLRB7 Homo sapiens cDNA clone IMAGE:2335632 3' similar to gb:X16560 CYTOCHROME C OXIDASE POLYPEPTIDE VIIC PRECURSOR

34381_at AI708889 107 (HUMAN);, mRNA sequence. -1.5 1.4 -1.2 -12 at02f03.x1 Barstead aorta HPLRB6 Homo sapiens cDNA clone IMAGE:2353949 3' similar

39856 at AI708983 108 to gb:M15661 60S RIBOSOMAL PROTEIN L44 (HUMAN);, mRNA sequence. -1.8 -15 -16 -17.1 wg16b07.x1 Soares_NSF_F8_9W_OT_PA_P_S1 Homo sapiens cDNA clone

IMAGE:2365237 3' similar to SW:HP1G_MOUSE P23198 HETEROCHROMATIN

38085_at A1740522 109 PROTEIN 1 HOMOLOG GAMMA ;, mRNA sequence. -1.4 -13 1.1 -3.0 wg51f08.x1 Soares_NSF_F8_9W_OT_PA_P_S1 Homo sapiens cDNA clone

IMAGE:2368647 3' similar to gb:X56741 RAS-RELATED PROTEIN RAB-8 (HUMAN);,

35339_at AI743606 110 mRNA sequence. -2.1 2.0 1.3 2.3 wf26e10.x1 Soares_NFL_T_GBC_S1 Homo sapiens cDNA clone IMAGE:2356746 3' similar to gb:X52195 5-LIPOXYGENASE ACTIVATING PROTEIN (HUMAN);, mRNA

37099_at AI806222 111 sequence. 1.9 2.2 2.1 -1.4 wj^'83a09.x1 NCI_CGAPJ_yπJ2 Homo sapiens cDNA clone IMAGE.2409400 3" similar to gb:M32315 TUMOR NECROSIS FACTOR RECEPTOR 2 PRECURSOR

(HUMAN);contains Alu repetitive element;contains element HGR repetitive element ;,

33813_at AI813532 112 mRNA sequence. -1.6 3.7 2.4 3.4 wl62d08.x1 NCI_CGAP_Brn25 Homo sapiens cDNA clone IMAGE:2429487 3' similar to

32609_at AI885852 113 gb:L19779 HISTONE H2AJ (HUMAN);, mRNA sequence. 1.4 3.1 2.6 2.6 wd84b06.x1 NCI_CGAP_Lu24 Homo sapiens cDNA clone 1MAGE:2338259 3' similar to

SW:CH10_HUMAN Q04984 10 KD HEAT SHOCK PROTEIN, MITOCHONDRIAL ;, mRNA

39353 at AI912041 114 sequence. 1.0 9.7 6.2 -1.1

Table 7. Genes identified by DNA chip analysis.

ratio ratio ratio ratio

Affy ID Genbank Seq ID Gene Bank Names E.coli KI 5 KIM6 yopH wx69d10.x1 NCI_CGAP_Bm53 Homo sapiens cDNA clone IMAGE:2548915 3' similar to

36683_at AI953789 115 gb:X53331 MATRIX GLA-PROTEIN PRECURSOR (HUMAN);, mRNA sequence. 2.2 3.2 1.5 2.1 wt15b04.x1 NCI_CGAP_Ut1 Homo sapiens cDNA clone IMAGE:2507503 3" similar to gb:M11949 PANCREATIC SECRETORY TRYPSIN INHIBITOR PRECURSOR (HUMAN);,

38582_at AI961220 116 mRNA sequence. 1.0 6.7 7.8 7.7 wt39g02.x1 NCI_CGAP_Pan1 Homo sapiens cDNA clone IMAGE:2509874 3' similar to

39700_at AI961929 117 gb:U02570 !!!! ALU CLASS C WARNING ENTRY !!!! (HUMAN);, mRNA sequence. -3.8 -4.0 -7.7 -10.4 wr07a04.x1 NCI_CGAP_GC6 Homo sapiens cDNA clone IMAGE:2480814 3' similar to

41185_f_at AI971724 118 SW:SM32_HUMAN P55855 UBIQUITIN-LIKE PROTEIN SMT3B ;, mRNA sequence. -1.4 -11 -1.3 -2.3 wz57e04.x1 NCI_CGAP_Lu27 Homo sapiens cDNA clone IMAGE:2562174 3' similar to

SW:CRF4_HUMAN Q08334 CYTOKINE RECEPTOR CLASS-II CRF2-4 PRECURSOR. ;,

33227_at AI984234 119 mRNA sequence. -3.8 -2.2 -2.8 -1.4 wz57e04.x1 NCI_CGAP_Lu27 Homo sapiens cDNA clone IMAGE:2562174 3" similar to

SW:CRF4_HUMAN Q08334 CYTOKINE RECEPTOR CLASS-II CRF2-4 PRECURSOR. ;,

33228_g_at AI984234 119 mRNA sequence. -3.8 -2.2 -3.8 -3.4 wu36b05.x1 Soares_Dieckgraefe_colon_NHCD Homo sapiens cDNA clone

IMAGE:2522097 3' similar to TR:Q14919 Q14919 NC2 ALPHA SUBUNIT. [1] ;, mRNA

39076_s_at AI991040 120 sequence. -1.8 12 -2.0 -13

35597_at AJ000480 121 Homo sapiens mRNA for C8FW phosphoprotein. 9.0 64.3 46.0 414

36118_at AJ000882 122 Homo sapiens mRNA for steroid receptor coactivator 1e. 12 -2.1 -16 -1.8

38046_at AJ005579 123 Homo sapiens mRNA for Prer protein. -2.5 -3.9 -4.6 -2.5

38971_r_at AJO 11896 124 Homo sapiens mRNA for HIV-1 , Nef-associated factor 1 beta (Nafl beta). 2.2 9.4 3.3 6.3

38970_s_at AJO 11896 124 Homo sapiens mRNA for HIV-1 , Nef-associated factor 1 beta (Nafl beta). 2.2 7.0 4.0 4.9

32178_r_at AJ011915 125 Homo sapiens mRNA for synaptosome associated protein of 23 kilodaltons, isoform A. -19 1.2 -17 1.0

36131_at AJO 12008 126 #N/A -10 2.0 1.1 11

40203_at AJ012375 127 Homo sapiens mRNA for SUI1 protein translation initiation factor. 2.5 6.9 7.0 2.5

35302 at AJ132712 128 Homo sapiens mRNA for TAP/NXF1 protein (nxfl gene). -2.3 -12 -12 -1.6

Table 7. Genes identified by DNA chip analysis.

ratio ratio ratio ratio

Affy ID Genbank Seq ID Gene Bank Names E.coli KIM5 KIM6 yopH

32826 at AJ 133133 129 Homo sapiens mRNA for ecto-ATP dip osphohydrolase, isolate C1800. -2.1 -1.3 -1.3 1.1

Homo sapiens mRNA for G18.1a and G18.1b proteins (G18.1a and G18.1b genes, located

39049 at AJ243937 130 in the class III region of the major histocompatibility complex). -11 -1.6 -2.1 -1.9

Human DNA sequence from clone CTA-833B7 on chromosome 22q12.3-13.2 Contains the NCF4 gene for cytosolic neutrophil factor 4 (40kD), the 5' part of the CSF2RB gene for

38894_g_at AL008637 131 granulocyte-macrophage low-affinity colony stimulating factor 2 receptor beta, ESTs, STS -1.0 -3.0 -4.5 -3.1

39062_at AL008726 132 #N/A -1.4 -1.6 -12 14

35576_f_at AL009179 133 #N/A -1.0 1.1 -1.5 -1.2

32573_at AL021546 134 #N/A -2.5 -3.2 -2.1 -4.1 Homo sapiens DNA sequence from PAC 232K4 on chromosome 6p22.3. Contains the JUMONJI gene for a hypothetical 141.7 kD protein. Contains ESTs, STSs, a CA repeat

34782_at AL021938 135 polymorphism and genomic marker D6S260', complete sequence. -2.0 1.2 -1.3 -2.1

32408 s at AL022101 136 #N/A 1.6 2.7 3.9 1.8

Human DNA sequence from clone 395P12 on chromosome 1q24-25. Contains the TXGP1 gene for tax-transcriptionally activated glycoprotein 1 (34kD) (OX40 ligand, OX40L) and a

32319_at AL022310 137 GOT2 (Aspartate Aminotransferase, mitochondrial precursor, EC 2.6.1.1, Transaminase A, 6.4 -1.6 -1.6 4.0

41235_at AL022312 138 #N/A 1.4 4.4 4.5 2.2

39230_at AL022318 139 #N/A -1.6 -16.1 -1.8 -1.7

31722_at AL022326 140 #N/A -1.1 -1.1 -1.3 -2.3

37421_f_at AL022723 141 #N/A -1.0 1.7 -1.7 1.5

37420_i_at AL022723 141 #N/A -1.1 -1.4 -1.4 -1.9

31545_at AL031228 142 #N/A -1.4 -1.4 -12 -1.8

33301_g_at AL031282 143 #N/A -6.2 -11 -15 -1.2

35083 at AL031670 144 #N/A 1.9 1.4 -16 12 Human DNA sequence from clone 738P11 on chromosome 1q24.1-24.3. Contains the SCYC1 gene for small inducible cytokine subfamily C, member 1 (lymphotactin) (Lymphotaxin, LTN), a novel gene for a SCYC1 LIKE protein, two RPL7A (60S Ribosomal

39652 at AL031736 145 Protein L7A) pseu 10 7.1 10 1.0

Table 7. Genes identified by DNA chip analysis.

ratio ratio ratio ratio

Affy ID Genbank Seq ID Gene Bank Names E.coli KIM5 KIM6 yopH

37009_at AL035079 146 #N/A 1.2 -5.1 -3.7 -4.4

38456_s_at AL049650 147 #N/A -10 3.2 1.6 1.2

38455 at AL049650 147 #N/A -10 2.2 1.4 -1.1

40975_s_at AL050258 148 Novel human mRNA similar to mouse tuftelin-interacting protein 10 mRNA, AF097181 3.0 1.4 -1.2 2.7

Homo sapiens mRNA; cDNA DKFZp564D0782 (from clone DKFZp564D0782); complete

40521_at AL050259 149 cds. -1.9 -2.0 -4.9- -3.0

Homo sapiens mRNA; cDNA DKFZp564l0682 (from clone DKFZp564l0682); complete

36243 at AL050262 150 cds. -60.4 -4.7 -20.8 -36.3

34304 s at AL050290 151 Homo sapiens mRNA; cDNA DKFZp586G1923 (from clone DKFZp586G1923). 2.7 8.7 7.1 2.6

32749_s_at AL050396 152 Homo sapiens mRNA; cDNA DKFZp586K1720 (from clone DKFZp586K1720). 3.1 5.5 4.5 4.2

Novel human gene mapping to chomosome 22p13.33 similar to mouse

32033_at AL096780 153 Choline/Ethanolamine Kinase (055229). -1.1 J6.3 -14.9 -16.3 wr28g10.x1 NCI_CGAP_Pr28 Homo sapiens cDNA clone IMAGE:2489058 3' similar to

38207 at AW006742 154 TR:Q15810 Q15810 CLONE 137308 ORF1 ;, mRNA sequence. 4.6 6.6 11.4 3.9 wy78c04.x1 Soares_NSF_F8_9W_OT _PA_P_S1 Homo sapiens cDNA clone

41551 at AW044624 155 IMAGE:2554662 3' similar to TR:015258 015258 RER1 PROTEIN. ;, mRNA sequence. -3.2 -3.6 -2.6 -2.8 wy78c04.x1 Soares_NSF_F8_9W_OT_PA_P_S1 Homo sapiens cDNA clone

41552_g_at AW044624 155 IMAGE:2554662 3' similar to TR:015258 015258 RER1 PROTEIN. ;, mRNA sequence. -3.2 -2.2 -3.5 -14.6

1447_at D00761 156 Human mRNA for proteasome subunit HC5. -19 1.1 -1.6 -2.4 zq51g09.s1 Stratagene neuroepithelium (#937231) Homo sapiens cDNA clone

IMAGE.645184 3" similar to gb:D00763 PROTEASOME COMPONENT C9 (HUMAN);,

1450_g_at D00763 157 mRNA sequence. -5.5 -12 -2.1 -8.2

32046 at D 10495 159 Homo sapiens mRNA for protein kinase C delta-type, complete cds. 2.2 4.1 3.0 2.9

1810 s at D 10495 159 Homo sapiens mRNA for protein kinase C delta-type, complete cds. 2.2 3.8 2.6 2.6

34951 at D 10923 162 Human mRNA for HM74. 6.8 9.0 14.6 13.7

39994 at D 10925 163 Human mRNA for HM145. 16 3.7 4.4 1.8

1506 at D11086 164 Human mRNA for interleukin 2 receptor gamma chain. 1.2 3.7 2.0 2.2

Table 7. Genes identified by DNA chip analysis.

ratio ratio ratio ratio

Affy ID Genbank Seq ID Gene Bank Names E.coli KIM5 KIM6 yopH

1305_s_at D 12620 165 Homo sapiens mRNA for cytocfirome P-450LTBV, complete cds. -13 19 1.4 15

37077_at D 13243 166 Homo sapiens gene for pyruvate kinase L, exon12 and complete cds. 10 4.1 3.9 12.7

37384_at D 13640 167 Human mRNA for KIAA0015 gene, complete cds. -62.4 -39.7 -9.1 -3.0

*1215_s_at D13891 169 Human mRNA for ld-2H, complete cds. 3.2 11 2.1 1.3

777_at D 13988 170 Human rab GDI mRNA, complete cds. -5.0 1.1 -2.6 -1.9

34819_at D 14043 171 Human mRNA for MGC-24, complete cds. -3.8 -13 -1.7 -2.3

347_s_at D 14530 173 Human homolog of yeast ribosomal protein S28, complete cds. 11 -7.1 -12 -1.3

37359_at D 14658 174 Human mRNA for KIAA0102 gene, complete cds. -3.7 -2.2 -1.6 -7.3

34760_at D 14664 175 Human mRNA for KIAA0022 gene, complete cds. 14 -3.6 -4.9 -5.7

37320_at D 14694 176 Human mRNA for KIAA0024 gene, complete cds. 15 3.4 1.3 -1.0

37325_at D 14697 177 Human mRNA for KIAA1293 gene, complete cds. -4.4 -4J -2.0 -4.1

34777_at D 14874 178 Homo sapiens mRNA for adrenomedullin precursor, complete cds. 2.3 5.5 4.2 2.5

38123_at D 14878 179 Human mRNA for protein D123, complete cds. -1.2 -13 -11.4 -13.6

38413_at D 15057 180 Human mRNA for DAD-1 , complete cds. -7.7 2.2 -1.7 -1.9

35770_at D 16469 181 Human mRNA for ORF, Xq terminal portion. 2.2 -2.8 -17 -1.2

Homo sapiens mRNA for mitochondrial 3-ketoacyl-CoA thiolase beta-subunit of

39741_at D16481 182 trifunctional protein, complete cds. -4.9 -1.4 -1.6 1.0

40115_at D 16562 183 Human mRNA for ATP synthase gamma-subunit (L-type), complete cds. -1.5 -6.3 -1.3 -1.1

35723_at D16581 184 Human mRNA for 8-oxo-dGTPase, complete cds. 1.5 -3.4 -1.8 -1.4

40735_at D 16626 185 Human mRNA for histidase, complete cds. -2.5 -19.3 -4.7 J9.3

1873_at D21089 186 Human mRNA for XP-C repair complementing protein (p125), complete cds. 1.6 -6.0 -19.1 -6.4

1874_at D21090 187 Human mRNA for XP-C repair complementing protein (p58/HHR23B), complete cds. 1.6 -8.8 -6.1 -8.8

36678_at D21261 188 Human mRNA for KIAA0120 gene, complete cds. 1.5 -10 -1.7 -1.2

38031_at D21853 189 Human mRNA for KIAA0111 gene, complete cds. 1.4 4.7 4.2 3.7

32675_at D21878 190 Human mRNA for BST-1 , complete cds. -1.8 1.4 1.1 1.5

33656_at D23661 191 Human mRNA for ribosomal protein L37, complete cds. 1.1 1.2 1.0 1.3

1695_at D23662 192 Homo sapiens mRNA for ubiquitin-like protein, complete cds. -1.2 -15.5 -2.1 -1.0

35689_at D25215 193 Human mRNA for KIAA0032 gene, complete cds. 2.3 16 -2.9 1.2

40864_at D25274 194 Homo sapiens mRNA, clone:P02ST9. -15.7 -2.3 -4.1 -2.5

37543 at D25304 195 Human mRNA for KIAA0006 gene, partial cds. -1.7 -1.0 -1.2 -3.5

Table 7. Genes identified by DNA chip analysis.

ratio ratio ratio ratio

Affy ID Genbank Seq ID Gene Bank Names E.coli KIM5 KIM6 yopH

41333_at D26069 197 Human mRNA for KIAA0041 gene, partial cds. 12 -2.5 -2J -1.0

1309_at D26598 199 Human mRNA for proteasome subunit HsC10-ll, complete cds. -1.0 -16 -2.5 -3.8

1310_at D26599 200 Human mRNA for proteasome subunit HsC7-l, complete cds. -2.0 -1.2 -15 -3.4

33154 at D26600 201 Human mRNA for proteasome subunit HsN3, complete cds. -1.2 -1.1 -1.8 -2.4

1311_at D26600 201 Human mRNA for proteasome subunit HsN3, complete cds. -1.2 -1.3 -1.4 -1.9

32628_at D28118 202 Human mRNA for DB1 , complete cds. -7.0 -5.9 -2.9 -1.3

Human mRNA for pre-mRNA splicing factor SRp20, 5'UTR (sequence from the 5'cap to the

351_f_at D28423 203 start codon). 3.1 4.1 11.5 -2.8

39699_at D28476 204 Human mRNA for KIAA0045 gene, complete cds. 1.0 2J -1.0 -2.8

37212_at D28588 205 Human mRNA for KIAA0048 gene, complete cds. 2.8 6.8 1.7 2.6

941_at D29012 206 Human mRNA for proteasome subunit Y, complete cds. -1.0 1.0 -1.7 -1.3

1696_at D29013 207 Human mRNA for DNA polymerase beta, complete cds. 1.7 -5.7 -2.2 1.3

38149_at D29642 208 Human mRNA for KIAA0053 gene, complete cds. -7.8 -4.8 -5.5 -1.8

1418_at D29675 209 Human inducible nitric oxide synthase gene, promoter and exon 1. 9.9 10 1.0 1.0

40960_at D29805 210 Human mRNA for beta-1 ,4-galactosyltransferase, complete cds. 2.1 1.7 11 1.0

40227_at D29810 211 Human mRNA for unknown product, partial cds. 2.7 -7.3 -1.3 -7.3

41862_at D29954 212 Human mRNA for KIAA0056 gene, partial cds. 1.4 4.5 -12 3.0

1420_s_at D30655 213 Homo sapiens mRNA for eukaryotic initiation factor 4AII, complete cds. 1.3 1.2 -1.4 -2.7

33444_at D30756 214 Human mRNA for KIAA0049 gene, complete cds. 19 -10 -5.4 -1.6

37411 at D30758 215 Human mRNA for KIAA0050 gene, complete cds. 1.2 -3.3 -2.6 -2.4

36616 at D31767 216 Human mRNA for KIAA0058 gene, complete cds. -1.1 -1.1 -16 -2.8

36572_r_at D31885 217 Human mRNA for KIAA0069 gene, partial cds. -1.6 3.1 1.2 2.0

37651 at D31888 218 Human mRNA for KIAA0071 gene, partial cds. 1.0 -1.4 -2.6 -8.5

34336_at D32053 219 Homo sapiens mRNA for Lysyl tRNA Synthetase, complete cds. 2.0 1.2 -18 -1.6

36188_at D32257 221 Human GTF3A mRNA for Xenopus transcription factor IIIA homologue, complete cds. -1.0 10 1.0 2.0

33777_at D34625 222 Human TBXAS1 gene for thromboxane synthase, exon 13. 1.3 -3.3 -4.6 -5.0

1312_at D38047 223 Human mRNA for 26S proteasome subunit p31 , complete cds. 11 -1.5 1.1 1.3

1313_at D38048 224 Human mRNA for proteasome subunit z, complete cds. 1.1 -1.4 -3.5 -3.7

1858_at D38122 226 Human mRNA for Fas ligand, complete cds. 9.9 2.2 1.0 1.0

738 at D38524 227 Human mRNA for 5'-nucleotidase. -5.4 3J -15 11

Table 7. Genes identified by DNA chip analysis.

ratio ratio ratio ratio

Affy ID Genbank Seq ID Gene Bank Names E.coli KIM5 KIM6 yopH

38114_at D38551 229 Human mRNA for KIAA0078 gene, complete cds. -2.3 -15.7 -3.1 -15.7

36208_at D42040 231 Human mRNA for KIAA9001 gene, complete cds. 2.1 1.4 1.5 1.7

32788_at D42063 232 Human mRNA for RanBP2 (Ran-binding protein 2), complete cds. -18 2.3 3.3 4.7

33326_at D42087 233 Human mRNA for KIAA0118 gene, partial cds. 2.2 8.7 8.0 5.4

314 at D42138 234 Homo sapiens mRNA for PIG-B, complete cds. 2.0 1.5 -1.9 -1.2

37718_at D43636 235 Human mRNA for K1AA0096 gene, partial cds. -7.0 -26.7 -7.2 -26.7

40417_at D43950 236 Homo sapiens mRNA for KIAA0098 protein, partial cds. -4.2 -4.8 -3.7 -4.9

38976_at D44497 237 Human mRNA for actin binding protein p57, complete cds. -2.3 -2.6 -3.6 -2.6

944_s_at D49354 239 Human mRNA for enhancer protein in hsp70 gene, partial cds. 9.3 -3.1 -13 1.2

37395_at D49400 240 Homo sapiens mRNA for vacuolar ATPase, complete cds. -11 1.0 2.1 2.8

1185_at D49410 241 Human gene for interleukin 3 receptor alpha subunit, exon 12 and partial cds. -5.4 -8.3 -13 2.1

Homo sapiens mRNA for 6-phosphofructo-2-kinase/fructose-2, 6-bisphosphatase,

39522_at D49817 242 complete cds. 5.2 21.7 13.0 7.8

1836_at D50310 243 Human mRNA for cyclin I, complete cds. 1.3 1.1 -1.4 -1.6

38597_f_at D50402 244 Human mRNA for NRAMP1, complete cds. 1.3 2.4 2.4 3.9

38771_at D50405 245 Human mRNA for RPD3 protein, complete cds. -1.2 -2.6 -2.5 -14.1

33683_at D50525 246 Human mRNA for TI-227H. -1.3 2.2 12 -1.7

41627_at D50645 247 Homo sapiens mRNA for SDF2, complete cds. -2.5 2.0 1.0 -2.7

946_at D50663 248 Human mRNA for TCTEL1 gene, complete cds. -1.9 -10.8 -3.7 -19.6

1815 g_at D50683 249 Homo sapiens mRNA for TGF-betallR alpha, complete cds. -22.9 -3.4 -10.1 -29.8

1814_at D50683 249 Homo sapiens mRNA for TGF-betallR alpha, complete cds. -22.9 J4.8 -14.5 -44.8

1904_at D50692 250 Homo sapiens mRNA for c-myc binding protein, complete cds. 5.1 4.4 -2.6 -1.8

33498_at D56495 251 Human mRNA for Reg-related sequence derived peptide-2. 2.7 1.0 1.0 2.3

32445_at D63390 252 Homo sapiens mRNA for acetylhydrolase IB beta-subunit, complete cds. 1.3 3.5 1.0

39795_at D63475 253 Human mRNA for KIAA0109 gene, complete cds. -3.4 -2.0 -3.7 -1.4

40828_at D63476 254 Human mRNA for KIAA0142 gene, complete cds. -2.0 2.5 1.2 -1.5

38089_at D63478 255 Human mRNA for K1AA0144 gene, complete cds. 2.1 -6.4 2.5 14

36741_at D63482 256 Human mRNA for KIAA0148 gene, complete cds. -2.4 -25.9 -25.9 -4.3

33281_at D63485 257 Human mRNA for KIAA0151 gene, complete cds. 3.5 1.7 1.2 1.7

37962 r at D63506 258 Homo sapiens mRNA for unc-1 δhomologue, complete cds. -1.0 -2.3 -2.4 -6.5

Table 7. Genes identified by DNA chip analysis.

ratio ratio ratio ratio

Affy ID Genbank Seq ID Gene Bank Names E.coli KIM5 KIM6 yopH

35895_at D63710 259 Human ob gene, exon 3 and complete cds. 4.3 10 1.0 1.3

32220_at D63874 260 Human mRNA for HMG-1 , complete cds. -1.6 10 -1.5 -1.5

37959_at D63876 261 Human mRNA for KIAA0154 gene, partial cds. -3.0 -14.6 -14.6 -14.6

40281_at D63878 262 Human mRNA for KIAA0158 gene, complete cds. -2.2 -15 -1.4 -1.8

36207 at D67029 263 Human SEC14L mRNA, complete cds. -5.2 -10.2 -5.0 -5.3

40140_at D76444 264 Homo sapiens hkf-1 mRNA, complete cds. -3.5 2.5 3.8 2.4

39864_at D78134 265 Homo sapiens mRNA for CIRP, complete cds. -4.7 -19 -2.6 -2.4

1166_at D78151 266 Human mRNA for 26S proteasome subunit p97, complete cds. 1.1 1.1 -1.3 1.2

1315_at D78361 267 Human mRNA for ornithine decarboxylase antizyme, ORF 1 and ORF 2. 1.1 -1.1 -1.6 -15

1424_s_at D78577 268 Human DNA for 14-3-3 protein eta chain, exon2 and complete cds. -1.3 -1.4 -2.5 -1.2

40662_g_at D78579 269 Homo sapiens mRNA for neuron derived orphan receptor, complete cds. -3.4 22.3 28.8 10.8

40661_at D78579 269 Homo sapiens mRNA for neuron derived orphan receptor, complete cds. -3.4 27.8 38.8 9.1

33889_s_at D79985 270 Human mRNA for KIAA0163 gene, complete cds. -2.0 -42.1 -42.1 -42.1

38050_at D79986 271 Human mRNA for KIAA0164 gene, complete cds. -2.1 -1.5 -3.5 -2.1

37598_at D79990 272 Human mRNA for KIAA0168 gene, complete cds. -3.7 -1.5 -1.4 -1.4

32644_at D79991 273 Homo sapiens mRNA for KIAA0169 protein, partial cds. 2.3 3.2 3.0 3.0

36942_at D79996 274 Human mRNA for KIAA0174 gene, complete cds. -1.7 -16 -1.7 -2.5

37031 at D80005 275 Human mRNA for KIAA0183 gene, partial cds. -2.0 -10.1 -3.0 -10.1

37734 at D80006 276 Human mRNA for KIAA0184 gene, partial cds. -2.4 -11 -12 -2.3

37683_at D80012 277 Human mRNA for KIAA0190 gene, partial cds. -1.2 -2.3 -18 -6.6

31672 g at D82351 278 Human retropseudogene MSSP-1 DNA, complete cds. 1.1 -15.8 -3.6 -4.6

32674_at D83032 279 Homo sapiens mRNA for nuclear protein, NP220, complete cds. -2.4 -3.3 -17 -1.4

38879_at D83664 280 Human mRNA for CAAF1 (calcium-binding protein in amniotic fluid 1), complete cds. 1.1 -8.1 11 -8.1

37292_at D83785 281 Human mRNA for KIAA0200 gene, complete cds. 1.6 -2.0 -2.2 -3.8

1621_at D85423 282 Homo sapiens mRNA for Cdc5, partial cds. 10.1 1.0 1.0 1.0

752_s_at D85429 283 Homo sapiens gene for heat shock protein 40, complete cds. 1.1 -2.6 -1.5 12

32691_s_at D86096 284 Human DNA for prostaglandin EP3 receptor subtype, complete cds. -5.0 4.5 1.7 2.6

40034_r_at D86864 286 Homo sapiens mRNA for acetyl LDL receptor, complete cds. 3.8 11 3.2 4.0

34387_at D86960 287 Human mRNA for KIAA0205 gene, complete cds. -4.1 1.5 -1.4 -1.2

32704 at D86964 288 Human mRNA for KIAA0209 gene, partial cds. -2.3 -5.0 -3.2 -3.9

Table 7. Genes identified by DNA chip analysis.

ratio ratio ratio ratio

Affy ID Genbank Seq ID Gene Bank Names E.coli KIM5 KI 6 yopH

37551_at D86966 289 Human mRNA for KIAA0211 gene, complete cds. 1.2 -1.6 -1.7 -1.5

31898_at D86967 290 Human mRNA for KIAA0212 gene, complete cds. 1.4 2.2 1.5 2.1

33748_at D86976 291 Human mRNA for KIAA0223 gene, partial cds. -2.6 -5.5 -5.8 -3.7

31802_at D86979 292 Homo sapiens mRNA for KIAA0226 protein, partial cds. 1.9 -1.2 -6.7 -2.6

40971_at D86982 293 Human mRNA for KIAA0229 gene, partial cds. -3.0 1.7 -1.4 -1.1

39327_at D86983 294 Human mRNA for KIAA0230 gene, partial cds. -2.6 2.8 1.5 18

37748_at D86985 295 Homo sapiens mRNA for KIAA0232 protein, partial cds. -3.0 -13.5 -3.0 -2.3

39404_s_at D86988 296 Human mRNA for KIAA0221 gene, complete cds. -2.1 -33.4 -10.3 -4.7

38393_at D87434 298 Human mRNA for KIAA0247 gene, complete cds. 1.3 2.2 2.2 1.3

40447_at D87436 299 Human mRNA for KIAA0249 gene, complete cds. -1.5 -1.6 -4.0 -29.3

34835 at D87442 300 Human mRNA for KIAA0253 gene, partial cds. -1.4 -41.7 -9.5 -5.1

36154_at D87452 301 Homo sapiens mRNA for KIAA0263 protein, partial cds. -27.5 -17-4 -4.0 -6.9

37336_at D87684 302 Homo sapiens mRNA for KIAA0242 protein, partial cds. -2.0 -4.0 -1.3 -4.0

31907_at D87735 303 Homo sapiens mRNA for ribosomal protein L14, complete cds. -2.3 2.0 -1.3 -6.2

36933 at D87953 304 Human mRNA for RTP, complete cds. 1.2 2.2 -1.0 1.3

34479_at D88532 305 Homo sapiens mRNA for p55pik, complete cds. -2.6 8.0 1.0 3.7

33367_s_at D88674 306 Homo sapiens mRNA for antizyme inhibitor, complete cds. 5.0 16.5 13.5 9.2

1277_at D89016 307 Homo sapiens mRNA for Neuroblastoma, complete cds. 5.5 -1.5 -2.2 1.0

39624_at D89078 310 Homo sapiens mRNA for leukotriene b4 receptor, complete cds. -37.4 1.1 -1.1 1.1

1817_at D89667 311 Homo sapiens mRNA for c-myc binding protein, complete cds. -1.0 -3.5 -1.3 -4.8

38912_at D90042 312 Human liver arylamine N-acetyltransferase (EC 2.3.1.5) gene. 13.3 7.0 -1.5 1.0

723 s at 31322-HT5143 Human nuclear ribonucleoprotein particle (hnRNP) C protein mRNA, complete cds. 1.6 4.1 4.7 1.1

324_f_at 31515-HT1515 #N/A -1.3 -1.4 1.3 2.9

954_s_at 31614-HT1614 Human protein phosphatase-1 catalytic subunit mRNA, complete cds. -24.9 -16.4 -6.2 -3.3

1173_g_at 3172-HT3924 #N/A 2.7 9.6 2.8 5.6

726 f_at 31751-HT1768 #N/A -1.3 11.7 3.4 7.5

327_f_at 31800-HT1823 #N/A 1.2 1.2 -1.2 -2.7

955_at 31862-HT1897 #N/A -1.1 -1.0 -11 -9.1

1818_at 31879-HT1919 #N/A -4.6 -3.4 -2.5 -1.2

956 at 31980-HT2023 #N/A -1.7 2.0 1.3 1.1

Table 7. Genes identified by DNA chip analysis.

ratio ratio ratio ratio

Affy ID Genbank Seq ID Gene Bank Names E.coli KIM5 KIM6 yopH

957_at 32059- HT2114 #N/A -1.9 1.2 -1.3 -12

329_s_at 32238- HT2321 H.sapiens mRNA for NuMA protein. -7.4 11 -1.2 -1.3

330_s_at 32259- HT2348 Human HALPHA44 gene for alpha-tubulin, exons 1-3. -2.5 -18 -2.6 -2.1

1663_at 32325- HT2421 #N/A 4.0 -3.5 -3.5 -3.5

959_at 32463- HT2559 #N/A 3.6 10 1.0 1.0

333_s_at 32639- HT2735 H.sapiens MSSP-2 mRNA. 1.1 -2.6 -2.5 -3.1

694_at 32689- HT2785 #N/A 1.0 10.8 3.4 10

1842 at 32724- HT2820 #N/A 3.1 8.6 8.8 6.2 ae49g08.s1 Stratagene lung carcinoma 937218 Homo sapiens cDNA clone IMAGE:950270 3' similar to gb:Y00371_rna1 HEAT SHOCK COGNATE 71 KD PROTEIN (HUMAN);,

1180_g_at 32855 HT2995 mRNA sequence. -5.3 3.7 2.5 14 1179_at 32855 HT2995 #N/A -5.3 3.5 3.3 2.7

312_s_at 33075 HT3236 Human focal adhesion kinase (FAK) mRNA, complete cds. 5.7 2.3 1.0 1.0

1894_f_at 33236 HT3413 #N/A -8.4 4.7 1.9 5.7 1164_at 33344 HT3521 #N/A -2.7 -3.6 -2.6 -2.7 1142_at 33432 HT3618 #N/A -3.0 8.5 1.7 5.3

292_s_at 33484 HT3678 Homo sapiens clkl mRNA, complete cds. -1.6 -2.8 -1.7 -1.3 1903_at 33521 HT3715 #N/A -1.3 1.5 1.4 12

1630_s_at 33730 HT4000 Homo sapiens protein tyrosine kinase (Syk) mRNA, complete cds. -5.3 -23.7 -3.7 -7.3 938_at 33936 HT4206 #N/A -2.5 10.8 2.6 1.0 1937 at 34036 HT4306 #N/A 1.2 -2.5 2.6 3.4

294_s_at 34120-HT4392 Human p58/GTA (galactosyltransferase associated protein kinase) mRNA, complete cds. -6.2 -1.7 -1.0 -2.2 1286_s_at IG429-HT429 Human B-cell growth factor (BCGF1 ) mRNA, complete cds. 5.2 1.0 1.0 1.0 706_at 34582-HT4987 #N/A -5.7 -3.2 -1.4 -3.2 1150_at IG620-HT620 #N/A 19 6.2 5.1 3.0 31525_s_at J00153 313 #N/A 1.6 1.9 -2.1 1.7 37039_at J00194 314 human hla-dr antigen alpha-chain mrna & ivs fragments. 1.6 2.2 1.8 1.4 306_s_at J02621 315 Human non-histone chromosomal protein HMG-14 mRNA, complete cds. -1.4 -1.1 -1.2 -2.1 40379 at J02625 316 Human cytochrome P-450J mRNA, complete cds. 1.0 6.7 1.0 2.3

Table 7. Genes identified by DNA chip analysis.

ratio ratio ratio ratio

Affy ID Genbank Seq ID Gene Bank Names E.coli K1M5 KIM6 yopH

Human prolyl 4-hydroxylase beta-subunit and disulfide isomerase (P4HB) gene, exon 11,

691_g_at J02783 317 clones 6B-(1 ,3,5,6). -7.5 1.3 1.9 17 1431 at J02843 318 Human cytochrome P450IIE1 (ethanol-inducible) gene, complete cds. 3.4 4.3 1.1 -2.2

Human protein phosphatase 2A regulatory subunit alpha-isotype (alpha-PR65) mRNA,

40867 at J02902 319 complete cds. -11 -15 -11 -11

922_at J02902 319 complete cds. -11 -2.0 1.0 -2.8

37023_at J02923 320 Human 65-kilodalton phosphoprotein (p65) mRNA, complete cds. 1.5 2.7 3.2 18

36543_at J02931 321 Human placental tissue factor (two forms) mRNA, complete cds. 32.5 13.5 9.9 1.0

692_s_at J02947 322 Human extracellular-superoxide dismutase (SOD3) mRNA, complete cds. 1.0 1.7 1.8 3.3

33803 at J02973 323 Human thrombomodulin gene, complete cds. 1.7 2.1 -11 -1.5

39916_r_at J02984 324 Human insuiinoma rig-analog mRNA encoding DNA-binding protein, complete cds. -2.1 -14 -2.5 -1.2

1408_at J02986 325 Human transforming protein (hst) gene, complete cds. 8.3 4.7 1.0 1.0

37400_at J03068 326 Human DNF1552 (lung) mRNA, complete cds. 1.6 6.7 2.0 5.2

36795 at J03077 327 Human co-beta glucosidase (proactivator) mRNA, complete cds. -13 -1.1 -1.4 1.1

40109 at J03161 328 Human serum response factor (SRF) mRNA, complete cds. 10 3.4 2.3 2.7

1409_at J03161 328 Human serum response factor (SRF) mRNA, complete cds. 1.0 4.9 3.2 2.6

38081_at J03459 330 Human leukotriene A-4 hydrolase mRNA, complete cds. -2.2 -1.4 -2.2 -4.4

41146_at J03473 331 Human poly(ADP-ribose) synthetase mRNA, complete cds. 1.3 -1.1 -3.2 1.1

40435_at J03592 332 Human ADP/ATP translocase mRNA, 3' end, clone pHAT8. -15 1.5 -16 -1.3

40436_g_at J03592 332 Human ADP/ATP translocase mRNA, 3' end, clone pHATδ. -1.5 -4.1 -1.2 1.8

307_at J03600 333 Human lipoxygenase mRNA, complete cds. -1.6 -5.8 -4.8 -3.5

310_s_at J03778 334 Human mRNA for microtubule-associated tau protein. 7.2 1.0 1.0 1.0

39728_at J03909 336 Human gamma-interferon-inducible protein (IP-30) mRNA, complete cds. -1.0 3.5 2.8 4.7

925_at J03909 336 Human gamma-interferon-inducible protein (IP-30) mRNA, complete cds. -10 3.4 3.4 4.2

38533_s_at J03925 337 Human Mac-1 gene encoding complement receptor type 3, CD11b, complete cds. 1.0 -2.4 -2.7 -2.5

1158_s_at J04046 338 Human calmodulin mRNA, complete cds. 1.6 -9.3 -4.0 -3.6

1519_at J04102 339 Human erythroblastosis virus oncogene homolog 2 (ets-2) mRNA, complete cds. 16.8 64.5 34.3 17.4

41221 at J04173 342 Homo sapiens phosphoglycerate mutase (PGAM-B) mRNA, complete cds. -13 -1.8 -4.2 -2.8

39758 f at J04182 343 Homo sapiens lysosomal membrane glycoprotein-1 (LAMP1 ) mRNA, complete cds. -3.1 1.2 1.5 1.5

Table 7. Genes identified by DNA chip analysis.

ratio ratio ratio ratio

Affy ID Genbank Seq ID Gene Bank Names E.coli IM5 KIM6 yopH

37670_at J04543 344 Human synexin mRNA, complete cds. -2.4 2.1 -11 -3.4

1288_s_at J04617 345 Human elongation factor EF-1 -alpha gene, complete cds. 1.5 3.4 3.8 2.2

31697_s_at J04755 346 Human ferritin H processed pseudogene, complete cds. 3.2 3.4 -1.6 2.9

2093_s_at J04977 347 Human Ku (p70/p80) subunit mRNA, complete cds. -5.4 -1.2 -1.8 -2.2

679_at J04990 348 Human cathepsin G gene, complete cds. 3.4 -2.7 1.6 1.4

1520_s_at J05008 349 Homo sapiens endothelin-1 (EDN1) gene, complete cds. 76.7 249.6 57.5 30.6

31859_at J05070 350 Human type IV collagenase mRNA, complete cds. 1.5 1.2 11 1.3

1119_at J05249 351 Human replication protein A 32-kDa subunit mRNA, complete cds. -1.9 1.7 1.4 1.1 Homo sapiens (clones MDP4, MDP7) microsomal dipeptidase (MDP) mRNA, complete

37413_at J05257 352 cds. -2.8 6.2 2.1 2.9

40695_at J05272 353 Human IMP dehydrogenase type 1 mRNA complete cds. -1.0 -2.4 -4.0 -1.8

36036_at J05500 354 Human beta-spectrin (SPTB) mRNA, complete cds. 1.8 4.5 19 -1.4

40507_at K03195 355 Human (HepG2) glucose transporter gene mRNA, complete cds. 1.8 1.5 -1.3 2.3

686_s_at K03498 356 Human endogenous retrovirus HERV-K22 pol and envelope ORF region. -1.4 -1.7 -1.4 1.4

39122_at K03515 357 Human neuroleukin mRNA, complete cds. 1.3 3.0 -1.7 1.1

35601_at L00022 358 Human Ig active heavy chain epsilon-1 gene, constant region. -1.8 17.2 4.6 19.5

32855_at L00352 359 Human low density lipoprotein receptor gene, exon 18. 9.4 5.7 8.8 6.3

32469_at L00693 360 Human carcinoembryonic antigen (CGM1) mRNA, complete cds. 1.0 2.5 1.1 1.8

33619_at L01124 361 Human ribosomal protein S13 (RPS13) mRNA, complete cds. 1.0 -11 -1.8 -4.5 Human eosinophil Charcot-Leyden crystal (CLC) protein (lysophospholipase) mRNA,

36809_at L01664 362 complete cds. -1.3 2.0 1.3 1.4

31596_f_at L02326 363 Homo sapiens (clone Hu lambda-17) lambda-like gene, complete cds. -3.0 2.9 1.6 2.2

688_at L02426 364 Human 26S protease (S4) regulatory subunit mRNA, complete cds. -2.8 1.7 -1.7 -1.5

274_at L04282 365 Human CACCC box-binding protein mRNA, complete cds. -1.2 -1.7 -8.4 -9.3

669_s_at L05072 366 Homo sapiens interferon regulatory factor 1 gene, complete cds. -4.8 -2.4 -2.2 -3.1

31708_at L05095 367 Homo sapiens ribosomal protein L30 mRNA, complete cds. -1.1 -2.1 -13 -2.5

1125_s_at L05424 368 Human cell surface glycoprotein CD44 (CD44) gene, 3' end of long tailed isoform. 4.4 19.7 24.3 28.7

36930 _ at L05425 369 Homo sapiens nucleolar GTPase mRNA, complete cds. 1.1 1.8 2.0 6.0

670_s_at L05515 370 Homo sapiens cAMP response element-binding protein (CRE-BP1) mRNA, complete cds. -3.9 -12.2 -12.2 -12.2

Table 7. Genes identified by DNA chip analysis.

ratio ratio ratio ratio

Affy ID Genbank Seq ID Gene Bank Names E.coli KIM5 KIM6 yopH

39531_at L06237 371 Human microtubule-associated protein 1 B (MAPI B) gene, complete cds. 5.2 1.0 1.8 1.0

32438_at L06498 372 Homo sapiens ribosomal protein S20 (RPS20) mRNA, complete cds. 1.2 -1.8 -1.2 -1.7

31962_at L06499 373 Homo sapiens ribosomal protein L37a (RPL37A) mRNA, complete cds. 1.3 -1.4 -1.9 -2.5

649_s_at L06797 374 Human (clone L5) orphan G protein-coupled receptor mRNA, complete cds. 1.3 3.4 5.3 4.1

1774_at L06895 375 Homo sapiens antagonizer of myc transcriptional activity (Mad) mRNA, complete cds. 1.7 1.5 16 -10

34543_at L06895 375 Homo sapiens antagonizer of myc transcriptional activity (Mad) mRNA, complete cds. 1.7 1.5 4.0 2.1

Homo sapiens calcium/calmodulin-dependent protein kinase (CAMK) isoform B mRNA

650_s_at L07044 376 sequence. -1.2 -12.6 -4.4 -2.7

32146_s_at L07261 377 Human alpha adducin mRNA, partial cds including alternate exons A and B. -5.0 1.2 -6.3 -2.9

37713_at L07548 378 Human aminoacylase-1 (ACY1) mRNA, complete cds. 5.8 4.4 4.7 1.3

36600_at L07633 380 Homo sapiens (clone 1950.2) interferon-gamma IEF SSP 5111 mRNA, complete cds. 1.1 -2.3 -2.5 -1.8

276_at L08069 381 Human heat shock protein, E. coli DnaJ homologue mRNA, complete cds. 15 4.7 3.4 2.3

656_at L08488 383 Human inositol polyphosphate 1 -phosphatase mRNA, complete cds. -3.0 9.2 4.3 2.4

37697_s_at L08666 384 Homo sapiens porin (por) mRNA, complete cds and truncated cds. 2.2 1.6 -1.4 -2.0

37309_at L09159 385 Homo sapiens RHOA proto-oncogene multi-drug-resistance protein mRNA, 3' end. 11 1.1 -1.2 -1.2

34890_at L09235 386 Human vacuolar ATPase (isoform VA68) mRNA, complete cds. -8.0 -1.5 -2.0 -4.4

33012_at L09753 387 Homo sapiens CD30 ligand mRNA, complete cds. 7.1 14.9 10.3 9.4

31331_at L10123 388 Homo sapiens surfactant protein A mRNA, complete cds. 1.3 7.4 1.0 10

40125_at L10284 389 Homo sapiens integral membrane protein, calnexin, (IP90) mRNA, complete cds. 1.2 3.5 2.0 3.2

41469_at L10343 390 Huma elafin gene, complete cds. 6.1 26.6 9.9 8.3

33123_at L10379 391 Human (clone CTG-B45d) mRNA sequence. 5.3 12.5 1.8 1.0

1499_at L10413 392 Human famesyltransferase alpha-subunit mRNA, complete cds. -1.1 -12 -2.4 -1.4

1131_at L11285 393 Homosapiens ERK activator kinase (MEK2) mRNA. 1.2 -5.3 -2.9 -2.5

1292_at L11329 394 Homo sapiens protein tyrosine phosphatase (PAC-1) mRNA, complete cds. 78.8 151.4 147.4 44.6

657_at L11373 395 Human protocadherin 43 mRNA, complete cds for abbreviated PC43. -1.9 -9.6 -1.9 -9.6

31546_at L11566 396 Homo sapiens ribosomal protein L18 (RPL18) mRNA, complete cds. -8.6 J5.5 -1.4 -1.6

932 i at L11672 397 Human Kruppel related zinc finger protein (HTF10) mRNA, complete cds. 2.0 2.6 1.5 18

Table 7. Genes identified by DNA chip analysis.

ratio ratio ratio ratio

Affy ID Genbank Seq ID Gene Bank Names E.coli KIM5 KIM6 yopH

934 at L11702 398 Human phospholipase D mRNA, complete cds. 1.0 5.2 1.4 4.3

935 at L12168 399 Homo sapiens adenylyl cyclase-associated protein (CAP) mRNA, complete cds. 1.0 -12 -1.4 -1.8

31506_s_at L12691 400 Human neutrophil peptide-3 gene, complete cds. 12 -2.3 -11 -2.5

38789_at L12711 401 Homo sapiens transketolase (tk) mRNA, complete cds. -18 -6.5 -6.7 -5.3

40592_at L13329 402 Homo sapiens iduronate-2-sulfatase (IDS) gene, complete cds. -2.9 1.8 -11 -1.2

32569 at L13385 403 Homo sapiens(clone 71) Miller-Dieker lissencephaly protein (LIS1) mRNA, complete cds. -4.5 -3.6 -1.4 -5.3

278_at L13436 404 Homo sapiens guanylate cyclase mRNA, complete mature peptide. 1.3 6.0 -1.7 3.9

1728_at L13689 406 Human prot-oncogene (BMI-1 ) mRNA, complete cds. 4.4 3.8 3.1 2.4

39037_at L13773 407 Human AF-4 mRNA, complete cds. -3.3 J3.6 -6.1 J3.6

38129_at L13943 408 Human glycerol kinase (GK) mRNA exons 1-4, complete cds. 1.1 5.0 4.3 2.8

36672_at L13977 409 Human prolylcarboxypeptidase mRNA, complete cds. -2.2 -6.3 -2.2 -1.5

36991_at L14076 410 Human pre-mRNA splicing factor SRp75 mRNA, complete cds. -3.6 -20.6 -7.7 -20.6

1907_at L14812 411 Human retinoblastoma related protein (p107) mRNA, complete cds. 6.1 4.0 1.0 3.7

37497 at L16499 412 Human orphan homeobox protein (PRH) mRNA, complete cds. -2.8 1.3 -7.4 -7.4

35434_at L16794 413 Human transcription factor (MEF2) mRNA, complete cds. -5.1 3.0 2.1 2.0

38637_at L16895 414 Human lysyl oxidase (LOX) gene, exon 7. 10 10.2 1.8 -1.4

35893_s_at L17418 415 Human complement receptor type 1 (alleles S and F) gene, exon 47 and complete cds's. 1.3 1.2 -19 -8.1

1271_g_at L19067 416 Human NF-kappa-B transcription factor p65 subunit mRNA, complete cds. 1.2 2.8 1.4 1.4

36645_at L19067 416 Human NF-kappa-B transcription factor p65 subunit mRNA, complete cds. 1.1 3.6 2.3 3.0

1295_at L19067 416 Human NF-kappa-B transcription factor p65 subunit mRNA, complete cds. 11 2.6 1.7 17

1272 at L19161 417 Human translation initiation factor elF-2 gamma subunit mRNA, complete cds. 1.5 1.0 3.3 10

35934_at L19161 417 Human translation initiation factor elF-2 gamma subunit mRNA, complete cds. 1.5 -18 2.5 -1.8

33768_at L19267 418 Homo sapiens 59 protein mRNA, 3' end. 1.3 2.8 3.0 2.2

664_at L19593 419 Homo sapiens interleukin 8 receptor beta (IL8RB) mRNA, complete cds. -3.0 -7.2 -6.2 -7.2

36637_at L19605 420 Homo sapiens 56K autoantigen annexin XI gene mRNA, complete cds. -14 -1.4 -2.3 -1.4

286_at L19779 421 Homo sapiens histone H2A.2 mRNA, complete cds. 14 4.2 2.6 2.3

287_at L19871 422 Human activating transcription factor 3 (ATF3) mRNA, complete cds. 10.8 1.0 3.3 3.9

1138 at L20859 423 Human leukemia virus receptor 1 (GLVR1 ) mRNA, complete cds. -5.1 5.1 6.4 5.7

Table 7. Genes identified by DNA chip analysis.

ratio ratio ratio ratio

Affy ID Genbank Seq ID Gene Bank Names E.coli KIM5 KIM6 yopH

33705 at L20971 425 Human phosphodiesterase mRNA, complete cds. -11 6.3 4.8 2.3 af17d01.s1 Soares_testis_NHT Homo sapiens cDNA clone IMAGE:1031905 3' similar to

SW:UBC3_HUMAN P49427 UBIQUITIN-CONJUGATING ENZYME E2-CDC34

1274_s_at L22005 426 COMPLEMENTING ;contains element TAR1 repetitive element ;, mRNA sequence. 1.1 -6.8 -4.4 -3.5

33635_at L22075 427 Human guanine nucleotide regulatory protein (G13) mRNA, complete cds. 1.2 -1.3 1.7 1.5

35718_at L22342 428 Human nuclear phosphoprotein mRNA, complete cds. -3.0 -21.0 -3.5 -4.4

Homo sapiens cathepsin B mRNA, 3' UTR with a stem-loop structure providing mRNA

32372_at L22569 429 stability. -7.5 -2.7 -1.1 -1.4

2069_s_at L23805 430 Human alphal (E)-catenin mRNA, complete cds. -1.5 1.2 -2.6 -2.3

36446_s_at L24521 431 Human transformation-related protein mRNA, 3" end. -4.7 -4.9 -1.3 -1.4

1394_at L25080 432 Homo sapiens GTP-binding protein (rhoA) mRNA, complete cds. 1.1 1.3 -1.2 -1.2

38427_at L25286 433 Homo sapiens alpha-1 type XV collagen mRNA, complete cds. 7.1 1.0 1.9 1.0

32432_f_at L25899 434 Human ribosomal protein L10 mRNA, complete cds. -1.0 1.7 1.2 -1.1

288_s_at L25931 435 Human lamin B receptor (LBR) mRNA, complete cds. -7.8 -9.2 -5.2 -6.8

34006_s_at L26318 436 Human protein kinase (JNK1) mRNA, complete cds. 3.8 8.1 3.4 7.2

2071_s_at L26318 436 Human JNK1 beta2 protein kinase (JNK1 B2) mRNA, complete cds. 3.8 10.8 3.3 -1.2

2070_i_at L26318 436 Human protein kinase (JNK1) mRNA, complete cds. 3.8 1.0 1.0 1.0

36925_at L26336 437 Human heat shock protein HSPA2 gene, complete cds. 2.8 3.1 1.1 1.1

645_at L26336 437 Human heat shock protein HSPA2 gene, complete cds. 2.8 1.0 1.0 1.0

36670_at L26339 438 Human autoantigen mRNA, complete cds. 1.0 -16 -3.2 -1.2

36682_at L27841 439 Human autoantigen pericentriol material 1 (PCM-1) mRNA, complete cds. -2.6 4.3 -2.4 1.9

1117_at L27943 440 Homo sapiens cytidine deaminase (CDA) mRNA, complete cds. -1.4 -1.4 -2.9 -2.0

1118_at L28175 441 Homo sapiens prostaglandin E2 receptor EP2 subtype mRNA, complete cds. 16.0 13.7 21.0 14.3

38188_s_at L28821 442 Homo sapiens alpha mannosidase II isozyme mRNA, complete cds. -8.3 -1.9 -1.9 -1.3

36885_at L28824 443 Homo sapiens protein tyrosine kinase (Syk) mRNA, complete cds. -5.3 -15.9 -15.9 -15.9

289_at L29277 444 Homo sapiens DNA-binding protein (APRF) mRNA, complete cds. 1.3 2.5 2.5 1.7

1398_g_at L32976 445 Human protein kinase (MLK-3) mRNA, complete cds. 2.4 2.2 1.0 1.4

1397 at L32976 445 Human protein kinase (MLK-3) mRNA, complete cds. 2.4 2.3 1.6 1.7

1825 at L33075 446 Homo sapiens ras GTPase-activating-like protein (IQGAP1) mRNA, complete cds. -11 -1.8 -2.0 -1.9

Table 7. Genes identified by DNA chip analysis.

ratio ratio ratio ratio

Affy ID Genbank Seq ID Gene Bank Names E.coli KIM5 KIM6 yopH

1483_at L34059 447 Homo sapiens cadherin-4 mRNA, complete cds. 3.2 2.0 -16 3.0

1399 at L34587 448 Homo sapiens RNA polymerase II elongation factor Sill, p15 subunit mRNA, complete cds. 1.4 -10 14 -1.0 Homo sapiens platelet/endothelial cell adhesion molecule-1 (PECAM-1) gene, exon 16 and

268_at L34657 449 complete cds. -1.6 -1.4 -2.4 -4.4

39530_at L35240 450 Human enigma gene, complete cds. -11 1.1 -1.4 1.0

40568_at L35249 451 Homo sapiens vacuolar H+-ATPase Mr 56,000 subunit (H057) mRNA, complete cds. -4.8 2.0 2.5 19

37733_at L35263 452 Human CSaids binding protein (CSBP1) mRNA, complete cds. -17 -4.9 -22.2 -11.8

40783_s_at L36151 453 Homo sapiens phosphatidylinositol 4-kinase mRNA, complete cds. -11 -1.2 1.1 1.3

2075_s_at L36719 454 Homo sapiens MAP kinase kinase 3 (MKK3) mRNA, complete cds. 3.0 11.1 5.2 6.4

32622 at L36983 455 Homo sapiens dynamin (DNM) mRNA, complete cds. 1.1 -36.1 -36.1 -2.9

40850_at L37033 456 Human FK-506 binding protein homologue (FKBP38) mRNA, complete cds. 2.0 -2.4 -1.5 -1.8

1486_at L37127 457 Homo sapiens RNA polymerase II mRNA, complete cds. 1.2 -26.4 -26.4 -26.4

36186_at L37368 458 Human (clone E5.1) RNA-binding protein mRNA, complete cds. 11 1.3 -1.4 -2.0

37985_at L37747 459 Homo sapiens lamin B1 gene, exon 11, complete cds. -7.9 1.4 11 -2.1

1487_at L38487 460 Human estrogen receptor-related protein (hERRal) mRNA, 3' end, partial cds. -10.0 3.5 2.3 3.0

36125_s_at L38696 461 Homo sapiens autoantigen p542 mRNA, complete cds. 13 J8.8 -2.9 -2.8

39064_at L38928 462 Homo sapiens 5,10-methenyltetrahydrofolate synthetase mRNA, complete cds. -1.6 -1.6 -1.8 -11

33657_at L38941 463 Homo sapiens ribosomal protein L34 (RPL34) mRNA, complete cds. 1.4 -7.6 -1.3 -14.1

632_at L40027 464 Homo sapiens glycogen synthase kinase 3 mRNA, complete cds. -19 1.3 -1.4 -1.2

363 2_at L40377 465 Homo sapiens cytoplasmic antiproteinase 2 (CAP2) mRNA, complete cds. 3.1 33.4 21.5 17.2

36625_at L40401 467 Homo sapiens (clone zap128) mRNA, 3' end of cds. 9.2 25.5 7.1 18.0

38216_at L40411 468 Homo sapiens thyroid receptor interactor (TRIP8) mRNA, 3' end of cds. 2.7 3.9 3.4 3.4

40815_g_at L40586 469 Homo sapiens iduronate-2-sulphatase (IDS) mRNA, complete cds. -1.4 1.4 -1.4 -1.2

40814_at L40586 469 Homo sapiens iduronate-2-sulphatase (IDS) mRNA, complete cds. -1.4 -4.1 -1.2 -1.4

40887_g_at L41498 470 Homo sapiens longation factor 1 -alpha 1 (PTI-1) mRNA, complete cds. 1.5 3.3 4.2 2.7

40886_at L41498 470 Homo sapiens longation factor 1 -alpha 1 (PTI-1) mRNA, complete cds. 1.5 2.4 3.1 1.7

903 at L42373 471 Homo sapiens phosphatase 2A B56-alpha (PP2A) mRNA, complete cds. -2.8 -19.1 -4.7 -4.8

Table 7. Genes identified by DNA chip analysis.

ratio ratio ratio ratio

Affy ID Genbank Seq ID Gene Bank Names E.coli KIM5 KIM6 yopH

38844 at L42451 472 Homo sapiens pyruvate dehydrogenase kinase isoenzyme 2 (PDK2) mRNA, complete cds. 1.1 -1.9 -1.8 3.1

36628_at L42542 473 Human RLIP76 protein mRNA, complete cds. -1.0 -17.5 -6.0 -16.1

38376_at L46590 475 Homo sapiens very long chain acyl-CoA dehydrogenase gene, exons 1-20, complete cds. 1.4 -8.4 -1.8 -19

37579_at L47738 476 Homo sapiens inducible protein mRNA, complete cds. -5.4 -7.1 -2.2 -2.2

Homo sapiens beta-globin (HBB) gene, with a to c allele 28 bp 5' to exon 1 , (J00179 bases

32052_at L48215 477 61971-63802). 1.6 2.8 -2.6 18

41203 at L49380 479 Homo sapiens clone B4 transcription factor ZFM1 mRNA, complete cds. -11 2.6 1.9 2.2

905_at L76200 481 Human guanylate kinase (GUK1) mRNA, complete cds. -1.0 2.0 1.1 1.4

34995_at L76380 482 Homo sapiens (clone HSNME29) CGRP type 1 receptor mRNA, complete cds. 1.7 1.0 1.0 10.1

641 at L76517 483 Homo sapiens (clone cc44) senilin 1 (PS1 ; S182) mRNA, complete cds. -1.2 3.5 3.5 19

41792_at L78207 484 Homo sapiens sulfonylurea receptor (SUR1) mRNA, complete cds. 18 2.7 3.2 5.6

36690_at M10901 485 Human mRNA for alpha-glucocorticoid receptor (clone 0B7). -5.7 -6.5 -4.8 -6.5

39328_at M11058 486 Human 3-hydroxy-3-methylglutaryl coenzyme A reductase mRNA, complete cds. 1.8 1.6 -1.6 -7.4

1104_s_at M11717 488 Human MHC class III HSP70-2 gene (HLA), complete cds. 4.4 -1.7 -3.7 -3.3

33218_at M11730 489 Human tyrosine kinase-type receptor (HER2) mRNA, complete cds. 2.0 1.0 1.0 1.0

1826 at M12174 490 Human ras-related rho mRNA (clone 6), partial cds. -2.3 -22.0 -33.7 -8.1

36636 at M 12267 491 Human ornithine aminotransferase mRNA, complete cds. -9.1 -6.2 12 1.1

34638_r at M 12963 492 Human class I alcohol dehydrogenase (ADH1) alpha subunit mRNA, complete cds. -1.5 3.2 -3.5 -3.5

31634_at M 13057 493 Human acidic proline-rich protein (PRH1) gene, complete cds. 1.0 2.6 15 4.2

35591_at M13142 494 Human factor XI (blood coagulation factor) mRNA, complete cds. 2.7 -1.6 1.5 -1.2

37377 j_at M 13452 495 Human lamin A mRNA, 3'end. 1.2 -1.1 -2.1 -1.2

37378_r_at 13452 495 Human lamin A mRNA, 3'end. 1.2 1.0 7.6 1.0

35016_at M 13560 496 Human la-associated invariant gamma-chain gene, exon 8, clones lambda-y(1 ,2,3). 1.2 1.3 -1.5 -11

1107_s_at M 13755 497 Human interferon-induced 1 -kDa/15-kDa protein mRNA, complete cds. -2.0 3.0 1.3 1.5

34593_g at M 13932 498 Human ribosomal protein S17 mRNA, complete cds. -1.6 -1.3 -1.3 -5.2

34592_at M13932 498 Human ribosomal protein S17 mRNA, complete cds. -1.6 -13.0 -13 -6.4

32412_at M13934 499 Human ribosomal protein S14 gene, complete cds. -1.4 -2.5 -2.6 -1.5

256 s at M14199 500 Human laminin receptor (2H5 epitope) mRNA, 5' end. 1.2 -2.2 -1.9 -2.6

Table 7. Genes identified by DNA chip analysis.

ratio ratio ratio ratio

Affy ID Genbank Seq ID Gene Bank Names E.coli KIM5 KIM6 yopH

38590_r_at M14630 501 Human prothymosin alpha mRNA, complete cds. 1.5 1.2 -11 -1.1

38589_i_at M14630 501 Human prothymosin alpha mRNA, complete cds. 1.5 -2.4 12 1.0

908_at M14660 502 Human ISG-54K gene (interferon stimulated gene) encoding a 54 kDA protein, exon 2. J3.2 -6.4 -6.2 -21.1

909_g_at M14660 502 Human ISG-54K gene (interferon stimulated gene) encoding a 54 kDA protein, exon 2. J3.2 -15.6 -7.6 -15.6

33308_at M15182 503 Human beta-glucuronidase mRNA, complete cds. 17 1.1 -12 -2.0

39402_at M15330 504 Human interleukin 1-beta (IL1B) mRNA, complete cds. 76.7 163.1 41.3 24.4

1402_at 16038 506 Human lyn mRNA encoding a tyrosine kinase. -2.0 1.1 1.1 -1.1

32616 at M 16038 506 Human lyn mRNA encoding a tyrosine kinase. -2.0 1.0 12 1.1

37105_at M16117 507 Human cathepsin G mRNA, complete cds. 3.4 1.9 -2.6 -1.8

33666_at M 16342 508 Human nuclear ribonucleoprotein particle (hnRNP) C protein mRNA, complete cds. 14 3.2 3.0 2.2

38034_at 16505 509 Human steroid sulfatase (STS) mRNA, complete cds. 10 4.9 1.4 7.6

Human hemopoietic cell protein-tyrosine kinase (HCK) gene, complete cds, clone lambda-

40742_at M16591 510 a2/1a. -1.3 -1.4 -2.0 -18

2045_s_at M 16592 511 Human hemopoietic cell protein-tyrosine kinase (HCK) gene, complete cds, clone HK24. -1.3 -1.4 -1.7 -1.7

1779_s at 16750 512 Human pim-1 oncogene mRNA, complete cds. -1.9 -11 -3.0 -1.1

41694_at M 17754 515 Human BN51 mRNA, complete cds. 16.2 4.6 -1.6 3.3

31956_f_at M 17886 516 Human acidic ribosomal phosphoprotein P1 mRNA, complete cds. 1.5 -16 -1.5 -1.9

31957_r_at M17886 516 Human acidic ribosomal phosphoprotein P1 mRNA, complete cds. 1.5 -1.6 -2.5 1.2

Human, intestinal fatty acid binding protein gene, complete cds, and an Alu repetitive

38587_at 18079 517 element. 4.8 1.0 1.0 1.0

38356_at M19481 518 Human follistatin gene, exon 6. 2.7 2.0 -12 1.5

1780_at M19722 519 Human fgr proto-oncogene encoded p55-c-fgr protein, complete cds. 15 2.4 2J 2.5

39443_s_at M19961 520 Human cytochrome c oxidase subunit Vb (coxVb) mRNA, complete cds. -1.2 -17 -2.0 -12

32523_at M20470 521 Human lymphocyte clathrin light-chain B mRNA, complete cds. -4.0 -1.4 10 -12

38657_s_at M20471 522 Human brain-type clathrin light-chain a mRNA, complete cds. -1.4 -1.4 -2.0 -11

31792_at M20560 523 Human lipocortin-lll mRNA, complete cds. -1.2 -2.0 -3.5 -5.4

36979 at M20681 524 Human glucose transporter-like protein-Ill (GLUT3), complete cds. 1.0 -1.3 -17 -1.6

Table 7. Genes identified by DNA chip analysis.

ratio ratio ratio ratio

Affy ID Genbank Seq ID Gene Bank Names E.coli KIM5 KIM6 yopH zw47c11.s1 Soares_total_fetus_Nb2HF8_9w Homo sapiens cDNA clone IMAGE:773204 3" similar to gb:M21154 S-ADENOSYLMETHIONINE DECARBOXYLASE PROENZYME

263_g_at M21154 525 (HUMAN);, mRNA sequence. -5.2 -3.2 -4.5 -22.3

262_at M21154 525 Human S-adenosylmethionine decarboxylase mRNA, complete cds. -5.2 -6.3 -5.8 -6.2

1110_at M21624 527 Human T-cell receptor delta chain mRNA (VJC-region), complete cds. 3.4 3.7 -13 2.6

34793_s_at M22299 528 Human T-plastin polypeptide mRNA, complete cds, clone p4. 3.0 3.2 -13 -13

39407_at M22488 530 Human bone morphogenetic protein 1 (BMP-1) mRNA. 4.8 10 2.7 11.2

39971_at M22637 531 Human LYL-1 protein mRNA, complete cds. -4.5 1.4 -2.0 -13

Human prolyl 4-hydroxylase beta-subunit and disulfide isomerase (P4HB) gene, exon 11 ,

36666_at M22806 532 clones 6B-(1 ,3,5,6). -7.5 12 1.8 2.2

33994_g_at M22919 533 Human nonmuscle/smooth muscle alkali myosin light chain gene, complete cds. 12 1.4 1.1 -17

1848_at M22995 534 Human ras-related protein (Krev-1) mRNA, complete cds. -11 -19 -1.9 -4.5

34636 at M23892 535 Human 15-lipoxygenase mRNA, complete cds. 14 -9.2 -2.8 J3.7

34608_at M24194 536 H Huummaann MHC protein homologous to chicken B complex protein mRNA, complete cds. 14 -1.7 -2.2 -4.0

34609 g at M24194 536 Human MHC protein homologous to chicken B complex protein mRNA, complete cds. 1.4 2.3 1.2 1.1

32640_at M24283 537 Human major group rhinovirus receptor (HRV) mRNA, complete cds. 7.3 31.6 42.2 15.0

32814_at M24594 538 Human mRNA for 56-KDa protein induced by interferon. -3.9 1.0 -1.5 -4.7

915_at M24594 538 Human mRNA for 56-KDa protein induced by interferon. -3.9 -17 -11.9 -19.5

35294_at M25077 539 Human SS-A/Ro ribonucleoprotein autoantigen 60 kd subunit mRNA, complete cds. 1.4 -2.9 -2.2 -2.9

31687_f_at M25079 540 Human sickle cell beta-globin mRNA, complete cds. 2.3 2.5 -2.4 1.7

32378_at M26252 542 Human TCB gene encoding cytosolic thyroid hormone-binding protein, complete cds. 2.0 -12 1.6 1.9

2048_s_at M26747 543 Human c-erbA mRNA, complete cds. 3.2 11.4 2.5 10.0

1367_f_at M26880 544 Human ubiquitin mRNA, complete cds. -15 2.4 12 2.3

1366_i_at M26880 544 Human ubiquitin mRNA, complete cds. -15 2.3 2.1 1.8

1368_at M27492 545 Human interleukin 1 receptor mRNA, complete cds. 2.0 7.1 5.5 2.2

877_at M27691 546 Human transactivator protein (CREB) mRNA, complete cds. 2.9 -2.6 -1.8 -2.6

1369_s_at M28130 547 Human beta-thromboglobulin-like protein mRNA, complete cds. 3.6 19.4 1.5 17.5

1116 at M28170 548 Human cell surface protein CD19 (CD19) gene, complete cds. -6.0 -1.1 -4.0 12

Table 7. Genes identified by DNA chip analysis.

ratio ratio ratio ratio

Affy ID Genbank Seq ID Gene Bank Names E.coli KIM5 KIM6 yopH

1074 at M28209 549 Homo sapiens GTP-binding protein (RAB1) mRNA, complete cds. 1.8 5.1 7.0 4.4

623 s at M28213 550 Homo sapiens GTP-binding protein (RAB2) mRNA, complete cds. -3.5 -5.2 -12 -3.8

36668 at M28713 551 Homo sapiens NADH-cytochrome b5 reductase (b5R) gene, exon 9. 1.3 1.7 -1.2 1.1

1076 at M28983 552 Homo sapiens interleukin 1 alpha (IL 1) mRNA, complete cds. -1.9 -5.1 -5.1 -5.1

2049 s at M29039 553 Human transcription factor junB (junB) gene, 5' region and complete cds. 3.4 2.4 2.0 -12

36654 s at M29065 554 Human hnRNP A2 protein mRNA. 3.7 2.1 2.3 -11

39780 at M29551 555 Human calcineurin A2 mRNA, complete cds. 10 1.0 1.0 10.5

32893 s at M30474 557 Human kidney gamma-glutamyl transpeptidase type II mRNA, 3' end. 1.6 19.1 31.0 26.9

879 at M30818 558 Human interferon-induced cellular resistance mediator protein (MxB) mRNA, complete cds. -16 1.7 13 1.4

38733 at M30938 559 Human Ku (p70/p80) subunit mRNA, complete cds. -5.4 -3.1 -3.1 -3.0

585 at M30938 559 Human Ku (p70/p80) subunit mRNA, complete cds. -5.4 -5.2 -3.4 -5.8

1491 at M31166 561 Human tumor necrosis factor-inducible (TSG-14) mRNA, complete cds. 113 10.9 6.1 3.3

39695 at M31516 562 Human decay-accelerating factor mRNA, complete cds. 2.1 9.7 8.3 3.5

32315 at M31520 563 Human ribosomal protein S24 mRNA. -10 13 -14 -2.1

40137 at M31724 564 Human phosphotyrosyl-protein phosphatase (PTP-1 B) mRNA, complete cds. 1.5 -5.7 -2.0 -5.7

37688 f at M31932 565 Human IgG low affinity Fc fragment receptor (FcRlla) mRNA, complete cds. -2.4 -3.9 -1.7 -2.7

1375_s_at M32304 567 Human tissue inhibitor of metalloproteinases-2 (TlMP-2) gene, exon 5 and complete cds. -13 -2.9 -15 -13

1583_at M32315 568 Human tumor necrosis factor receptor mRNA, complete cds. -16 3.9 3.2 4.0

36601 _at M33308 570 Human vinculin mRNA, complete cds. -2.5 1.3 13 -1.1

1492 f at M33317 571 Human cytochrome P450IIA4 (CYP2A4) mRNA, complete cds. -2.8 10.4 2.7 4.2

Human cAMP-dependent protein kinase type l-alpha subunit (PRKAR1 A) mRNA, complete

227_g_at M33336 572 cds. -2.7 -14 -2.0 -2.6

226_at M33336 572 cds. -2.7 -1.1 -1.4 -1.7 33913_at M33509 573 Human HLA-B-associated transcript 2 (BAT2) mRNA, complete cds. 1.1 -2.2 -1.9 -11 33838_at M33519 574 Human HLA-B-associated transcript 3 (BAT3) mRNA, complete cds. 1.1 1.2 1.8 -2.2

1081_at M33764 576 Human ornithine decarboxylase gene, complete cds. 1.9 5.9 2.8 1.3 37014 at M33882 577 Human p78 protein mRNA, complete cds. -1.4 -15 -2.3 -2.3

Table 7. Genes identified by DNA chip analysis.

ratio ratio ratio ratio

Affy ID Genbank Seq ID Gene Bank Names E.coli KIM5 KIM6 yopH

Human testis-specific cAMP-dependent protein kinase catalytic subunit (C-beta isoform)

36215_at M34181 578 mRNA, complete cds. 7.1 -2.0 -2.0 -2.0

37742_at M34423 579 Human beta-galactosidase (GLB1) mRNA, complete cds. -1.8 2.7 -2.6 -2.0 Human interferon-gamma-inducible indoleamine 2,3-dioxygenase (IDO) mRNA, complete

36804_at M34455 580 cds. -11 -2.0 -2.3 -6.9

880_at M34539 581 Human FK506-binding protein (FKBP) mRNA, complete cds. -14 -1.3 -2.6 -7.6

37907_at M34677 582 Human nested gene protein gene, complete cds. -5.9 1.1 -15 -2.1

228_at M35416 583 Human GTP-binding protein (RALB) mRNA, complete cds. -1.4 -2.7 -18 -16

39736_at M35543 584 Human GTP-binding protein (G25K) mRNA, complete cds. 3.6 1.0 1.0 1.0

32806_at M36035 585 Human peripheral benzodiazepine receptor (hpbs) mRNA, complete cds. -13 -2.2 -3.6 -2.0

33987_at M36340 586 Human ADP-ribosylation factor 1 (ARF1) mRNA, complete cds. 14 1.7 14 1.8

36585_at M36341 587 Human ADP-ribosylation factor 4 (ARF4) mRNA, complete cds. 1.7 6.3 6.2 3.9

37418_at M36653 588 Human Oct-2 factor mRNA, complete cds. 1.0 1.6 1.9 2.9

34022_at M36821 590 Human cytokine (GRO-gamma) mRNA, complete cds. 8.0 7.0 5.2 7.0

1085_s_at M37238 592 Human phospholipase C mRNA, complete cds. -1.3 10 -1.2 -1.7

39337 at M37583 593 Human histone (H2A.Z) mRNA, complete cds. -19 -3.0 -3.4 -17.1

1830_s_at M38449 594 Human transforming growth factor-beta mRNA, complete cds, clone pTGF-beta-trpl 14. 1.1 -1.8 -2.3 -1.2

39389_at M38690 595 Human CD9 antigen mRNA, complete cds. -2.4 -4.0 -1.2 -2.8

883_s_at M54915 596 Homo sapiens protein kinase-related oncogene (PIM1) mRNA, complete cds. -3.0 -1.8 -2.3 -1.2

40159_r_at M55067 597 Human 47-kD autosomal chronic granulomatous disease protein mRNA, complete cds. -15 -2.4 -5.4 -3J

40258_at M55265 598 Human casein kinase II alpha subunit mRNA, complete cds. 1.4 2.0 -1.8 2.8

36313_at M55267 599 Human EV12 protein gene, exon 1 -2.6 -1.0 -1.8 -1.6

1267_at M55284 600 Human protein kinase C-L (PRKCL) mRNA, complete cds. -18 8.9 9.9 -1.2

35735_at M55542 601 Human guanylate binding protein isoform I (GBP-2) mRNA, complete cds. 2.8 7.2 4.6 2.8

32700_at M55543 602 Human guanylate binding protein isoform II (GBP-2) mRNA, complete cds. 1.8 1.7 1.4 -1.1

39778_at M55621 603 Human N-acetylglucosaminyltransferase I (GlcNAc-TI) mRNA, complete cds. -2.4 1.9 1.5 2.0

31680_at M55630 604 Human topoisomerase I pseudogene 2. -1.8 2.8 2.6 2.8

2035_s_at M55914 605 Human alpha enolase mRNA, complete cds. -2.2 1.1 -1.4 1.3

Table 7. Genes identified by DNA chip analysis.

ratio ratio ratio ratio

Affy ID Genbank Seq ID Gene Bank Names E.coli KIM5 KIM6 yopH

37346 at M57567 606 Human ADP-ribosylation factor (hARF5) mRNA, complete cds. 1.4 -1.3 -1.8 -1.8

40358_at M57609 607 Human DNA-binding protein (GLI3) mRNA, complete cds. 3.1 1.0 1.0 1.0

37984 s at M57763 608 Human ADP-ribosylation factor (hARFδ) mRNA, complete cds. -2.2 -2.5 -2.0 -1.5

1268_at M58028 609 Human ubiquitin-activating enzyme E1 (UBE1 ) mRNA, complete cds. 1.8 -1.3 -2.0 -1.8

1563 s at M58286 610 Human tumor necrosis factor receptor mRNA, complete cds. -1.4 -1.0 -2.2 -3.0

34643_at M58458 611 Human ribosomal protein S4 (RPS4X) isoform mRNA, complete cds. 1.2 2.9 1.0 1.1

32667__at M58526 612 Human alpha-5 collagen type IV (COL4A5) mRNA, 3' end. 2.1 1.0 10 5.2

38438 at M58603 613 Human nuclear factor kappa-B DNA binding subunit (NF-kappa-B) mRNA, complete cds. 4.4 15.5 12.2 9.9 zn44d12.s1 Stratagene HeLa cell s3 937216 Homo sapiens cDNA clone IMAGE:550295 3' similar to gb:M58603 NUCLEAR FACTOR NF-KAPPA-B P105 SUBUNIT (HUMAN);,

1378_g_at M58603 613 mRNA sequence. 4.4 35.5 24.9 22.5

1377_at M58603 613 Human nuclear factor kappa-B DNA binding subunit (NF-kappa-B) mRNA, complete cds. 4.4 20.6 18.2 10.4

32833 at M59287 615 Human protein kinase mRNA. -1.6 -1.1 -1.5 -1.8

34223_at M59818 616 Human granulocyte colony-stimulating factor receptor (G-CSFR-1 ) mRNA, complete cds. 11 -1.4 -1.6 -16

596_s_at M59820 617 Human granulocyte colony-stimulating factor receptor (G-CSFR-1) mRNA, complete cds. 1.1 -12 -1.6 -1.2

237_s_at M60483 618 Human mRNA for protein phosphatase 2A (alpha-type). 1.1 1.6 1.4 -3.7

32181_at M60922 620 Human surface antigen mRNA, complete cds. -1.6 -5.6 -18.4 -6.0

38278_at M62324 621 Human modulator recognition factor I (MRF-1 ) mRNA, 3' end. -8.6 -11 -1.8 -11

37126_at M62800 623 Human 52-kD SS-A/Ro autoantigen mRNA, complete cds. -9.7 -2.9 -3.0 -3.5

239_at M63138 625 Human cathepsin D (catD) gene, exons 7, 8, and 9. -1.2 2.0 1.6 2.2

1564_at M63167 626 Human rac protein kinase alpha mRNA, complete cds. 1.4 -41.7 -5.7 -4.0

38068_at M63175 627 Human autocrine motility factor receptor mRNA. 6.3 3.3 -1.1 -1.2

35823_at M63573 628 Human secreted cyclophilin-like protein (SCYLP) mRNA, complete cds. 1.0 -17.8 -17.8 -17.8

37220_at M63835 629 Human IgG Fc receptor I gene, exon 6 and complete cds. -7.8 -8.6 -2.1 -1.5

1456_s_at M63838 630 Human interferon-gamma induced protein (IFI 16) gene, complete cds. -1.0 -4.0 -1.4 -1.4

35380_at M63896 631 Homo sapiens transcriptional enhancer factor (TEF1 ) DNA, complete CDS. 5.6 1.4 1.0 1.0

Table 7. Genes identified by DNA chip analysis.

ratio ratio ratio ratio

Affy ID Genbank Seq ID Gene Bank Names E.coli KIM5 KIM6 yopH

40365_at M63904 632 Human G-alpha 16 protein mRNA, complete cds. 2.5 11.8 10.2 9.1

36194_at M63959 633 Human alpha-2-macroglobulin receptor-associated protein mRNA, complete cds. -1.7 -32.2 -4.0 -4.2

36101_s_at M63978 634 Human vascular endothelial growth factor gene, exon 8. 8.0 203.5 298.4 191.3

31504_at M64098 635 Human high density lipoprotein binding protein (HBP) mRNA, complete cds. -1.5 1.6 -1.5 1.6

1457_at M64174 636 Human protein-tyrosine kinase (JAK1) mRNA, complete cds. -1.6 1.2 -11 -1.1

2016_s_at M64241 637 Human Wilm's tumor-related protein (QM) mRNA, complete cds. 1.2 1.9 1.5 -1.3

32226_at M64571 638 Human microtubule-associated protein 4 mRNA, complete cds. 2.5 -5.4 -1.8 -1.3 zo01 b05.s1 Stratagene colon (#937204) Homo sapiens cDNA clone IMAGE:566385 3' similar to gb:M64571 MICROTUBULE-ASSOCIATED PROTEIN 4 (HUMAN);, mRNA

243 g_at M64571 638 sequence. 2.5 2.1 -1.7 1.7

32737_at M64595 639 Human small G protein (Gx) mRNA, 3" end. 1.1 1.6 1.1 1.8

31573_at M64716 640 Human ribosomal protein S25 mRNA, complete cds. -1.9 -16.7 -1.4 -11

32207_at M64925 641 Human palmitoylated erythrocyte membrane protein (MPP1) mRNA, complete cds. -1.0 1.2 1.8 2.1

1383_at M64929 642 Human protein phosphatase 2A alpha subunit mRNA, complete cds. -2.0 1.3 1.2 -1.3

41167_at M64929 642 Human protein phosphatase 2A alpha subunit mRNA, complete cds. -2.0 2.1 3.4 16

37995_s_at M67468 643 Human Fragile X mental retardation 1 FMR-1 gene, 3' end, clones BC72 and BC22. -3.5 1.3 -3.7 -2.1 aa08g07.s1 Soares_NhHMPu_S1 Homo sapiens cDNA clone IMAGE:812700 3' similar to

1792_g_at M68520 644 gb:M68520 CELL DIVISION PROTEIN KINASE 2 (HUMAN);, mRNA sequence. 4.4 -2.3 4.5 6.8

1459_at M68941 645 Human protein-tyrosine phosphatase mRNA, complete cds. -15 6.2 1.0 1.0

33665 s_at M73832 648 Human GM-CSF receptor (GM-CSF receptor) mRNA, complete cds. -1.1 1.6 -1.3 -2.7

32183_at M74002 649 Human arginine-rich nuclear protein mRNA, complete cds. -2.8 3.6 -1.3 -2.2

37178_at M74089 650 Human TB1 gene mRNA, 3' end. 1.4 10.2 3.0 3.3

31823_at M74099 651 Human displacement protein (CCAAT) mRNA. -2.1 1.1 -5.4 -5.4

39336_at M74491 652 Human ADP-ribosylation factor 3 mRNA, complete cds. 1.2 -3.2 -2.3 -3.2

36729_g_at M76446 653 Human alpha-A1-adrenergic receptor mRNA, complete cds. 1.0 3.6 2.3 3.0

32186_at M80244 654 Human E16 mRNA, complete cds. 39.7 61.6 46.2 30.1

35017_f_at M80469 656 Human MHC class I HLA-J gene, exons 1-8 and complete cds. -1.0 13 -1.5 1.1

37027 at M80899 657 Human novel protein AHNAK mRNA, partial sequence. 1.6 3.0 1.8 2.9

36773 f at M81141 658 Human MHC class II HLA-DQ-beta mRNA (DR7 DQw2), complete cds. 1.2 -1.1 -1.1 -1.1

Table 7. Genes identified by DNA chip analysis.

ratio ratio ratio ratio

Affy ID Genbank Seq ID Gene Bank Names E.coli KIM5 KIM6 yopH

33551 _s_at M81778 662 Human serotonin 5-HT1C receptor mRNA, complete cds. -1.2 -2.3 -2.3 2.1

37372_at M81780 663 #N/A 4.9 1.0 6.1 7.0

40067_at M82882 664 Human cis-acting sequence. -5.5 -6.3 1.3 -18

32210_at M83088 665 Human phosphoglucomutase 1 (PGM1) mRNA, complete cds. -1.1 1.7 -1.5 1.6

570_at M83221 666 Homo sapiens l-Rel mRNA, complete cds. -11 4.8 3.3 4.3

1052_s_at M83667 667 Human NF-IL6-beta protein mRNA, complete cds. -24.3 -8.9 -19.6 -8.8

40739 at M83670 668 Human carbonic anhydrase IV mRNA, complete cds. -2.2 1.2 -2.1 -1.3

206_at M84424 669 Human cathepsin E (CTSE) gene, exon 9 and complete cds. 4.2 3.4 10 1.0

40282_s_at M84526 670 Human adipsin/complement factor D mRNA, complete cds. -1.5 -1.3 -2.1 -15

37095_r_at M84562 671 Human formyl peptide receptor-like receptor (FPRL1) mRNA, complete cds. -1.8 2.9 1.2 1.6

1653_at M84711 672 Human v-fos transformation effector protein (Fte-1), mRNA complete cds. -1.6 -1.7 -1.8 -1.7

38666_at M85169 673 Human homologue of yeast sec7 mRNA, complete cds. -1.2 -2.5 -2.5 J0.8

32340_s_at M85234 674 Human nuclease sensitive element binding protein-1 mRNA, complete cds. 1.1 3.3 3.1 2.7

1235_at M86400 675 Human phospholipase A2 mRNA, complete cds. 10 3.4 2.3 2.1

571_at M86667 676 H.sapiens NAP (nucleosome assembly protein) mRNA, complete cds. -2.2 1.7 1.3 -3.0

39263 at M87434 677 Human 71 kDa 2'5' oligoadenylate synthetase (p69 2-5A synthetase) mRNA, complete cds. 1.0 5.0 2.0 3.6

38517_at M87503 678 Human IFN-responsive transcription factor subunit mRNA, complete cds. -15 11 1.1 -15

574 s at M87507 679 Human interleukin 1-beta converting enzyme isoform beta (IL1 BCE) mRNA, complete cds. -1.3 -1.8 -1.5 -2.3

39346_at M88108 680 Human p62 mRNA, complete cds. -1.7 2.1 1.2 1.0

38729_at M88279 681 Human immunophilin (FKBP52) mRNA, complete cds. 1.8 10.9 4.2 1.0

41239_r_at M90696 682 Human cathepsin S (CTSS) mRNA, complete cds. 11 -1.0 -15 1.3

38417_at M91029 683 Human AMP deaminase (AMPD2) mRNA. -3.2 -1.9 -3.3 -2.8

38585_at M91036 684 #N/A -1.7 7.5 10 1.2

35868_at M91211 685 Human receptor for advanced glycosylation end products (RAGE) mRNA, partial cds. 1.4 -2.5 -5.6 -2.8

35225_at M91592 686 Human zinc-finger protein (ZNF76) gene, partial cds. 6.3 1.0 1.8 1.0

40619 at M91670 687 Human ubiquitin carrier protein (E2-EPF) mRNA, complete cds. 6.8 7.0 4.5 2.9

Table 7. Genes identified by DNA chip analysis.

ratio ratio ratio ratio

Affy ID Genbank Seq ID Gene Bank Names E.coli KIM5 KIM6 yopH zt76g01.s1 Soares_testis_NHT Homo sapiens cDNA clone IMAGE:728304 3' similar to

1795_g_at M92287 688 gb:M92287 G1/S-SPECIFIC CYCLIN D3 (HUMAN);, mRNA sequence. -5.6 -6.6 -6.6 -7.5

1794_at M92287 688 Homo sapiens cyclin D3 (CCND3) mRNA, complete cds. -5.6 -5.2 -4.3 -3.5

31481_s_at M92383 690 Homo sapiens thymosin beta-10 gene, 3'end. -11 -2.0 -2.2 -2.1

33305_at M93056 692 Human mononcyte/neutrophil elastase inhibitor mRNA sequence. 1.8 2.0 1.1 1.1

1463_at M93425 693 Human protein tyrosine phosphatase (PTP-PEST) mRNA, complete cds. 1.0 2.2 1.7 1.2

32553 at M94046 694 Human zinc finger protein (MAZ) mRNA. 1.6 -1.0 -1.7 -10

33677 at M94314 695 Homo sapiens ribosomal protein L30 mRNA, complete cds. 13 3.8 3.5 1.4

38016_at M94630 696 Homo sapiens hnRNP-C like protein mRNA, complete cds. -3.1 4.1 -1.2 1.4

39330 s at M95178 697 Human non-muscle alpha-actinin mRNA, complete cds. 1.3 -1.3 -1.6 -1.3

210_at M95678 698 Homo sapiens phospholipase C-beta-2 mRNA, complete cds. 1.1 -2.9 -4.9 -4.2

1654 at M95712 699 Human B-raf mRNA, complete cds. 2.4 5.2 1.3 -1.6

37855_at M95767 700 Homo sapiens di-N-acetylchitobiase mRNA, complete cds. -1.0 -1.3 -1.8 -3.8

36931_at M95787 701 Human 22kDa smooth muscle protein (SM22) mRNA, complete cds. -3.5 3.0 1.2 1.3

38782_at M95809 702 Human basic transcription factor 62kD subunit (BTF2), complete cds. -2.7 6.2 6.2 4.7

40817_at M96824 703 Human nucleobindin precursor mRNA, complete cds. 2.3 -1.7 -2.6 -2.7

36517_at M96982 704 Homo sapiens U2 snRNP auxiliary factor small subunit, complete cds. -11 2.0 2.0 -1.3

1565 s at M96995 705 Human GRB2 isoform mRNA. 1.1 2.5 1.7 1.9

Homo sapiens epidermal growth factor receptor-binding protein GRB2 (EGFRBP-GRB2)

33855 at M96995 705 mRNA sequence. 1.1 12 -1.0 1.0

32621 at M97388 706 Human TATA binding protein-associated phosphoprotein (DR1) mRNA, complete cds. -2.3 -6.6 -2.4 -6.6

32860 g_at M97935 707 Homo sapiens transcription factor ISGF-3 mRNA, complete cds. -16 -1.0 -1.2 -3.4

39861 at M98343 708 Homo sapiens amplaxin (EMS1) mRNA, complete cds. 1.0 25.4 2.0 13.6

38008 at M98528 709 Homo sapiens neuron-specific protein gene, last exon, clone D4S234. 1.0 2.3 -1.0 1.5

41425 at M98833 710 Homo sapiens ERGB transcription factor mRNA, complete cds. 2.4 -4.9 -4.4 -4.9

38234 at M99438 711 Human transducin-like enhancer protein (TLE3) mRNA, complete cds. -3.4 -1.2 1.1 1.3

40692 at M99439 712 Human transducin-like enhancer protein (TLE4) mRNA, 3' end. -1.6 -7.1 -4.0 -7.1

38317 at M99701 713 Homo sapiens (pp21) mRNA, complete cds. 5.7 2.4 3.2 3.3

35841 at N24355 714 #N/A 1.5 -1.2 1.2 1.1

Table 7. Genes identified by DNA chip analysis.

ratio ratio ratio ratio

Affy ID Genbank Seq ID Gene Bank Names E.coli KIM5 KIM 6 yopH

34210_at N90866 715 #N/A 1.1 -14.5 -1.7 -5.0

39798_at R87876 716 #N/A -13 1.1 1.6 1.2 CD68=110kda transmembrane glycoprotein [human, promonocyte cell line U937, mRNA,

33391_r_at S57235 717 1722 nt]. 4.4 10 9.4 6.5

33944_at S60099 718 APPH=amyloid precursor protein homolog [human, placenta, mRNA, 3727 nt]. 1.0 1.5 1.3 11 TLS/CHOP=hybrid gene {translocation breakpoint} [human, myxoid liposarcomas cells,

39420_at S62138 719 mRNA Mutant, 1682 nt]. 3.1 8.2 10.5 6.5

39180_at S62140 720 TLS=transiocated in liposarcoma [human, mRNA, 1824 nt]. 11 16 1.5 1.6

872 i at S62539 721 insulin receptor substrate-1 [human, skeletal muscle, mRNA, 5828 nt]. 3.4 6.0 -1.2 -1.2 RBP2=retinoblastoma binding protein 2 [human, Nalm-6 pre-B cell leukemia, mRNA, 6455

1785 at S66431 722 nt]. -15 1.1 12 -4.0

Homo sapiens cyclic AMP-responsive element modulator beta isoform (CREM) mRNA,

32065_at S68134 723 complete cds. 10 13.7 20.3 7.6

32681_at S68616 724 Na+/H+ exchanger NHE-1 isoform [human, heart, mRNA, 4516 nt]. 2.2 2.1 1.8 1.9

32175_at S72008 725 hCDC10=CDC10 homolog [human, fetal lung, mRNA, 2314 nt]. -19 -1.6 -2.4 -2.3

IK=IK factor [human, leukemic cells K562, chronic myeloid leukemia patient, mRNA, 756

218 at S74221 728 nt]. -2.5 -1.4 -4.6 -3.1

545_g_at S76638 729 p50-NF-kappa B homolog [human, peripheral blood T cells, mRNA, 3113 nt]. 2.4 15.9 8.4 10.3

544_at S76638 729 p50-NF-kappa B homolog [human, peripheral blood T cells, mRNA, 3113 nt]. 2.4 29.4 17.3 16.1

37983_at S77410 730 type 1 angiotensin II receptor [human, liver, mRNA, 2268 nt]. -19 8.0 -1.7 -1.7 nuclear factor erythroid 2 isoform f=basic leucine zipper protein {alternatively spliced, exon

37179_at S77763 731 1f} [human, fetal liver, mRNA, 1678 nt]. -3.0 -90.4 -90.4 -22.4

37210_at S78296 732 neurofilament-66 [human, fetal brain, mRNA, 3197 nt]. -2.2 4.6 3.1 6.4

36210 g_at S78771 733 NAT=CpG island-associated gene [human, mRNA, 1741 nt]. 1.2 2.5 1.6 -1.5

36209_at S78771 733 NAT=CpG island-associated gene [human, mRNA, 1741 nt]. 1.2 2.1 2.6 1.7

34570_at S79522 734 ubiquitin carboxyl extension protein [human, mRNA, 540 nt]. -10 2.1 1.0 1.0 p72syk {G insertion nucleotide 92} [human, Jurkat E6-1 J.CaMI cells, mRNA Partial

548_s_at S80267 735 Mutant, 1909 nt]. -6.2 -3.2 -2.6 -1.2

36447 at S80990 736 ficolin [human, uterus, mRNA, 1736 nt]. -11 -2.2 -2.5 -2.2

Table 7. Genes identified by DNA chip analysis.

ratio ratio ratio ratio

Affy ID Genbank Seq ID Gene Bank Names E.coli KIM5 KIM6 yopH

L-UBC=ubiquitin conjugating enzyme [human, odontogenic keratocysts, mRNA Partial, 683

223 at S81003 737 nt]. -1.6 -3.3 -7.8 -1.7

1237_at S81914 738 IEX-1=radiation-inducible immediate-early gene [human, placenta, mRNA Partial, 1223 nt]. 4.8 34.3 19.9 17.8

40714_at S82198 739 caldecrin=serum calcium-decreasing factor [human, pancreas, mRNA Partial, 894 nt]. 1.4 1.0 7.6 1.2

201_s_at S82297 740 Human beta-2-microglobulin gene, exons 2 and 3. 4.4 -1.0 1.3 -1.4

858_at S90469 742 cytochrome P450 reductase [human, placenta, mRNA Partial, 2403 nt]. -1.4 -15.0 -2.1 -2.4

32538_at S95936 743 transferrin [human, liver, mRNA, 2347 nt]. 5.6 3.0 1.2 2.6

40872 at T57872 744 #N/A -1.2 -1.9 -2.1 -6.9

40091_at U00115 745 Human zinc-finger protein (bcl-6) mRNA, complete cds. -1.4 -2.9 -1.2 -1.6

40252_g_at U00943 747 Human clone A9A2BRB2 (CAC)n/(GTG)n repeat-containing mRNA. 8.9 1.9 1.2 -2.0

40251_at U00943 747 Human clone A9A2BRB2 (CAC)n/(GTG)n repeat-containing mRNA. 8.9 1.0 1.3 1.0

38063_at U00952 748 Human clone A9A2BRB7 (CAC)n/(GTG)n repeat-containing mRNA. -1.2 -1.5 -2.3 -6.1

32135_at U00968 749 Human SREBP-1 mRNA, complete cds. -3.4 -1.4 1.1 1.8

39058_at U01147 750 Human guanine nucleotide regulatory protein (ABR) mRNA, complete cds. 2.0 -9.5 -1.8 -4.1

41132 r_at U01923 751 Human BTK region clone ftp-3 mRNA. -1.9 1.2 1.3 11

38527_at U02493 753 Human 54 kDa protein mRNA, complete cds. -1.9 -1.5 1.1 -1.5

553_g_at U02570 754 Human CDC42 GTPase-activating protein mRNA, partial cds. -3.8 -2.9 -7.9 -4.2

38526_at U02882 755 Human rolipram-sensitive 3',5'-cyclic AMP phosphodiesterase mRNA, complete cds. 1.0 13.3 3.2 3.3

41155_at U03100 756 Human alpha2(E)-catenin mRNA, complete cds. -1.5 -3.7 -1.5 -8.8

41 156_g_at U03100 756 Human alpha2(E)-catenin mRNA, complete cds. -1.5 -2.7 -1.4 -8.1

2031 s at U03106 758 Human wild-type p53 activated fragment-1 (WAF1 ) mRNA, complete cds. 5.4 55.5 53.5 30.7

35000 at U03398 759 Human receptor 4-1 BB ligand mRNA, complete cds. 1.6 1.0 1.0 1.0

184_at U03642 760 Human G protein-coupled receptor APJ gene, complete cds. 1.0 6.6 3.3 5.9

37980 at U03644 761 Human recepin mRNA, complete cds. -1.8 -2.6 -3.0 -1.8

36641_at U03851 762 Human capping protein alpha mRNA, partial cds. -3.9 -1.8 -2.1 -2.6

36327_at U03884 763 Human inwardly rectifying K+ channel (ROMK1) mRNA, complete cds. 6.7 5.7 1.0 1.0

36270_at U04343 764 Human CD86 antigen mRNA, complete cds. 3.3 5.4 1.3 1.8

1069 at U04636 765 Human cyclooxygenase-2 (hCox-2) gene, complete cds. 12.2 6.9 8.1 1.3

Table 7. Genes identified by DNA chip analysis.

ratio ratio ratio ratio

Affy ID Genbank Seq ID Gene Bank Names E.coli KIM5 KIM6 yopH

185_at U04840 766 Human onconeural ventral antigen-1 (Nova-1) mRNA, complete cds. 6.7 6.6 1.7 7.4

41091_at U05237 767 Human fetal Alz-50-reactive clone 1 (FAC1) mRNA, complete cds. -3.7 -3.4 -11 -1.4

1796_s_at U05681 768 Human B-cell lymphoma 3-encoded protein (bcl-3) mRNA, complete cds. 5.4 4.3 2.5 3.2

37747_at U05770 769 Human annexin V (ANX5) gene, exon 13. 1.0 4.3 8.5 4.8

32100_r_at U06088 771 Human N-acetylgalactosamine 6-sulphatase (GALNS) gene, exon 14. -8.9 -2.2 -23.5 -23.5 zu09a06.s1 Soares_testis_NHT Homo sapiens cDNA clone IMAGE:7313143' similar to

519_g_at U07132 772 TR:G555752 G555752 RLD-1 ;, mRNA sequence. 1.8 2.0 1.2 1.3

37911_at U07158 773 Human syntaxin mRNA, complete cds. 1.6 4.5 5.1 3.7

520_at U07358 774 Human protein kinase (zpk) mRNA, complete cds. 3.7 4.5 2.0 5.9

36880_at U07736 775 Human quinone oxidoreductase2 (NQ02) gene, exon 7, complete cds. -15 1.1 -4.6 J0.3

1710_s_at U07804 777 Human topoisomerase I mRNA, complete cds. 2.8 16.7 4.5 1.6

1030_s_at U07806 778 Human topoisomerase I mRNA, complete cds. -1.8 3.8 2.7 1.8

865_at U08316 779 Human insulin-stimulated protein kinase 1 (ISPK-1) mRNA, complete cds. 1.4 -2.6 -1.6 -4.8

Human homolog of Drosophila splicing regulator suppressor-of-white-apricot mRNA,

38478_at U08377 780 complete cds. -2.8 1.2 -4.9 1.6

33068_f_at U08854 781 Human UDP glucuronosyltransferase precursor (UGT2B15) mRNA, complete cds. 1.3 12.0 7.0 10.8

Human N-methyl-D-aspartate receptor modulatory subunit 2A (hNR2A) mRNA, complete

38236_at U09002 782 cds. 3.5 -11 -1.2 2.2

38397_at U09196 783 Human 1.1 kb mRNA upregulated in retinoic acid treated HL-60 neutrophilic cells. 1.2 1.0 -3.9 1.4

1031_at U09564 784 Human serine kinase mRNA, complete cds. -1.4 2.3 1.5 -1.1

1637_at U09578 785 Homo sapiens MAPKAP kinase (3pK) mRNA, complete cds. -6.1 -15.5 -15.5 -6.8

39412_at U09825 786 Human acid finger protein mRNA, complete cds. -1.5 -1.4 -1.9 -8.4

41713_at U09848 787 Human zinc finger protein (ZNF139) mRNA, partial cds. -2.0 2.6 1.0 2.7

37998_at U09877 788 Human helicase-like protein (HLP) mRNA, complete cds. -5.1 -13.5 J3.5 -13.5

189_s_at U09937 789 H.sapiens urokinase plasminogen activator surface receptor (uPAR) mRNA. 7.8 66.3 8.2 30.6

36358_at U09953 790 Human ribosomal protein L9 mRNA, complete cds. -1.5 -2.5 1.3 2.8

35974_at U 10485 791 Human lymphoid-restricted membrane protein (Jaw1) mRNA, complete cds. -4.2 -2.8 -4.3 -3.4

1924_at U11791 792 Human cyclin H mRNA, complete cds. -11 5.1 3.5 2.0

39029 at U11861 793 Human G10 homolog (edg-2) mRNA, complete cds. -1.0 -3.5 -3.5 -3.4

1353_g_at U11870 794 Homo sapiens interleukin 8 receptor alpha (IL8RA) mRNA, complete cds. -3J -7J -9.0 -8.9

Table 7. Genes identified by DNA chip analysis.

ratio ratio ratio ratio

Affy ID Genbank Seq ID Gene Bank Names E.coli KIM5 KIM6 yopH

1352 at U11870 794 Human interleukin-8 receptor type A (IL8RBA) gene, promoter and complete cds. -3.1 -7.1 -6.6 -8.8

1033_g at U11872 795 Homo sapiens interleukin 8 receptor beta (IL8RB) mRNA, complete cds. -1.7 -3.6 -6.6 -8.5

41143 at U 12022 796 Human calmodulin (CALM1 ) gene, exons 2,3,4,5 and 6, and complete cds. -11 -2.2 -1.7 -12.4

33396 at U 12472 798 Human glutathione S-transferase (GST phi) gene, complete cds. -6.5 -1.5 6.7 10.4

38963 i at U 12707 799 Human Wiskott-Aldrich syndrome protein (WASP) mRNA, complete cds. -2.0 -1.7 -2.6 -2.2

38964 r at U 12707 799 Human Wiskott-Aldrich syndrome protein (WASP) mRNA, complete cds. -2.0 -2.2 -2.9 -2.3

40659 at U 12767 800 Human mitogen induced nuclear orphan receptor (MINOR) mRNA, complete cds. 4.1 49.9 63.1 45.4

190 at U 12767 800 Human mitogen induced nuclear orphan receptor (MINOR) mRNA, complete cds. 4.1 47.7 52.2 31.9

1240_at U13022 801 Human negative regulator of programmed cell death 1CH-1S (lch-1) mRNA, complete cds. 2.8 5.2 4.2 7.6

39320_at U13697 802 Human interleukin 1-beta converting enzyme isoform beta (IL1 BCE) mRNA, complete cds. -1.3 -2.0 -1.7 -2.0

Human TATA-binding protein associated factor 30 kDa subunit (tafll30) mRNA, complete

868_at U13991 803 cds. -1.6 -1.2 -2.0 -1.7

869 at U14193 804 Human TFIIA gamma subunit mRNA, complete cds. 1.3 -3.2 -2.1 -3.2

1034_at U 14394 805 Human tissue inhibitor of metalloproteinases-3 mRNA, complete cds. 9.3 8.0 4.2 8.5

1035_g_at U 14394 805 Human tissue inhibitor of metalloproteinases-3 mRNA, complete cds. 9.3 2.4 5.4 -1.8

34693 at U 14550 806 Human sialyltransferase SThM (sthm) mRNA, complete cds. 1.1 -1.0 -2.4 -1.5

1241_at U 14603 807 Human protein-tyrosine phosphatase (HU-PP-1) mRNA, partial sequence. -1.2 -1.7 -2.0 -5.2

32436_at U14968 808 Human ribosomal protein L27a mRNA, complete cds. 1.4 -2.2 -3.0 -2.6

31385 at U14969 809 Human ribosomal protein L28 mRNA, complete cds. -1.2 -1.2 -13 -1.1

31511 at U14971 810 Human ribosomal protein S9 mRNA, complete cds. -1.2 1.4 1.0 1.2

31568_at U 14972 811 Human ribosomal protein S10 mRNA, complete cds. -6.2 -1.3 -2.7 -1.7

Homo sapiens BCL2/adenovirus E1 B 19kD-interacting protein 2 (BNIP2) mRNA, complete

32060 at U15173 812 cds. -3.1 -10.9 -16 1.6

34092 at U15177 813 Human cosmid CRI-JC2015 at D10S289 in 10sp13. 1.8 1.0 1.0 10

528_at U 15590 814 Homo sapiens heat shock 17kD protein 3 (HSPB3) mRNA, complete cds. 10 2.2 -2.8 1.3

529 at U 15932 815 Human dual-specificity protein phosphatase mRNA, complete cds. 17.7 55.3 43.9 18.2

845_at U16031 816 Human transcription factor IL-4 Stat mRNA, complete cds. -2.8 -1.5 -15 -1.1

33135 at U 17566 817 Human 65 kDa hydrophobic protein mRNA, complete cds. 19 -3.2 -1.5 -15

Table 7. Genes identified by DNA chip analysis.

ratio ratio ratio ratio

Affy ID Genbank Seq ID Gene Bank Names E.coli KIM5 KIM6 yopH

1640 at U17714 818 Homo sapiens putative tumor suppressor ST13 (ST13) mRNA, complete cds. 3.6 3.0 1.1 -3.2

1712_s_at U 17743 819 Homo sapiens MAP kinase kinase 4 (MKK4) mRNA, complete cds. -3.3 -3.9 -13 -3.9

Human succinate dehydrogenase iron-protein subunit (sdhB) gene, exon 8, and complete

35751_at U 17886 820 cds. 1.0 J4.5 -2.6 -2.3

39378_at U17999 821 #N/A -14 1.1 -1.9 -1.8

192_at U18062 822 Human TFIID subunit TAFII55 (TAFII55) mRNA, complete cds. -11 1.9 1.8 1.0

34836_at U 18420 823 Human ras-related small GTP binding protein Rab5 (rab5) mRNA, complete cds. 1.1 -14 -2.0 -15

37240_at U 18937 824 Human histidyl-tRNA synthetase homolog (H03) mRNA, complete cds. -3.7 2.4 -3.5 1.4

1038_s_at U 19247 825 #N/A -2.4 -11 1.2 -11 zu49g02.s1 Soares ovary tumor NbHOT Homo sapiens cDNA clone IMAGE:741362 3',

849 g_at U19261 826 mRNA sequence. 27.4 223.7 124.4 89.7

848_at U19261 826 Homo sapiens Epstein-Barr virus-induced protein mRNA, complete cds. 27.4 20.7 8.9 10.8

37944_at U 19523 827 Human GTP cyclohydrolase I mRNA, complete cds. 4.2 28.8 34.5 17.9

38442_at U19718 828 Human microfibril-associated glycoprotein (MFAP2) mRNA, complete cds. 1.0 1.9 2.7 2.6 ze23d07.s1 Soares_fetal_heart_NbHH19W Homo sapiens cDNA clone 1MAGE:359821 3',

1551 g at U 19796 829 mRNA sequence. -2.0 J6.7 -2.0 -6.1

35309_at U20428 831 Human SNC19 mRNA sequence. 2.3 3.2 1.4 2.9

1357_at U20657 832 Human ubiquitin protease (Unph) proto-oncogene mRNA, complete cds. 1.5 13 1.0 -14

535_s_at U20816 833 Human pδOHT (p80HT/NKFB-2) mRNA, complete cds. 1.0 16.4 10.3 11.1

38220_at U20938 834 Human lymphocyte dihydropyrimidine dehydrogenase mRNA, complete cds. -15 -2.6 -2.7 -2.4

37057_s_at U21092 835 Human CD40 receptor associated factor 1 (CRAF1) mRNA, complete cds. 2.6 20.5 13.6 23.1

36495_at U21931 836 Human fructose-1 ,6-biphosphatase (FBP1) gene, exon 7, and complete cds. -1.3 -2.9 -17 -2.1

1552_i_at U22028 837 Human cytochrome P450 (CYP2A13) gene, complete cds. -2.8 6.6 1.4 -18

1039_s_at U22431 838 Human MOP1 mRNA, complete cds. -11 5.4 5.0 2.4

39108_at U22526 839 Human 2,3-oxidosqualene-lanosterol cyclase mRNA, complete cds. 17 2.8 2.6 3.0

40063 at U22897 840 Homo sapiens nuclear domain 10 protein (ndp52) mRNA, complete cds. -1.5 1.2 1.1 -1.6

1556_at U23946 841 Human putative tumor suppressor (LUCA15) mRNA, complete cds. -12.4 -2.2 -2.9 -5.0

36962 at U24105 842 Homo sapiens coatomer protein (COPA) mRNA, complete cds. -12 1.7 1.3 -16

Table 7. Genes identified by DNA chip analysis.

ratio ratio ratio ratio

Affy ID Genbank Seq ID Gene Bank Names E.coli KIM5 KIM6 yopH zp05a06.s1 Stratagene ovarian cancer (#937219) Homo sapiens cDNA clone IMAGE:595474 3' similar to SW:KPAK_RAT P35465 SERINE/THREONINE-PROTEIN

1558_g_at U24152 843 KINASE PAK ;, mRNA sequence. -1.3 1.0 1.4 -12

32337_at U25789 844 Human ribosomal protein L21 mRNA, complete cds. -1.4 -8.5 -11 -2.1

37541_at U25956 845 Human P-selectin glycoprotein ligand (SELPLG) gene, exon 2, and complete cds. -6.4 -3.4 -9.7 -8.9

33758_f_at U25988 846 Human pregnancy-specific glycoprotein 13 (PSG13') mRNA, complete cds. 1.0 6.0 2.6 3.0

33508_at U26398 847 Human inositol polyphosphate 4-phosphatase mRNA, complete cds. 5.3 -2.1 1.6 3.3

1041_at U26403 848 Human receptor tyrosine kinase ligand LERK-7 precursor (EPLG7) mRNA, complete cds. 13.3 3.1 10 1.1

195 s at U28014 850 Human lch-2 cysteine protease mRNA, complete cds. -1.3 1.4 1.2 -17

41741_at U28686 851 Human putative RNA binding protein RNPL mRNA, complete cds. -2.9 1.2 1.1 -1.4

32443_at U28687 852 Human zinc finger containing protein ZNF157 (ZNF157) mRNA, complete cds. 4.5 -1.4 -2.1 -11

33098_at U28694 853 Human eosinophil CC chemokine receptor 3 mRNA, complete cds. -2.5 -13 -17 -2.3

35653_at U28963 854 Human Gps2 (GPS2) mRNA, complete cds. -1.6 -2.4 -2.4 -2.6

493_at U29171 855 Human casein kinase I delta mRNA, complete cds. -1.0 3.5 2.4 2.1

36411_s_at U29943 856 Human ELAV-like neuronal protein-2 Hel-N2 mRNA, complete cds. 1.0 3.4 1.9 2.8

37423_at U30246 857 Human bumetanide-sensitive Na-K-CI cotransporter (NKCC1) mRNA, complete cds. 1.0 4.8 -2.1 3.2

36963_at U30255 858 Human phosphogluconate dehydrogenase (hPGDH) gene, complete cds. -4.0 -3.8 -5.4 -5.0

40453_s_at U30826 859 Human splicing factor SRp40-1 (SRp40) mRNA, complete cds. -1.1 -5.6 -19 -1.8

37735_at U31383 860 Human G protein gamma-10 subunit mRNA, complete cds. 1.1 -2.4 -2.2 -3.2

38381_at U32315 861 Human syntaxin 3 mRNA, complete cds. -1.1 1.9 2.1 1.1

34856_at U32331 862 Homo sapiens RIG mRNA, complete cds. 1.0 3.8 -11 2.1

40653_at U32439 863 Human regulator of G-protein signaling similarity (RGS7) mRNA, partial cds. 4.1 10 2.3 1.0

31845_at U32645 864 Human myeloid elf-1 like factor (MEF) mRNA, complete cds. 1.0 1.3 13 1.2

497_at U32680 865 Human CLN3 mRNA, complete cds. -2.5 4.0 2.1 2.7

36472_at U32849 866 Homo sapiens Nmi mRNA, complete cds. -1.6 -2.4 -2.3 -2.6

199_s_at U33052 867 protein kinase PRK2 [human, DX3 B-cell myeloma cell line, mRNA, 3255 nt]. -4.4 -12 -1.4 -1.4

36835_at U33052 867 Human lipid-activated, protein kinase PRK2 mRNA, complete cds. -4.4 -16 -15 1.3

2009 at U33284 868 Human protein tyrosine kinase PYK2 mRNA, complete cds. 1.7 2.2 2.0 2.8

31900 at U33429 869 human K+ channel beta 2 subunit mRNA, complete cds. -2.2 1.7 20.7 42.5

Table 7. Genes identified by DNA chip analysis.

ratio ratio ratio ratio

Affy ID Genbank Seq ID Gene Bank Names E.coli KIM5 KIM6 yopH

35279_at U33821 870 Homo sapiens taxi -binding protein TXBP151 mRNA, complete cds. 1.2 -16 -1.4 -1.6

498 at U33821 870 Homo sapiens taxi-binding protein TXBP151 mRNA, complete cds. 1.2 1.8 -1.2 -2.7

33570_at U34962 871 Human transcription factor HCSX (hCsx) mRNA, complete cds. 2.1 1.0 1.0 1.0

Human lysosome-associated membrane protein-2b (LAMP2) mRNA, alternatively spliced

38402_at U36336 872 form h-lamp-2b, complete cds. -4.6 -19 -1.2 1.1

38943_at U36787 873 Human putative holocytochrome c-type synthetase mRNA, complete cds. 1.8 3.4 2.8 7.3

34650_at U36798 874 Homo sapiens platelet cGI-PDE mRNA, complete cds. 3.1 1.0 1.0 10

33103_s_at U37122 875 Human adducin gamma subunit mRNA, complete cds. 1.9 14 1.1 -2.4

Human silencing mediator of retinoid and thyroid hormone action (SMRT) mRNA, complete

39358_at U37146 876 cds. -4.5 2.3 2.0 2.9

40786_at U37352 877 Human protein phosphatase 2A B'alphal regulatory subunit mRNA, complete cds. -11 -16 -4.0 -13.1

176_at U37352 877 Human protein phosphatase 2A B'alphal regulatory subunit mRNA, complete cds. -1.1 -5.1 -5.1 -5.1

41308_at U37408 878 Homo sapiens phosphoprotein CtBP mRNA, complete cds. -3.4 1.1 -3.2 -1.7

41309 g at U37408 878 Homo sapiens phosphoprotein CtBP mRNA, complete cds. -3.4 -1.3 -2.4 -1.5

1715_at U37518 879 Human TNF-related apoptosis inducing ligand TRAIL mRNA, complete cds. -15 -5.9 -16.6 -23.3

37956_at U37519 880 Human aldehyde dehydrogenase (ALDH8) mRNA, complete cds. 1.0 2.7 4.4 1.0

39684_at U37707 881 Human dlg3 mRNA, complete cds. -2.0 5.5 1.2 5.9

832 at U39317 882 Human E2 ubiquitin conjugating enzyme UbcH5B (UBCH5B) mRNA, complete cds. 1.3 1.6 -2.3 -1.5

504_at U39318 883 Human E2 ubiquitin conjugating enzyme UbcH5C (UBCH5C) mRNA, complete cds. 1.1 2.9 1.8 1.1

833_at U40279 885 Human beta-2 integrin alphaD subunit (ITGAD) gene, exons 25-30, and partial cds. 2.6 4.0 2.1 1.7

35365_at U40282 886 Homo sapiens integrin-linked kinase (ILK) mRNA, complete cds. -14 1.6 -11 -1.2

1797 at U40343 887 Human CDK inhibitor p19INK4d mRNA, complete cds. 2.1 -6.0 -16.9 -78.1

834_at U40462 888 Human lkaros/LyF-1 homolog (hlk-1) mRNA, complete cds. -10.0 2.8 -1.0 2.6

40007_at U40462 888 Human lkaros/LyF-1 homolog (hlk-1) mRNA, complete cds. -10.0 1.8 1.1 -6.2

38107 at U40998 889 Human retinal protein (HRG4) mRNA, complete cds. 1.3 -10 -1.4 1.1

37650_at U41315 890 Human ring zinc-finger protein (ZNF127-Xp) gene and 5' flanking sequence. -6.3 -4.0 -6.9 -2.3

37022_at U41344 891 Human prolargin (PRELP) gene, exon 3 and complete cds. 2.0 14.1 7.1 7.2

36973_at U41371 892 Human spliceosome associated protein (SAP 145) mRNA, complete cds. -1.2 -27.4 -5.6 -6.1

36996 at U41635 893 Human OS-9 precurosor mRNA, complete cds. -18 -1.2 -1.9 -1.6

Table 7. Genes identified by DNA chip analysis.

ratio ratio ratio ratio

Affy ID Genbank Seq ID Gene Bank Names E.coli KIM5 KIM6 yopH

35316_at U41654 894 Human adenovirus protein E3-14.7k interacting protein 1 (FIP-1 ) mRNA, complete cds. 1.2 -2.1 -3.2 -1.9

34346_at U42412 895 Human 5'-AMP-activated protein kinase, gamma-1 subunit mRNA, complete cds. -1.2 2.4 1.2 1.0

505_at U43077 896 Human CDC37 homolog mRNA, complete cds. -9.1 -2.3 -1.3 -2.6

38580_at U43083 897 Human G alpha-q (Gaq) mRNA, complete cds. -1.6 1.6 1.2 -1.4

836_at U43148 898 Human patched homolog (PTC) mRNA, complete cds. 2.3 3.7 -1.3 -1.0

Homo sapiens signal transducer and activator of transcription (STAT5) mRNA, complete

506_s_at U43185 899 cds. -1.2 1 1..11 --11..77 --11..33

40458_at U43185 899 Human signal transducer and activator of transcription StatδA mRNA, complete cds. -1.2 6 6..00 22..55 22..33

507_s_at U43189 900 Human Ets transcription factor (NERF-2) mRNA, complete cds. -1.7 - -77..11 --11..77 --11.33

39078_at U43286 901 Human selenophosphate synthetase 2 (SPS2) mRNA, complete cds. 1.8 1 1..55 22..22 --11..22

33804_at U43522 902 Human cell adhesion kinase beta (CAKbeta) mRNA, complete cds. 1.7 1 1..77 22..00 22..66

1991_s_at U43784 903 Human mitogen activated protein kinase activated protein kinase-3 mRNA, complete cds. 1.0 -12 -2.1 -2.4

508 at U43923 904 Human transcription factor SUPT4H mRNA, complete cds. -1.4 -1.7 -1.8 -3.6

37252_at U44755 905 Human PSE-binding factor PTF delta subunit mRNA, complete cds. 5J 6.3 1.0 15.6

34774 at U44772 906 Human palmitoyl protein thioesterase mRNA, complete cds. 1.1 -2.4 -12 -1.2

162_at U44839 907 Human putative ubiquitin C-terminal hydrolase (UHX1) mRNA, complete cds. 17 3.8 2.0 2.0

Human specific 116-kDa vacuolar proton pump subunit (OC-116KDa) mRNA, complete

36028_at U45285 908 cds. -1.5 -1.3 -1.2 1.0

33535 at U45448 909 Human P2x1 receptor mRNA, complete cds. -2.0 -3.7 -3.6 -1.7

41151 at U45973 910 Human phosphatidylinositol (4,5)bisphosphate 5-phosphatase homolog mRNA, partial cds. 3.3 2.1 -1.6 1.5

Human clathrin assembly protein lymphoid myeloid leukemia (CALM) mRNA, complete

37685 at U45976 911 cds. -1.9 -1.7 -1.5 -3.3

1524 at U46194 912 Human renal cell carcinoma antigen RAGE-4 mRNA, complete putative cds. 4.9 2.7 1.4 2.9

35816_at U46692 913 Human cystatin B gene, complete cds. 1.7 3.9 6.4 4.6

Human phosphotyrosine independent ligand p62 for the Lck SH2 domain mRNA, complete

40898 at U46751 914 cds. 1.3 5.7 8.0 6.0

36667 at U47025 915 Human fetal brain glycogen phosphorylase B mRNA, complete cds. -4.1 4.2 1.0 3.8

Table 7. Genes identified by DNA chip analysis.

ratio ratio ratio ratio

Affy ID Genbank Seq ID Gene Bank Names E.coli KIM5 KIM6 yopH

39165_at U47101 916 Human NifU-like protein (hNifU) mRNA, partial cds. -7.4 -4.2 -27.5 -8.1

1913 at U47414 917 Human cyclin G2 mRNA, complete cds. -2.1 -4.0 -3.6 -5.4

471_f_at U47634 918 Human beta-tubulin class III isotype (beta-3) mRNA, complete cds. 16 3.4 1.5 2.6

34003_at U47924 920 #N/A 2.4 -1.5 -1.7 1.0

34405_at U47927 921 Human isopeptidase T (ISOT) mRNA, complete cds. 1.0 -4.0 2.0 1.7

Homo sapiens protein tyrosine phosphatase PTPCAAX1 (hPTPCAAXI) mRNA, complete

843_at U48296 922 cds. 1.6 1.7 1.2 -1.2

844_at U48707 923 Human protein phosphatase-1 inhibitor mRNA, complete cds. 2.0 1.6 -2.6 3.1

473_g_at U48730 924 Human signal transducer and activator of transcription StatδB mRNA, complete cds. 1.0 -5.3 -2.3 -1.3

32977_at U49187 925 Human placenta (Diff48) mRNA, complete cds. -2.1 -6.1 -6.2 -4.2

32978_g_at U49187 925 Human placenta (Diff48) mRNA, complete cds. -2.1 -15.1 -4.6 -4.1

37007_at U49188 926 Human placenta (Diff33) mRNA, complete cds. 1.8 3.6 3.2 2.4

36959_at U49278 927 Homo sapiens UEV-1 (UBE2V) mRNA, partial cds. -3.2 -22.9 -3.7 -6.6

37011_at U49392 928 Human allograft inflammatory factor- 1 (AIF-1) mRNA, complete cds. -1.2 -4.5 -1.4 -6.4

40396_at U49395 929 Human ionotropic ATP receptor P2X5a mRNA, complete cds. 3.2 -1.3 1.7 -1.9

32153_s_at U49869 930 Homo sapiens ubiquitin gene. 1.5 2.0 17 -18

41195 at U49957 931 Human LIM protein (LPP) mRNA, partial cds. -11 -3.5 -2.8 2.0

1718 at U50523 932 Human BRCA2 region, mRNA sequence CG037. -1.4 1.1 -1.2 -1.6 zm91g11.s1 Stratagene ovarian cancer (#937219) Homo sapiens cDNA clone

1532_g_at U50535 933 IMAGE:545348 3' similar to contains Alu repetitive element;, mRNA sequence. -1.4 1.2 -18 -3.5 Human interferon-inducible RNA-dependent protein kinase (Pkr) gene, exon 17 and

1008 f at U50648 934 complete cds. -1.3 4.1 1.6 2.4

35364 at U50939 935 Human amyloid precursor protein-binding protein 1 mRNA, complete cds. 4.5 -3.8 -3.8 -3.8

39749 at U51007 936 Human 26S protease subunit S5a mRNA, complete cds. 1.1 -1.5 -2.0 -5.5

477 at U51127 937 Human interferon regulatory factor 5 (Humirfδ) mRNA, complete cds. 2.4 4.2 2.4 3.6

478 g at U51127 937 Human interferon regulatory factor 5 (Humirf5) mRNA, complete cds. 2.4 2.8 1.3 3.7

36465_at U51127 937 Human interferon regulatory factor 5 (Humirf5) mRNA, complete cds. 2.4 -1.3 1.1 1.4 Human lysosomal-associated multitransmembrane protein (LAPTmδ) mRNA, complete

37759 at U51240 938 cds. -1.2 2.2 1.1 17

36372 at U51333 939 Human hexokinase 111 (HK3) mRNA, complete cds. -2.6 -1.7 -2.8 -2.2

Table 7. Genes identified by DNA chip analysis.

ratio ratio ratio ratio

Affy ID Genbank Seq ID Gene Bank Names E.coli KIM5 KIM6 yopH

36822_at U51334 940 Human putative RNA binding protein (RBP56) mRNA, complete cds. 1.5 1.3 1.4 10

35755_at U51336 941 Human inositol 1 ,3,4-trisphosphate 5/6-kinase mRNA, complete cds. -1.7 -2.7 -5.6 -3.1

1647_at U51903 942 Human RasGAP-related protein (IQGAP2) mRNA, complete cds. -1.3 -1.7 -1.3 -1.1

37276_at U51903 942 Human RasGAP-related protein (IQGAP2) mRNA, complete cds. -1.3 2.0 -3.7 -4.5

38412_at U53588 943 Homo sapiens MHC class 1 region. 11 3.3 1.7 1.6

35396_at U54804 944 Human Has2 mRNA, complete cds. 5.0 1.0 1.0 1.0

32836_at U56417 945 Human lysophosphatidic acid acyltransferase-alpha mRNA, complete cds. -1.2 2.2 1.0 1.5

40910_at U56637 946 Human capping protein alpha subunit isoform 1 mRNA, complete cds. 1.2 1.2 13 -1.2

171_at U56833 947 Human VHL binding protein-1 (VBP-1 ) mRNA, partial cds. 1.8 -2.7 -1.2 1.5

806_at U56998 948 Human putative serine/threonine protein kinase PRK (prk) mRNA, complete cds. 7.2 11.2 10.1 7.7

809_at U57094 949 Human small GTP-binding protein mRNA, complete cds. -2.0 1.1 -11 -18

38164_at U57629 950 Human retinitis pigmentosa GTPase regulator (RPGR) mRNA, complete cds. 1.6 14 1.6 1.2

172_at U57650 951 Human SH2-containing inositol 5-phosphatase (hSHIP) mRNA, complete cds. -1.2 -7.2 -4.5 -8.0

33628_g_at U57843 952 Human phosphatidylinositol 3-kinase delta catalytic subunit mRNA, complete cds. 1.3 -3.5 -3.5 -3.5

484_at U59302 953 Human steroid receptor coactivator-1 F-SRC-1 mRNA, complete cds. 1.2 -1.2 -1.9 -3.5

41260_at U59321 954 Human DEAD-box protein p72 (P72) mRNA, complete cds. 1.2 -5.4 -1.4 J2.2

39742_at U59863 955 Human TRAF-interacting protein l-TRAF mRNA, complete cds. -4.4 2.7 2.9 -3.3

33371 s at U59877 956 Human low-Mr GTP-binding protein (RAB31 ) mRNA, complete cds. -7.8 -16 -2.4 -1.8

Human lysosomal alpha-mannosidase (manB) gene, exon 24, 3' flanking region and

34670 at U60899 957 complete cds. -1.1 -6.6 -4J 1.0

31855 at U61374 958 Human novel protein with short consensus repeats of six cysteines mRNA, complete cds. 2.0 2.7 1.6 4.2

35018_at U61538 959 Human calcium-binding protein chp mRNA, complete cds. -1.4 4.0 1.7 3.0

40006_at U63090 960 Human Gal beta-1,3 GalNAc alpha-2,3 sialyltransferase (ST3Gal II) mRNA, complete cds. 8.8 -2.4 -11 4.6

Human mRNA expressed in HC/HCC livers and MolT-4 proliferating cells, partial

40974 at U63541 961 sequence. 3.0 3.6 1.7 2.1

467 at U63717 962 Homo sapiens osteoclast stimulating factor mRNA, complete cds. -11 -4.4 -1.9 -4.4

810 at U64105 963 Human guanine nucleotide exchange factor p115-RhoGEF mRNA, partial cds. -16 -18 -3.1 -2.9

40385 at U64197 964 Homo sapiens chemokine exodus-1 mRNA, complete cds.

Table 7. Genes identified by DNA chip analysis.

ratio ratio ratio ratio

Affy ID Genbank Seq ID Gene Bank Names E.coli KIM5 KIM6 yopH

1534_at U64198 965 Human 11-12 receptor beta2 mRNA, complete cds. 4.2 1.0 1.0 5.7

811_at U64444 966 Homo sapiens ubiquitin fusion-degradation 1 like protein (UFD1L) mRNA, complete cds. -1.2 -3.2 -1.9 -2.6

35784_at U64520 967 Human synaptobrevin-3 mRNA, complete cds. -2.1 -1.7 -2.1 -2.1

34876 at U65090 968 Human carboxypeptidase D mRNA, complete cds. 1.7 3.2 3.9 2.4

33863_at U65785 969 Human 150 kDa oxygen-regulated protein ORP150 mRNA, complete cds. -1.5 11.5 1.5 5.7

32104_i_at U66063 970 Homo sapiens calcium/calmodulin-dependent protein kinase II mRNA, partial cds. -1.2 -16 -2.2 -2.6

32105_f_at U66063 970 Homo sapiens calcium/calmodulin-dependent protein kinase II mRNA, partial cds. -1.2 -30.3 -30.3 -30.3

32459_at U66088 971 Human sodium iodide symporter mRNA, complete cds. 5.1 1.0 1.0 1.0

138_at U66464 972 Human hematopoietic progenitor kinase (HPK1) mRNA, complete cds. 4.9 4.3 2.5 1.5

452_at U66615 973 Human SWI/SNF complex 155 KDa subunit (BAF155) mRNA, complete cds. -3.3 5.5 1.5 2.4

457_s_at U67122 975 Human sentrin mRNA, complete cds. -1.9 2.1 12 -4.2 zf57d12.s1 Soares retina N2b4HR Homo sapiens cDNA clone IMAGE:381047 3', mRNA

1327_s_at U67156 976 sequence. 2.6 -8.3 -2.5 -3.2

35695_at U67615 977 Human beige protein homolog (chs) mRNA, complete cds. -2.7 -3.8 -2.9 -3.2

35792_at U67963 978 Human lysophospholipase homolog (HU-K5) mRNA, complete cds. 1.4 4.5 1.0 10

34759_at U68494 979 Human hbc647 mRNA sequence. 1.3 4.6 -2.2 1.4

36938 at U70063 980 Human acid ceramidase mRNA, complete cds. 11 1.1 1.1 14

461_at U70063 980 Human acid ceramidase mRNA, complete cds. 1.1 1.2 1.0 -1.3

39424_at U70321 981 Human herpesvirus entry mediator mRNA, complete cds. 1.4 2.0 2.3 2.2

38369_at U70451 982 Human myleoid differentiation primary response protein MyD88 mRNA, complete cds. -1.9 1.5 -1.1 1.3

41776_at U70660 983 Human copper transport protein HAH1 (HAH1) mRNA, complete cds. 1.0 14 -1.2 13

34817_s_at U70671 984 Human ataxin-2 related protein mRNA, partial cds. 1.5 -2.0 -1.3 -1.3

40138_at U70735 985 Homo sapiens 34 kDa Mov34 homolog mRNA, complete cds. -11 -1.3 -2.6 -1.3

34438_at U71364 986 Human serine proteinase inhibitor (P19) mRNA, complete cds. 8.6 14.1 6.7 8.4

35227_at U72066 987 Homo sapiens CtBP interacting protein CtlP (CtlP) mRNA, complete cds. 2.8 5.7 1.2 4.5

40100_at U72206 988 Human guanine nucleotide regulatory factor (LFP40) mRNA, complete cds. 1.6 1.7 1.3 1.4

817_at U72209 989 Human YY1 -associated factor 2 (YAF2) mRNA, complete cds. -1.4 1.7 -2.7 -3.1

37364 at U72511 990 Human B-cell receptor associated protein (hBAP) mRNA, partial cds. -3.3 1.5 -HO -4.0

Table 7. Genes identified by DNA chip analysis.

ratio ratio ratio ratio

Affy ID Genbank Seq ID Gene Bank Names E.coli KIM5 KIM6 yopH

33710_at U72515 991 Human C3f mRNA, complete cds. 1.9 1.0 2.1 1.0

Homo sapiens putative DNA dependent ATPase and helicase (ATRX) mRNA, alternatively

39147_g_at U72936 993 spliced product 1 , complete cds. 2.0 -2.3 -2.1 -14

38118_at U73377 994 Human p66shc (SHC) mRNA, complete cds. 1.1 -1.0 -1.3 -17

37034_at U73477 995 Human acidic nuclear phosphoprotein pp32 mRNA, complete cds. -12 -11 -1.7 -2.4

33149_at U73524 996 Human putative ATP/GTP-binding protein (HEAB) mRNA, complete cds. -3.1 -3.2 -3.9 -3.9

39984_g_at U73704 997 Homo sapiens 48 kDa FKBP-associated protein FAP48 mRNA, complete cds. 1.0 1.6 10 -10

41785_at U73824 998 Human p97 mRNA, complete cds. -3.3 -14 -19 -2.0

36913_at U75679 999 Human histone stem-loop binding protein (SLBP) mRNA, complete cds. -16 -4.4 -3.8 -4.4

37972_at U75744 1000 Homo sapiens DNase gamma mRNA, complete cds. 2.2 4.3 2.9 4.2

38614_s_at U77413 1001 Human O-linked GlcNAc transferase mRNA, complete cds. -12 1.3 -2.1 -1.2

1633 g_at U77735 1003 Human pim-2 protooncogene homolog pim-2h mRNA, complete cds. 2.3 2.8 1.5 1.4

1652_at U77735 1003 Human pim-2 protooncogene homolog pim-2h mRNA, complete cds. 2.3 4.3 1.9 1.6

35414_s_at U77914 1004 Human soluble protein Jagged mRNA, partial cds. 1.0 1.7 -3.2 2.6

466_at U77948 1005 Human Bruton's tyrosine kinase-associated protein-135 mRNA, complete cds. -3.1 -16.2 -8.6 -5.8

34348_at U78095 1006 Homo sapiens placental bikunin mRNA, complete cds. -3.2 -14 -2.4 1.2

38104 at U78302 1007 Human 2,4-dienoyl-CoA reductase gene, exon 10 and complete cds. -7.1 -8.5 -8.5 -8.5

1229 at U78556 1008 Human cisplatin resistance associated alpha protein (hCRA alpha) mRNA, complete cds. 8.5 1.8 -16 -1.6 zw66a06.s1 Soares_testis_NHT Homo sapiens cDNA clone IMAGE:781138 3', mRNA

1230_g_at U78556 1008 sequence. 8.5 1.0 1.2 1.0

32852_at U78678 1009 Human thioredoxin mRNA, nuclear gene encoding mitochondrial protein, complete cds. 8.4 1.0 1.0 1.0

35183_at U78735 1010 Human ABC3 mRNA, complete cds. 4.2 11.4 5.3 1.0

41006_at U79265 1011 Human clone 23614 mRNA sequence. 1.2 1.2 -2.0 -19

34371_at U79267 1012 Human clone 23840 mRNA, partial cds. -2.6 -2.6 -17 -3.0

32059_at U79282 1013 Human clone 23801 mRNA sequence. -7.6 -6.0 -2.1 -6.0

40955_at U79287 1014 Human clone 23867 mRNA sequence. -3.2 -19 -4.2 -3.2

35564_at U79300 1015 Human clone 23629 mRNA sequence. 1.0 1.0 1.0 6.0

37875 at U79725 1016 Human A33 antigen precursor mRNA, complete cds. 1.1 2.0 -5.4 1.8

Table 7. Genes identified by DNA chip analysis.

ratio ratio ratio ratio

Affy ID Genbank Seq ID Gene Bank Names E.coli KIM5 KIM6 yopH

34095 f at U80114 1017 Human immunoglobulin heavy chain variable region (V4-31) gene, partial cds. 10 13.9 -1.0 5.0

34307_at U81006 1018 Human p76 mRNA, complete cds. -4.0 -12.9 -10.9 -12.9

33901 at U81375 1019 Human placental equilibrative nucleoside transporter 1 (hENT1) mRNA, complete cds. 1.1 -14.7 -14.7 -14.7

32113 at U83115 1020 Human non-lens beta gamma-crystallin like protein (AIM1) mRNA, partial cds. -4.8 -1.7 -1.7 -1.7

40452 at U83246 1021 Homo sapiens copine I mRNA, complete cds. -16 -11 -2.7 -2.7

34749 at U83461 1022 Human putative copper uptake protein (hCTR2) mRNA, complete cds. -3.7 -1.2 -2.7 -1.4

Human glycogen debranching enzyme isoform 1 (AGL) mRNA, alternatively spliced

38252 s at U84007 1023 isoform, complete cds. 3.3 1.0 1.0 3.4

Human glycogen debranching enzyme isoform 6 (AGL) mRNA, alternatively spliced

38253_at U84011 1024 isoform, complete cds. 3.3 1.8 -2.2 -2.2

32757_at U84720 1025 Homo sapiens mRNA export protein (RAE1) mRNA, complete cds. -9.5 1.2 -1.6 -1.6

1020 s at U85611 1026 Human Snk interacting protein 2-28 mRNA, complete cds. -1.5 15 -11 -1.6

33637_g_at U87459 1027 Human autoimmunogenic cancer/testis antigen NY-ESO-1 mRNA, complete cds. 3.6 2J 1.0 1.5

33636_at U87459 1027 Human autoimmunogenic cancer/testis antigen NY-ESO-1 mRNA, complete cds. 3.6 1.0 2.2 3.4

39182 at U87947 1028 Human hematopoietic neural membrane protein (HNMP-1) mRNA, complete cds. 1.2 2.1 1.7 1.9

35913_at U88047 1029 Homo sapiens DNA binding protein homolog (DRIL1) mRNA, complete cds. 1.0 1.7 -1.8 11

40606 at U88629 1030 Human RNA polymerase II elongation factor ELL2, complete cds. 1.9 218 9.0 8.8

148_at U88629 1030 Human RNA polymerase II elongation factor ELL2, complete cds. 1.9 7.1 4.3 7.2

33304_at U88964 1031 Human HEM45 mRNA, complete cds. -1.1 4.1 2.4 2.0

36960_at U89278 1032 Human polyhomeotic 2 homolog (HPH2) mRNA, complete cds. -4.2 -71.7 -11.3 -10.8

38542 at U89322 1033 Homo sapiens nucleophosmin phosphoprotein (NPM) gene, 3' flanking sequence. 1.4 1.4 2.7 1.7

35351 at U89505 1034 Human Hlark mRNA, complete cds. -3.9 -5.1 -2.0 -2.0

35714_at U89606 1035 Human pyridoxal kinase mRNA, complete cds. 1.2 3.9 3.6 4.1 af16e12.s1 Soares_testis_NHT Homo sapiens cDNA clone IMAGE:1031854 3' similar to

447_g_at U89896 1036 TR:G854735 G854735 CASEIN KINASE 1 GAMMA 2 ISOFORM. ;, mRNA sequence. 1.7 1.3 -4.5 -11.4

446_at U89896 1036 Homo sapiens casein kinase I gamma 2 mRNA, complete cds. 1.7 1.1 1.1 -1.0

32673 at U90543 1038 Human butyrophilin (BTF1) mRNA, complete cds. -7.9 -1.4 -1.7 -2.6

38760 f at U90546 1039 Human butyrophilin (BTF4) mRNA, complete cds. -4.6 -7.1 -2.8 -2.5

Table 7. Genes identified by DNA chip analysis.

ratio ratio ratio ratio

Affy ID Genbank Seq ID Gene Bank Names E.coli KIM5 KIM6 yopH

35341_at U90547 1040 Human Ro/SSA ribonucleoprotein homolog (RoRet) mRNA, complete cds. 17 5.0 2.4 -10

34308_at U90551 1041 Human histone 2A-like protein (H2A/I) mRNA, complete cds. -3.0 -5.9 -4.6 -4.3

32629_f_at U90552 1042 Human butyrophilin (BTF5) mRNA, complete cds. -3.2 -3.2 -5.5 -3.0

35950_at U90841 1043 Homo sapiens SSX4 (SSX4) mRNA, complete cds. 1.2 -1.4 10 1.9

40787_at U90911 1044 Human clone 23652 mRNA sequence. -1.9 1.8 1.3 -1.6

38411_at U90916 1045 Human clone 23815 mRNA sequence. -1.5 -2.8 -2.8 -3.7

41475_at U91512 1046 Human adhesion molecule ninjurin mRNA, complete cds. 1.5 4.6 2.5 3.4

38074_at U91932 1048 Homo sapiens AP-3 complex sigma3A subunit mRNA, complete cds. -2.3 -1.0 -2.4 -2.1

32047_at U91985 1049 Human DNA fragmentation factor-45 mRNA, complete cds. 4.1 1.0 1.0 1.0

31876 r at U92014 1050 Human clone 121711 defective mariner transposon Hsmar2 mRNA sequence. 11.7 1.0 2.7 1.0

1434_at U92436 1051 Human mutated in multiple advanced cancers protein (MMAC1) mRNA, complete cds. -1.9 -1.0 -2.7 -1.5

39552 at U92436 1051 Human mutated in multiple advanced cancers protein (MMAC1) mRNA, complete cds. -1.9 -1.8 -2.1 -1.3

37326 at U93305 1052 #N/A -1.7 -11 -1.7 -2.3

35036 at U94333 1053 Human Clq/MBL/SPA receptor C1qR(p) mRNA, complete cds. 2.0 4.7 3.5 5.0

37591 at U94592 1054 Human uncoupling protein homolog (UCPH) mRNA, complete cds. 1.4 -3.4 -2.3 -2.0

33859 at U96915 1055 Homo sapiens sin3 associated polypeptide p18 (SAP18) mRNA, complete cds. -2.5 -11 -1.3 -2.7

33506_at U96919 1056 Homo sapiens inositol polyphosphate 4-phosphatase type l-beta mRNA, complete cds. 5.3 1.9 -10 -5.5

33507_g_at U96919 1056 Homo sapiens inositol polyphosphate 4-phosphatase type l-beta mRNA, complete cds. 5.3 1.6 1.0 1.0

428_s_at V00567 1057 Human beta-2-microglobulin gene, exons 2 and 3. 2.4 2.0 1.7 14

37677_at V00572 1058 Human mRNA encoding phosphoglycerate kinase. -1.3 1.8 1.9 13

32603_at W27118 1060 #N/A -1.9 1.2 1.2 1.9

32004_s_at W32483 1061 #N/A -6.2 1.5 1.4 1.3

34317_g_at W52024 1062 #N/A -1.5 -4.7 -2.8 -19

38087_s_at W72186 1063 #N/A -1.1 -2.8 -2.9 -8.9

41471_at W72424 1064 #N/A -2.0 1.2 -1.5 1.1

40541 at X01630 1065 Human mRNA for argininosuccinate synthetase. 2.7 1.4 -1.0 1.9

Table 7. Genes identified by DNA chip analysis.

ratio ratio ratio ratio

Affy ID Genbank Seq ID Gene Bank Names E.coli KIM5 KIM6 yopH

36781_at X01683 1066 Human alpha-1-antitrypsin mRNA, complete cds. 1.8 2.5 1.4 1.4

40567_at X01703 1067 Human gene for alpha-tubulin (b alpha 1). -2.1 1.1 -1.1 -1.5

41485_at X02152 1068 Human mRNA for lactate dehydrogenase-A (LDH-A, EC 1.1.1.27). 2.8 3.0 2.2 1.7

35315_at X02544 1069 Human mRNA for alphal -acid glycoprotein (orosomucoid). 1.9 1.5 1.3 -1.5

32276_at X03342 1070 Human mRNA for ribosomal protein L32. -1.5 -1.3 -1.2 -1.3

1334_s_at X03656 1071 Human mRNA for granulocyte colony-stimulating factor (G-CSF) (pBRV-2). 16.4 -4.0 -4.0 -4.0

Human mRNA of X-CGD gene involved in chronic granulomatous disease located on

37975_at X04011 1072 chromosome X. 1.8 -3.3 -3.3 -3.3

36138_at X04106 1074 Human mRNA for calcium dependent protease (small subunit). 1.4 -23.7 -14.5 -4.7

Human mRNA for calcium activated neutral protease large subunit (muCANP, calpain, EC

33908_at X04366 1075 3.4.22.17). 3.3 - -88..88 - -1155..88 - -88..99

32612_at X04412 1076 Human mRNA for plasma gelsolin. -1.6 - -66..00 - -22..99 - -33..99

33341_at X04526 1077 Human liver mRNA for beta-subunit signal transducing proteins Gs/Gi (beta-G). -1.6 - -1111 - -11..22 - -11..55

1323_at X04803 1078 Homo sapiens ubiquitin gene. 1.5 1 1..66 1 1..44 - -22..22

Human mRNA for G(i) protein alpha-subunit (adenylate cyclase inhibiting GTP-binding

37307_at X04828 1079 protein). 1.4 -2.1 -3.2 -2.0

32336_at X05236 1080 Human fibroblast mRNA for aldolase A. -2.0 -1.2 -1.8 -1.1

33866_at X05276 1081 Human mRNA for fibroblast tropomyosin TM30 (pi). 1.4 8.4 6.5 3.4

37403_at X05908 1082 Human mRNA for lipocortin. -12 2.4 1.7 -2.1

36679_at X06272 1084 Human mRNA for docking protein (signal recognition particle receptor). -3.0 1.4 -1.8 -1.5

1976_s_at X06292 1085 Human c-fes/fps proto-oncogene. 2.0 -3.7 -23.1 -23.1

1336_s_at X06318 1086 Human mRNA for protein kinase C (PKC) type beta I. -5.9 -8.4 -2.4 -2.7

38743_f_at X06409 1087 Human mRNA fragment for activated c-raf-1 (exons 8-17). -2.4 -8.0 -6.0 -6.1

1337_s_at X06614 1088 Human mRNA for retinoic acid receptor. -1.3 1.1 1.3 1.8

32330_at X06617 1089 Human mRNA for ribosomal protein S11 -1.3 -1.3 -1.3 -4.0

36661 s_at X06882 1090 Human gene for CD14 differentiation antigen. -3.5 2.3 1.6 2.2

36591_at X06956 1091 Human HALPHA44 gene for alpha-tubulin, exons 1-3. -2.5 -2.9 -3.2 -2.5

1217_g_at X07109 1092 Human mRNA for protein kinase C (PKC) type beta I. -1.1 -1.3 -1.3 12

37582_at X07696 1093 Human mRNA for cytokeratin 15. 1.0 2.6 5.1 11.6

34666 at X07834 1095 Human mRNA for manganese superoxide dismutase (EC 1.15.11). 5.7 16.5 15.9 6.7

Table 7. Genes identified by DNA chip analysis.

ratio ratio ratio ratio

Affy ID Genbank Seq ID Gene Bank Names E.coli KIM5 KIM6 yopH

38119_at X12496 1097 Human mRNA for erythrocyte membrane sialoglycoprotein beta (glycophorin C). 1.0 2.8 1.8 3.2

985_s_at X12830 1098 Human mRNA for interleukin-6-receptor. 1.3 -1.6 1.2 3.3

39239_at X13444 1099 Human mRNA for CD8 beta-chain glycoprotein (CD8 betaJ). 5.0 18.2 31.0 16.3

41231_f_at X13546 1100 Human HMG-17 gene for non-histone chromosomal protein HMG-17. -1.0 1.4 -1.7 -1.1

37033_s_at X13710 1101 H.sapiens unspliced mRNA for glutathione peroxidase. 1.0 2.1 2.1 2.9

33820_g_at X13794 1102 H.sapiens lactate dehydrogenase B gene exon 1 and 2 (EC 1.1.1.27) (and joined CDS). -5.3 2.7 2.2 1.1

37180__at X14034 1103 Human mRNA for phospholipase C. -1.3 -1.1 -1.7 -1.7

31870_at X14046 1104 Human mRNA for leukocyte antigen CD37. 1.2 -3.1 -2.8 -2.3

38610_s_at X14487 1105 Human gene for acidic (type I) cytokeratin 10. 1.0 1.0 -2.7 -1.6

40415_at X14813 1106 Human liver mRNA for 3-oxoacyl-CoA thiolase. -5.3 -30.8 -5.7 -3J

33480_at X15393 1108 H.sapiens motilin gene exon 2 (and joined CDS). 2.2 2.6 2.0 2.0

33676_at X15940 1109 Human mRNA for ribosomal protein L31. -1.0 -1.2 -1.4 1.4

1220 g at X15949 1110 Human mRNA for interferon regulatory factor-2 (IRF-2). -4.5 11 -2.5 -1.4

1219_at X15949 1110 Human mRNA for interferon regulatory factor-2 (IRF-2). -4.5 -18.4 -16.7 -18.4

35201 at X16135 1112 Human mRNA for novel heterogeneous nuclear RNP protein, L protein. 1.9 2.0 -11 -11

1919_at X16316 1113 Human mRNA for vav oncogene. -1.4 -11 -6.1 -1.4

988_at X16354 1114 Human mRNA for transmembrane carcinoembryonic antigen BGPa (formerly TM1-CEA). 1.2 -2.0 1.4 -6.1

37021_at X16832 1116 Human mRNA for cathepsin H (EC 3.4.22.16). -4.3 15 -2.4 -1.5

36985_at X17025 1117 Human homolog of yeast IPP isomerase. 1.0 -2.5 -1.6 -1.7

35338_at X17094 1119 Human fur mRNA for furin. -5.4 -13.2 -13.2 J3.2

31527_at X17206 1120 Human mRNA for LLRep3. -11 -2.3 -2.8 -1.7

32786_at X51345 1121 Human jun-B mRNA for JUN-B protein. 3.4 1.7 1.4 -1.6

35251_at X51435 1122 Human PRDII-BF1 gene for a DNA-binding protein. -6.2 6.1 7.6 4.3

40103_at X51521 1123 Human mRNA for ezrin. 2.8 3.2 1.5 2.0

35965__at X51757 1124 Human heat-shock protein HSP70B' gene. J0.9 -4.9 -4.0 -7.3

117_at X51757 1124 Human heat-shock protein HSP70B' gene. J0.9 -10.9 -5.4 -3.1

38515_at X51801 1125 Human OP-1 mRNA for osteogenic protein. 1.0 4.0 10 7.7

788 s at X52001 1126 Human endothelin 3 (EDN3) mRNA, complete cds. 2.0 1.0 1.0 10.8

Table 7. Genes identified by DNA chip analysis.

ratio ratio ratio ratio

Affy ID Genbank Seq ID Gene Bank Names E.coli KIM5 KIM6 yopH

37603 at X52015 1127 H.sapiens mRNA for interleukin-1 receptor antagonist. 32.8 37.3 22.6 19.4

1341_at X52056 1128 Human mRNA for spi-1 proto-oncogene. 1.2 1.7 -1.0 1.3

34647_at X52104 1129 Human mRNA for p68 protein. 1.9 2.0 2.3 -1.0

37963_at X52151 1130 Homo sapiens arylsulphatase A mRNA, complete cds. -1.0 -8.3 -8.3 -8.3

32888_at X52213 1131 H.sapiens Itk mRNA. 11.8 6.4 3.4 6.2

404_at X52425 1132 Human IL-4-R mRNA for the interleukin 4 receptor. -1.5 1.1 -1.8 -1.5

32352_at X52730 1135 Human gene for phenylethanolamine N-methylase (PNMT) (EC 2.1.1.28). 1.6 2.4 3.1 2.9

405_at X52773 1136 Human mRNA for retinoic acid receptor-like protein. -13.4 -2.6 -2.3 1.0

33667_at X52851 1137 Human cyclophilin gene for cyclophilin (EC 5.2.1.8). -12.8 2.2 1.6 12

35055_at X53281 1138 H.sapiens BTF3b mRNA. -13 1.3 1.4 2.0

38027_at X53742 1139 H.sapiens mRNA for fibulin-1 B. 2.7 1.9 1.6 4.1

32440_at X53777 1140 Human L23 mRNA for putative ribosomal protein. -2.9 -1.1 -2.4 -5.4

32916_at X54134 1141 Human HPTP epsilon mRNA for protein tyrosine phosphatase epsilon. 1.9 5.4 5.5 2.9

33447_at X54304 1142 Human mRNA for myosin regulatory light chain. -11 1.3 1.2 -1.5

993_at X54637 1143 Human tyk2 mRNA for non-receptor protein tyrosine kinase. -18 -20.3 -4.4 -2.1

793 at X54936 1144 H.sapiens mRNA for placenta growth factor (PIGF). 4.5 18.8 1.0 8.2

31816_at X55079 1145 Human lysosomal alpha-glucosidase gene exon 1. -2.3 -34.1 -9.5 -1.4

34645_at X55715 1146 Human Hums3 mRNA for 40S ribosomal protein s3. -1.0 -1.2 -1.9 -2.2

32394 s at X55954 1147 Human mRNA for HL23 ribosomal protein homologue. -1.4 2.0 1.7 1.2

32395_r_at X55954 1147 Human mRNA for HL23 ribosomal protein homologue. -1.4 -12.9 1.1 -12.9

36766_at X55988 1148 Human EDN mRNA for eosinophil derived neurotoxin. 1.2 -7.5 -3.2 -1.3

37448_s_at X56009 1149 Human GSA mRNA for alpha subunit of GsGTP binding protein. -1.5 -1.9 -3.0 -2.3

409_at X56468 1150 Human mRNA for 14.3.3 protein, a protein kinase regulator. -4.4 -1.0 -1.2 1.1

41483_s_at X56681 1151 Human junD mRNA. -1.1 -2.1 -2.4 -2.1

1612_s_at X56681 1151 Human jun-D mRNA for JUN-D protein. -1.1 -2.1 -2.5 -2.3

41484_r_at X56681 1151 Human junD mRNA. -11 1.4 -3.8 1.2

35119_at X56932 1153 H.sapiens mRNA for 23 kD highly basic protein. -1.0 -2.2 -2.3 -2.4

1501_at X57025 1154 Human IGF-I mRNA for insulin-like growth factor I. 6.3 4.4 1.0 1.0

38737_at X57025 1154 Human IGF-I mRNA for insulin-like growth factor I. 6.3 1.0 1.0 1.0

410 s at X57152 1155 Human casein kinase II beta subunit mRNA, complete cds. -18 -1.0 -17 -1.6

Table 7. Genes identified by DNA chip analysis.

ratio ratio ratio ratio

Affy ID Genbank Seq ID Gene Bank Names E.coli KIM5 KIM6 yopH

37272_at X57206 1156 H.sapiens mRNA for 1 D-myo-inositol-trisphosphate 3-kinase B isoenzyme. -4.7 -2.5 -2.2 1.2

32324 at X57346 1157 H.sapiens mRNA for HS1 protein. -16 -11 -13 -16

411_i_at X57351 1158 Human 1-8D gene from interferon-inducible gene family. 3.3 11 -2.7 -15

40153_at X57522 1159 H.sapiens RING4 cDNA. -1.0 1.0 -2.4 -13

36333_at X57958 1160 H.sapiens mRNA for ribosomal protein L7. -5.8 1.7 16 2.5

33352_at X57985 1161 H.sapiens genes for histones H2B.1 and H2A. 1.4 1.6 15 1.8

40511_at X58072 1162 Human hGATA3 mRNA for trans-acting T-cell specific transcription factor. 1.8 1.0 1.0 2.7

32145_at X58141 1163 Human mRNA for erythrocyte adducin alpha subunit. -5.0 -3.3 -2.4 -2.0

37381_g_at X59268 1164 Human mRNA for general transcription factor MB. -3.1 1.6 -2.9 -3.8

38521_at X59350 1165 H.sapiens mRNA for B cell membrane protein CD22. 1.0 -17 2.5 3.8

36122_at X59417 1167 H.sapiens PROS-27 mRNA. 1.1 2.4 1.2 1.7

998_s_at X59770 1168 H.sapiens IL-1 R2 mRNA for type II interleukin-1 receptor, (cell line CB23). -1.1 8.1 3.7 2.6

999_at X59812 1169 H.sapiens CYP 27 mRNA for vitamin D3 25-hydroxylase. -1.3 -11 A -11.4 -11.4

40522_at X59834 1170 Human rearranged mRNA for glutamine synthase. -19 1.2 1.2 -15

32696_at X59841 1171 Human PBX3 mRNA. 5.1 4.5 1.0 1.0

38121_at X59892 1172 H.sapiens mRNA for IFN-inducible gamma2 protein. -10 J0.5 -15 -10.5

1768_s_at X59932 1173 H.sapiens cyl mRNA for cytoplasmic tryrosine kinase. -18 -2.3 -2.8 -2.3

37675_at X60036 1174 H.sapiens mRNA for mitochondrial phosphate carrier protein. -2.6 -1.9 -2.2 -17

1000_at X60188 1175 Human ERK1 mRNA for protein serine/threonine kinase. 1.0 1.0 -2.6 -16

37285_at X60364 1176 Human ALAS mRNA for 5-aminolevulinate synthase precursor. -1.2 2.7 2.0 2.4

38566_at X60382 1177 H.sapiens COL10A1 gene for collagen (alpha-1 type X). 2.4 3.7 1.2 2.6

32184_at X61118 1178 Human TTG-2 mRNA for a cysteine rich protein with LIM motif. -2.1 -4.6 -13 1.3

37294_at X61123 1179 Human BTG1 mRNA. -1.2 10 -2.4 -2.2

40362_at X61498 1180 H.sapiens mRNA for NF-kB subunit. 2.4 14.4 112 12.3

36902_at X61587 1181 H.sapiens rhoG mRNA for GTPase. -2.5 -3.8 -2.3 -2.0

794_at X62055 1182 H.sapiens PTP1C mRNA for protein-tyrosine phosphatase 1C. -2.1 -2.8 -2.9 -1.7

38065_at X62534 1183 H.sapiens HMG-2 mRNA. -4.2 -24.3 -3.3 -7.2

37003 at X62654 1184 H.sapiens gene for Me491/CD63 antigen. 14 2.8 4.8 4.3

32318_s_at X63432 1185 H.sapiens ACTB mRNA for mutant beta-actin (beta'-actin). 3.1 3.2 -1.2 2.6

32435 at X63527 1186 H.sapiens mRNA for ribosomal protein L19. -17 -15 -16 -19

Table 7. Genes identified by DNA chip analysis.

ratio ratio ratio ratio

Affy ID Genbank Seq ID Gene Bank Names E.coli KIM5 KIM6 yopH

40791_at X63564 1187 H.sapiens mRNA for RNA polymerase II largest subunit. -5.2 -19 -18 -1.9

39097_at X63753 1188 H.sapiens son-a mRNA. -1.9 -1.0 -2.6 -2.9

40768_s_at X64228 1189 H.sapiens can mRNA. -2.0 -9.0 -47.7 -47.7

37544_at X64318 1190 H.sapiens E4BP4 gene. 2.2 2.6 2.6 2.5

36162_at X64364 1191 H.sapiens mRNA for M6 antigen. 1.4 -1.1 -2.0 -1.4

31509_at X64707 1192 H.sapiens BBC1 mRNA. 1.6 J9.2 -12 -1.3

31775_at X65018 1193 H.sapiens mRNA for lung surfactant protein D. 1.8 3.8 1.8 4.5

31673_s_at X65784 1194 H.sapiens CAR gene. -16 -15 -14 -2.7

33467_at X66171 1195 H.sapiens CMRF35 mRNA, complete CDS. -8.9 3.4 2.2 5.6

1225_g_at X66363 1196 H.sapiens mRNA PCTAIRE-1 for serine/threonine protein kinase. -2.4 9.9 2.9 2.3

421_at X66397 1197 H.sapiens tpr mRNA. -5.5 1.3 -15 -1.3

422_s_at X66867 1198 Human helix-loop-helix zipper protein (max) mRNA, complete cds. -1.0 -18 -14 -1.3

423_at X66899 1199 H.sapiens EWS mRNA. -4.4 -19.1 -14 -1.1

40593_at X66975 1200 H.sapiens mRNA for heterogeneous nuclear ribonucleoprotein. 3.1 -2.3 -3.1 -2.4

31583_at X67247 1201 H.sapiens rpS8 gene for ribosomal protein S8. 1.8 -2.8 -2.2 -2.0

35125_at X67309 1202 H.sapiens gene for ribosomal protein S6. -11 -19 -1.7 -1.5

37689_s_at X68090 1203 H.sapiens Fc-gamma-RIIA gene for IgG Fc receptor class IIA (5'flank). -3.4 1.0 -1.0 -4.2

1005_at X68277 1204 H.sapiens CL 100 mRNA for protein tyrosine phosphatase. 4.0 4.2 2.2 -1.2

41573_at X68560 1205 H.sapiens SPR-2 mRNA for GT box binding protein. -1.5 -1.1 -1.2 -1.1

31952_at X69391 1206 H.sapiens mRNA for ribosomal protein L6. -18 1.6 -1.7 1.0

1984_s_at X69549 1207 Human GDP-dissociation inhibitor protein (Ly-GDI) mRNA, complete cds. 1.0 -2.5 -1.3 -8.1

40164_at X69550 1208 H.sapiens mRNA for rho GDP-dissociation Inhibitor 1 2.9 7.0 6.8 6.9

38076_at X69907 1210 H.sapiens gene for mitochondrial ATP synthase c subunit (P1 form). 1.6 2.2 -1.7 1.9

32529_at X69910 1211 H.sapiens p63 mRNA for transmembrane protein. 1.7 5.8 2.8 3.5

37994_at X69962 1212 H.sapiens FMR-1 mRNA. -17 -2.6 -3.8 -1.4

382_at X70218 1213 Homo sapiens mRNA for protein phosphatase X. -3.3 -2.0 -2.3 -2.4

36174_at X70326 1214 H.sapiens MacMarcks mRNA. -1.3 4.7 1.9 2.2

35175_f_at X70940 1215 H.sapiens mRNA for elongation factor 1 alpha-2. 2.9 13.2 6J 12.8

35174_i_at X70940 1215 H.sapiens mRNA for elongation factor 1 alpha-2. 2.9 -11 -3.7 -1.5

35966_at X71125 1216 H.sapiens mRNA for glutamine cyclotransferase. -15 -1.9 -2.8 -1.5

Table 7. Genes identified by DNA chip analysis.

ratio ratio ratio ratio

Affy ID Genbank Seq ID Gene Bank Names E.coli KIM5 KIM6 yopH

38686_at X71490 1217 H.sapiens mRNA for vacuolar proton ATPase, subunit D. -1.1 1.7 1.8 1.8

384_at X71874 1218 #N/A -1.7 -1.5 -4.1 -2.7

33931_at X71973 1219 H.sapiens GPx-4 mRNA for phospholipid hydroperoxide glutathione peroxidase. -1.7 -6.7 -2.3 -1.8

39415_at X72727 1221 H.sapiens tunp mRNA for transformation upregulated nuclear protein. -1.5 -1.4 -1.5 -3.1

40961_at X72889 1222 H.sapiens hbrm mRNA. 1.7 -2.0 -1.2 -2.2

34005_at X73079 1223 Homo sapiens encoding Polymeric immunoglobulin receptor. 1.0 6.5 1.3 4.7

40502_r_at X73114 1224 H.sapiens mRNA for slow MyBP-C. 5.2 1.0 1.0 5.7

37725_at X74008 1225 H.sapiens mRNA for protein phosphatase 1 gamma. 2.5 -2.6 -3.6 -2.9

36147_at X74104 1226 H.sapiens mRNA for TRAP beta subunit. 1.1 -11 1.4 -2.1

36375_at X74614 1227 H.sapiens ODF2 (allele 2) gene for outer dense fiber protein. 2.4 1.3 1.3 1.2

36180_s_at X75346 1228 H.sapiens mRNA for MAP kinase activated protein kinase. 1.0 7.3 4.9 5.2

1439_s_at X75346 1228 Human MAP kinase activated protein kinase 2 mRNA, complete cds. 1.0 13.9 10.3 9.4

33988_at X75861 1229 H.sapiens TEGT gene. 1.1 -1.7 -1.6 -1.5

33368_at X76040 1230 H.sapiens mRNA for Lon protease-like protein. 5.0 4.5 5.1 2.5

32597_at X76061 1231 H.sapiens p130 mRNA for 130K protein. -3.0 -1.2 -1.9 -15

36199_at X76105 1232 H.sapiens DAP-1 mRNA. -1.5 -16 -1.2 -2.1

37367_at X76228 1233 H.sapiens mRNA for vacuolar H+ ATPase E subunit. -2.0 1.1 1.1 1.4

34311_at X76648 1234 H.sapiens mRNA for glutaredoxin. -3.8 -3.6 -9.0 -6.1

34855_at X76770 1235 H.sapiens PAP mRNA. 1.2 2.0 -13 -2.2

38895_i_at X77094 1236 H.sapiens mRNA for p40phox. -1.0 -2.5 -4.6 -2.2

38403 at X77196 1237 H.sapiens mRNA for lysosome-associated membrane protein-2. -4.6 -1.5 -1.7 -2.5

33867_s_at X77494 1238 H.sapiens MSSP-2 mRNA. 1.1 -19.7 -5.0 -4.7

39174_at X77548 1239 H. sapiens cDNA for RFG. -1.2 -3.6 -6.3 -8.0

35746_r_at X78136 1240 H.sapiens hnRNP-E2 mRNA. -1.7 13 -11 -1.4

35745_f_at X78136 1240 H.sapiens hnRNP-E2 mRNA. -1.7 -1.1 -1.7 -1.1

31804_f_at X78283 1241 H.sapiens mRNA for aryl sulfotransferase (ST1 A3). -1.4 -3.2 -3.6 -3.9

38130_s_at X78711 1242 H.sapiens mRNA for glycerol kinase testis specific 1. -2.5 5.4 7.1 3.9

39649_at X78817 1243 H.sapiens partial C1 mRNA. 1.2 -2.2 -19 -2.0

34544_at X78925 1244 H.sapiens HZF2 mRNA for zinc finger protein. 1.7 12.9 17.0 10.2

32588 s at X78992 1245 H.sapiens ERF-2 mRNA. -137.4 -8.6 -8.3 -3.9

Table 7. Genes identified by DNA chip analysis.

ratio ratio ratio ratio

Affy ID Genbank Seq ID Gene Bank Names E.coli KIM5 KIM6 yopH

38740_at X79067 1246 H.sapiens ERF-1 mRNA 3' end. 2.3 3.2 1.6 1.8

31872_at X79201 1247 H.sapiens mRNA for SYT. 1.0 8.0 -1.2 1.6

36142_at X79204 1248 H.sapiens SCA1 mRNA for ataxin. -3.3 -7.0 -7.0 -7.0

41178_at X79234 1249 H.sapiens mRNA for ribosomal protein L11. -13 -17 -1.9 -2.3

36152_at X79353 1250 H.sapiens XAP-4 mRNA for GDP-dissociation inhibitor. -16 1.2 -1.3 1.2

38014_at X79448 1251 H.sapiens IFI-4 mRNA for type I protein. -1.3 -3.5 -5.0 -4.2

38064_at X79882 1252 H.sapiens Irp mRNA. -2.1 -2.9 -2.5 -2.6

38437_at X80199 1253 H.sapiens MLN51 mRNA. -2.0 -2.7 -2.8 -1.9

36480_at X80497 1254 H.sapiens PHKLA mRNA. -11 -1.9 -4.1 -3.4

39774_at X80695 1255 H.sapiens OXAI Hs mRNA. -1.7 -17 -16 14

40912_s_at X81372 1257 H.sapiens mRNA for biphenyl hydrolase-related protein. 11.1 13.5 3.0 3.4

32964_at X81479 1258 H.sapiens mRNA for EMR1 hormone receptor. -3.5 -13 1.0 -11

39308_r_at X81637 1259 H.sapiens clathrin light chain b gene. -4.0 3.7 -1.3 -11

39307_s_at X81637 1259 H.sapiens clathrin light chain b gene. -4.0 1.2 -4.2 -4.2

41724_at X81817 1260 H.sapiens BAP31 mRNA. -14 -7.7 -1.7 -1.8

36825_at X82200 1261 H.sapiens StafδO mRNA. -2.7 -4.4 -2.3 -1.6

36181_at X82456 1262 H.sapiens MLN50 mRNA. -2.1 -3.6 -3.2 -2.7

37029_at X83218 1263 H.sapiens mRNA for ATP synthase. 2.1 -5.2 -5.2 -5.2

1440_s_at X83490 1264 H.sapiens mRNA for APO-1 cell surface antigen. -1.2 2.9 -1.8 -3.7

34469_at X84746 1265 H.sapiens Histo-blood group ABO gene, exon 1 10.0 7.0 4.1 4.7

34733_at X85237 1266 H.sapiens mRNA for splicing factor SF3a120. 1.9 -12 1.1 -11

36137_at X86691 1267 H.sapiens mRNA for 218kD Mi-2 protein. 1.2 1.9 1.2 16

133_at X87212 1268 H.sapiens mRNA for cathepsin C. J0.7 -10 -1.4 1.2

38464_at X87237 1269 H.sapiens mRNA for processing a-glucosidase I. 10.0 1.0 1.0 1.0

41184_s_at X87344 1270 #N/A -3.3 -2.1 -23.4 -23.4

40777_at X87838 1271 H.sapiens mRNA for beta-catenin. 1.8 -1.3 -1.4 -3.0

36614_at X87949 1272 H.sapiens mRNA for BiP protein. 1.4 -11 -1.0 -2.9

36984_f_at X89214 1273 H.sapiens mRNA for haptoglobin related protein. 1.8 -2.9 -1.0 1.4

391_at X89416 1274 H.sapiens mRNA for protein phosphatase 5. 4.6 -1.3 2.7 -13

392_g_at X89416 1274 H.sapiens mRNA for protein phosphatase 5. 4.6 -2.0 4.6 5.5

Table 7. Genes identified by DNA chip analysis.

ratio ratio ratio ratio

Affy ID Genbank Seq ID Gene Bank Names E.coli KIM5 KIM6 yopH

37089_at X89654 1275 H.sapiens mRNA for cyritestin protein (clone T4A). 8.7 10 1.0 1.0

37351_at X90858 1276 H.sapiens mRNA for uridine phosphorylase. 1.3 6.6 2.4 -3.9

31558_at X91103 1277 H.sapiens mRNA for Hr44 protein. 2.5 5.3 1.3 2.6

39425_at X91247 1278 H.sapiens mRNA for thioredoxin reductase. -5.1 1.4 1.2 1.5

34849_at X91257 1279 H.sapiens mRNA for seryl-tRNA synthetase. -10.2 1.9 -2.0 -1.4

34268_at X91809 1280 H.sapiens mRNA for GAIP protein. -2.4 -3.5 -4.5 -3.5

36972_at X92098 1281 H.sapiens mRNA for transmembrane protein mp24. 1.9 -1.4 -1.7 -1.6

34753_at X92396 1282 H.sapiens mRNA for novel gene in Xq28 region. 1.4 -5.0 -2.1 -5.0

37188_at X92720 1283 H.sapiens mRNA for phosphoenolpyruvate carboxykinase. 9.1 1.0 1.0 1.0

35625_at X94630 1284 H.sapiens CD97 gene exon 1 (and joined CDS). -2.4 -2.9 -3.6 -2J

39342_at X94754 1285 H.sapiens mRNA for yeast methionyl-tRNA synthetase homologue. 1.9 1.5 -1.4 -2.1

41051_at X95073 1286 H.sapiens mRNA for translin associated protein X. -1.0 -4.7 -1.9 -4.7

33659_at X95404 1287 H.sapiens mRNA for non-muscle type cofilin. 1.0 2.1 1.3 1.4

39782_at X95592 1288 H.sapiens mRNA for C1D protein. -1.0 -2J -1.7 -6.7

36958 at X95735 1289 Homo sapiens mRNA for zyxin. 1.3 1.9 -11 1.5

34669_at X96717 1290 H.sapiens mRNA for transcription factor TFE3. 1.4 1.7 1.8 2.1

40698_at X96719 1291 H.sapiens mRNA for AICL (activation-induced C-type lectin). -2.1 -2.9 -1.6 -2J

39347_at X97074 1292 H.sapiens mRNS for clathrin-associated protein. -2.1 -1.5 -3.5 -1.4

33425_at X97548 1293 H.sapiens mRNA for TIFIbeta zinc finger protein. -2.4 -7.2 -2.0 1.2

33774_at X98172 1294 H.sapiens mRNA for MACH-alpha-1 protein. -20.7 -49.4 -7.5 -5.0

I5997_g_at X98261 1295 H.sapiens mRNA for M-phase phosphoprotein, mpp5. 1.8 2.3 1.9 4.8

35996 at X98261 1295 H.sapiens mRNA for M-phase phosphoprotein, mpp5. 1.8 3.0 1.8 1.8

970_r at X98296 1296 H.sapiens mRNA for ubiquitin hydrolase. -11 1.5 1.1 1.7

39159 at X99656 1298 H.sapiens mRNA for protein containing SH3 domain, SH3GL1. 1.0 5.8 2.6 4.1

36709_at Y00093 1300 H.sapiens mRNA for leukocyte adhesion glycoprotein p150,95. 2.0 1.7 1.1 1.7

39082 at Y00097 1301 Human mRNA for protein p68. 3.3 2.0 12 1.3

33424_at Y00281 1302 Human mRNA for ribophorin I. -1.5 -6.3 -3.3 -8.1

972_s_at Y00285 1303 Human cation-independent mannose 6-phosphate receptor mRNA, complete cds. -1.6 -34.9 J3.0 -1.2

31950_at Y00345 1304 Human mRNA for polyA binding protein. 1.1 1.6 1.7 1.6

37674 at Y00451 1306 Human mRNA for 5-aminolevulinate synthase. 2.5 -5.0 -1.7 -1.6

Table 7. Genes identified by DNA chip analysis.

ratio ratio ratio ratio

Affy ID Genbank Seq ID Gene Bank Names E.coli KIM5 KIM6 yopH

37177_at Y00636 1307 Human mRNA for lymphocyte function associated antigen-3 (LFA-3). -1.3 2.5 2.6 3.0

38547_at Y00796 1308 Human mRNA for leukocyte-associated molecule-1 alpha subunit (LFA-1 alpha subunit). -13.3 -14.2 -1.8 -2.8

35892_at Y00816 1309 Human mRNA for complement receptor type 1 (CR1 , C3b/C4b receptor, CD35). 1.4 -1.8 -1.4 1.9

41490_at Y00971 1310 Human mRNA for phosphoriobosyl pyrophosphate synthetase subunit II (EC 2.7.6.1). 9.6 8J 1.9 1.0

38331_at Y07566 1311 H.sapiens mRNA for RIT protein. -1.3 1.4 1.5 1.6

38479__at Y07969 1312 H.sapiens mRNA for APRIL protein. -1.3 2.2 -1.5 -2.9

32140_at Y08110 1313 H.sapiens mRNA for mosaic protein LRU . -1.1 -2.9 -3.0 -4.9

39950_at Y08136 1314 H.sapiens mRNA for ASM-like phosphodiesterase 3a. 2.8 3.1 -19 -19

36197_at Y08374 1315 H.sapiens gene encoding cartilage GP-39 protein, exon 1 and 2 (and joined CDS). -1.2 -1.3 -1.3 -1.2

35228_at Y08682 1316 H.sapiens mRNA for carnitine palmitoyltransferase I type I. -3.5 -8.2 -8.2 -8.2

1300_at Y08837 1317 Homo sapiens mRNA for RAD51 -like protein (XRCC2). 1.0 5.1 2.5 3.3

38445_at Y09160 1318 H.sapiens Subl5 mRNA. -16 -5.0 -4.4 -6.2

32179_s_at Y09568 1319 Homo sapiens mRNA for SNAP23B protein, complete CDS. -1.9 1.2 -2.2 -2.2

381_s_at Y10055 1321 H.sapiens mRNA for phosphoinositide 3-kinase. 13 1.3 -1.1 1.2

38642_at Y10183 1322 H.sapiens mRNA for MEMD protein. -2.0 2.1 -3.4 -3.4

37679_at Y10313 1323 Homo sapiens mRNA for PC4 protein (IFRD1 gene). -7.8 1.1 -2.5 -9.8

359_at Y10659 1324 H.sapiens IL-13Ra mRNA. J5.2 -1.2 -3.3 -19

35472_at Y10745 1325 H.sapiens mRNA for inwardly rectifing potassium channel Kir4.2. -1.3 11 1.3 -1.5

38862_at Y11215 1326 Homo sapiens mRNA for SKAP55 protein. 1.8 2.7 -1.7 -10

40729_s_at Y14768 1327 #N/A -5.1 -7.2 -4.7 -2.0

33641_g_at Y14768 1327 #N/A -1.2 -2.7 -2.5 -3.1

36482_s_at Y15724 1328 Homo sapiens SERCA3 gene, exons 1-7 (and joined CDS). -2J -1.8 -2.8 -2.6

33822__at Z11584 1329 H.sapiens mRNA for NuMA protein. -7.4 1.1 -12.0 -12.0

976_s__at Z11695 1330 H.sapiens 41 kDa protein kinase related to rat ERK2. -6.1 -1.3 -1.6 -1.3

32466_at Z12962 1331 H.sapiens mRNA for homologue to yeast ribosomal protein L41. -1.2 -1.2 -1.0 -1.2

362_at Z15108 1332 H.sapiens mRNA for protein kinase C zeta. -3.5 1.9 -1.6 -16

35121_at Z18956 1333 H.sapiens mRNA for taurine transporter. 2.3 -1.2 1.2 19

34091_s_at Z19554 1334 H.sapiens vimentin gene. 1.6 3.7 2.9 1.9

Table 7. Genes identified by DNA chip analysis.

ratio ratio ratio ratio

Affy ID Genbank Seq ID Gene Bank Names E.coli KIM5 KIM6 yopH

41256_at Z21507 1335 H.sapiens EF-1 delta gene encoding human elongation factor-1 -delta. 1.5 -1.2 -1.4 -1.7

37645_at Z22576 1336 H.sapiens CD69 gene. 3.7 11.9 3.9 -1.5

1615_at Z23115 1337 H.sapiens bcl-xL mRNA. -14 1.0 1.0 3.5

34742_at Z23115 1337 H.sapiens bcl-xL mRNA. -14 5.9 -2.8 1.5

34646_at Z25749 1338 H.sapiens gene for ribosomal protein S7. -4.4 -4.0 -1.7 -11.1

34085_at Z26876 1339 H.sapiens gene for ribosomal protein L38. 1.1 -1.2 -1.3 -3.5

31505_at Z28407 1340 H.sapiens mRNA for ribosomal protein L8. -2.7 -2J -2.5 -2.5

37731_at Z29064 1341 H.sapiens AF-1 p mRNA. -3.3 -4.6 -1.2 -4.6

34305_at Z29505 1342 H.sapiens mRNA for nucleic acid binding protein sub2.3. -2.1 -1.5 -1.6 -1.9

35646_at Z35093 1343 H.sapiens mRNA for SURF-1. -1.9 -1.8 -9.3 -1.8

36218_g_at Z35102 1344 H.sapiens mRNA for Ndr protein kinase. 1.2 -2.2 -2.5 -18

36217_at Z35102 1344 H.sapiens mRNA for Ndr protein kinase. 1.2 -8.9 -3.8 -8.9

37416_at Z35227 1345 H.sapiens TTF mRNA for small G protein. 11.3 9.8 10.0 9.8

39591_s_at Z36531 1346 H.sapiens mRNA for fibrinogen-like protein (pT49 protein). -3.7 -4.5 -3.1 -4.2

39592_r_at Z36531 1346 H.sapiens mRNA for fibrinogen-like protein (pT49 protein). -3.7 -4.4 -3.3 -4.4

1925_at Z36714 1347 H.sapiens mRNA for cyclin F. 1.0 18.8 9.2 10.6

35907_at Z36714 1347 H.sapiens mRNA for cyclin F. 1.0 3.4 1.0 2.9

35292_at Z37166 1348 H.sapiens BAT1 mRNA for nuclear RNA helicase (DEAD family). -2.7 -1.4 -2.1 -2.5

36710_at Z38026 1349 H.sapiens mRNA for FALL-39 peptide antibiotic. -1.1 -15 -1.7 1.2

40964_at Z46376 1350 H.sapiens HK2 mRNA for hexokinase II. 1.2 -1.2 -1.7 -3.2

39105_at Z46389 1351 Homo sapiens encoding vasodilator-stimulated phosphoprotein (VASP). -1.1 2.6 3.0 1.2

31951_s_at Z48501 1352 H.sapiens mRNA for polyadenylate binding protein II. -1.8 1.8 1.8 2.0

40142_at Z48570 1353 H.sapiens Sp17 gene. 1.0 -1.9 1.1 6.1

31510_s_at Z48950 1354 H.sapiens hH3.3B gene for histone H3.3. 1.4 1.1 1.9 -1.2

38091_at Z49107 1355 H.sapiens mRNA for galectin. -1.5 -1.2 -2.6 -1.5

33674_at Z49148 1356 H.sapiens mRNA for ribosomal protein L29. -1.6 -2.8 -2.5 -1.2

39003_at Z50022 1357 H.sapiens mRNA for surface glycoprotein. -3.7 -5.1 -3.7 -3.4

35909_at Z50194 1358 H.sapiens mRNA for PQ-rich protein. 27.9 24.0 16.4 8.5

36630_at Z50781 1359 H.sapiens mRNA for leucine zipper protein. -1.7 -3.5 -8.8 -5.0

40784 at Z69030 1360 H.sapiens mRNA for gamma 1 isoform of 61 kDa regulatory subunit of PP2A. -2.0 -1.4 -1.1 -1.7

Table 7. Genes identified by DNA chip analysis.

ratio ratio ratio ratio

Affy ID Genbank Seq ID Gene Bank Names E.coli KIM5 KIM6 yopH

37672 at Z72499 1361 H.sapiens mRNA for herpesvirus associated ubiquitin-specific protease (HAUSP). -1.1 -4.2 -1.3 -1.2

40466 at Z74792 1362 H.sapiens mRNA for CCAAT transcription binding factor subunit gamma. -1.3 -14.2 -3.0 -1.6

31523 f at Z80780 1364 H.sapiens H2B/h gene. -1.0 -1.5 -2.2 -1.4

31524 f at Z80782 1365 H.sapiens H2B/k gene. -1.0 -11 -11 1.0

39738 at Z82215 1366 #N/A -1.2 -2.7 -3.3 -2.3

Human DNA sequence from clone CTA-292E10 on chromosome 22q11-12 Contains the XBP1 gene for X-box binding protein 1 (TREB5), ESTs, STSs, GSSs and a putative CpG

39755 at Z93930 1367 island, complete sequence. 4.5 7.8 3.9 2.4

Human DNA sequence from clone 376D21 on chromosome Xq11.1-12 Contains the MSN gene for Moesin (Membrane-organizing Extension Spike protein), ESTs, STSs, GSSs,

40771_at Z98946 1368 genomic marker DXS8029 and a putative CpG island, complete sequence. -1.4 -1.7 -1.7 -2.1 38713 at Z99716 1369 #N/A 1.0 -1.1 1.2 2.0

Table 8. Genes identified by READS technology.

Gene

Affy ID Genbank Seq ID Symbol Gene Name

35299_at AB000409 15 MKNK1 MAP kinase-interacting serine/threonine kinase 1

34644_at AB021288 29 B2M Beta-2-microglobulin

37026_at AF001461 39 COPEB Core promoter element binding protein; CPBP

39043_at AF006084 46 ARPC1 B Actin related protein 2/3 complex, subunit 1A (41 kD); p41-Arc

37024_at AF010312 49 PIG7 LPS-induced TNF-alpha regulatory factor (LITAF)

34033 s at AF025531 57 LlR-7 Leukocyte immunoglobulin-like receptor 7

41198_at AF055008 72 GRN Granulin; Epithelin

35693_at AF070616 75 HPCAL1 Hippocalcin-like 1 ; Calcium-binding protein BDR-1

40082_at D 10040 158 FACL1 Fatty-acid-Coenzyme A ligase, long-chain 1 ; Palmitoyl-CoA ligase

32434_at D 10522 160 MACS Myristoylated alanine-rich protein kinase C substrate

40470 at D 10523 161 OGDH Oxoglutarate dehydrogenase

1199_at D 13748 168 EIF4A1 Eukaryotic translation initiation factor 4A, isoform 1

1891_at D 14497 172 MAP3K8 MAP kinase kinase kinase 8

41212_r_at D26068 196 WBSCR1 Williams-Beuren syndrome chromosome region 1; KIAA0038; EIF-4H

40712_at D26579 198 ADAM8 A disintegrin and metalloprotease domain 8; CD156

41237_at D32129 220 HLA-A

336_at D38081 225 TBXA2R Thromboxane A2 receptor

41632_at D38550 228 E2F-3 E2F transcription factor 3; KIAA0075

38138_at D38583 230 S100A11 S100 calcium-binding protein A11 ; Calgizzarin

38617_at D45906 238 LIMK2 LIM domain kinase 2

1512_at D86550 285 DYRK1A DYRK dual specificity threonine kinase 1A

1622_at D87116 297 PRKMK3 MAP kinase kinase 3b; MKK3b

ATPase, H+ transporting, lysosomal (vacuolar proton pump) 21 kD; Proton-ATPase-like protein yeast

36167_at D89052 308 ATP6F proteolipid (HATPL)

1426_at D89077 309 SLA Src-like-adapter

36675_r_at J03191 329 PFN1 Profilin 1

1389_at J03779 335 MME Neprilysin; Enkephalinase; CD10

37200_at J04162 340 CGR3A Fc-gamma receptor, low affinity Ilia; CD16

676_g_at J04164 341 IFI17 IFN-inducible protein 9-27; leu-13 antigen

Table 8. Genes identified by READS technology.

Gene

Affy ID Genbank Seq ID Symbol Gene Name

1127_at L07597 379 RPS6KA1 Ribosomal protein S6 kinase, 90kD, polypeptide 1

33146_at L08246 382 MCL1 BCL2-related; Myeloid cell differentiation protein

37701_at L13463 405 RGS2 Regulator of G-protein signaling 2, 24kD; G0S8

33943 at L20941 424 FTH1 Ferritin, heavy polypeptide 1

37693_at L40393 466 NUMB Homologue of numb [Fruit fly]

37574_at L43821 474 HEF1 Enhancer of filamentation 1

36669_at L49169 478 FOSB fosB; G0S3

1100_at L76191 480 IRAKI Interleukin 1 receptor-associated kinase 1

254_at M11353 487 H3F3A H3 histone, family 3A

37918_at M15395 505 ITGB2 Integrin, beta 2; Mac-1 beta; LFA-1 ; CD18

35372_r_at M17017 513 IL8 Interleukin 8

31557_at M 17733 514 TMSB4X Thymosin, beta 4, X chromosome

35807_at M21186 526 CYBA p22-PHOX; Cytochrome b-245, alpha polypeptide

39385_at M22324 529 ANPEP Membrane alanyl aminopeptidase; CD13

245_at M25280 541 SELL Selectin L; Lymph node homing receptor; CD62L

2050 s at M29870 556 RAC1 Ras-related C3 botulinum toxin substrate 1

1372_at M31165 560 TNFAIP6 TNF alpha-induced protein 6; Hyaluronate-binding protein

41038 at M32011 566 NCF2 Neutrophil cytosolic factor 2; p67-PHOX

36889_at M33195 569 FCER1G Fc fragment of IgE, high affinity I

36493_at M33552 575 LSP1 Lymphocyte-specific protein 1

37187_at M36820 589 GR02 GR02 oncogene; MIP-2-alpha

38378_at M37033 591 CD53

2036_s_at M59040 614 CD44 Hyaluronate receptor

40019_at M60830 619 EVI2B Ectropic viral integration site 2B; Intron of the neurofibromatosis type 1 (NF1) gene

36994_at M62762 622 ATP6C ATPase, H+ transporting, lysosomal (vacuolar proton pump) 16kD

36097_at M62831 624 ETR101 Immediate early protein ETR101 ; ETR101 early response factor

1461 at M69043 646 NFKBIA l-kappa-B alpha

38326_at M69199 647 Putative lymphocyte G0/G1 switch protein 2 (G0S2)

40840 at M80254 655 PPIF Cyclophilin F

Table 8. Genes identified by READS technology.

Gene

Affy ID Genbank Seq ID Symbol Gene Name

37556_at M81637 659 GCL Grancalcin

35012 at M81750 660 MNDA Myeloid cell nuclear differentiation antigen

31330_at M81757 661 RPS19 Ribosomal protein S19

38631_at M92357 689 TNFAIP2 TNF alpha-induced protein 2; B94

40448_at M92843 691 ZFP36 TTP; TIS11 ; G0S24

31508 at S73591 726 VDUP1 Upregulated by 1 ,25-dihydroxyvitamin D-3; Homologue of HHCPA 78

853_at S74017 727 NFE2L2 Nrf2

181_g_at S82470 741 BB1; AN43 antigen

1061_at U00672 746 IL10RA Interleukin 10 receptor, alpha

33849_at U02020 752 PBEF Pre-B cell colony-enhancing factor; G0S9

36980_at U03105 757 B4-2 B4-2 proline rich protein

41140_at U05875 770 IFNGR2 Interferon-gamma receptor beta chain

32587 at U07802 776 BRF2 EGF-response factor 2; Homologue of TIS11 D [Mouse]

31432_g_at U 12255 797 FCGRT Fc fragment of IgG, receptor, transporter, alpha

39319_at U20158 830 LCP2 Lymphocyte cytosolic protein 2; SLP-76

2002_s_at U27467 849 BCL2A1 BCL2-related protein A1 ; Bfl-1

36977_at U39412 884 NAPA Alpha-soluble NSF attachment protein (alpha SNAP)

840_at U47742 919 ZNF220 Zinc finger protein 220; Monocytic leukaemia zinc finger protein (MOZ)

37360_at U66711 974 LY6E RIG-E; human homologue of LY6

36634_at U72649 992 BTG2 TIS21 ; NGF-inducible PC3 anti-proliferative protein

41045_at U77643 1002 SECTM1 Secreted and transmembrane 1

824 at U90313 1037 GSTTLp28 Glutathione-S-transferase homologue

38276_at U91616 1047 NFKBIE l-kappa-B epsilon

1916_s_at V01512 1059 FOS* v-fos homologue; G0S7; c-fos

34160_at X04098 1073 ACTG1 gamma-actin

39753_at X06256 1083 ITGA5 Integrin alpha-5; Fibronectin receptor alpha subunit; CD49e

37328_at X07743 1094 PLEK Pleckstrin

41088_at X12433 1096 HS1-2 Putative transmembrane protein

32316_s_at X15183 1107 HSPCA Heat shock 90kD protein 1 , alpha

31584 at X16064 1111 TPT1 IgE-dependent histamine-releasing factor

Table 8. Genes identified by READS technology.

Gene

Affy ID Genbank Seq ID Symbol Gene Name

31820_at X16663 1115 HCLS1 Hematopoietic cell-specific Lyn substrate 1; HS1

32227_at X17042 1118 PRG1 Proteoglycan 1 , secretory granule

789_at X52541 1133 EGR1 G0S30; TIS8; KROX24; NGFIA; ETR103

38354_at X52560 1134 CEBPB NF-IL6; C/EBP beta

32321_at X56841 1152 HLA-E

>8441_s_at X59408 1166 MCP Membrane cofactor protein; Trophoblast-lymphocyte cross-reactive antigen; CD46

402_s_at X69819 1209 1CAM3 Intercellular adhesion molecule 3; CD50

39802 at X72308 1220 SCYA7 Small inducible cytokine A7 (monocyte chemotactic protein 3)

33614_at X80822 1256 RPL18A Ribosomal protein L18a

35132_at X98411 1297 MY01 E Myosin IE

40518_at Y00062 1299 PTPRC Leukocyte common antigen; Protein tyrosine phosphatase, receptor type, c polypeptide; CD45

40637_at Y00371 1305 HSPA10 Heat shock 70kD protein 10 (HSC71 )

973_at Y10032 1320 SGK Serum/glucocorticoid regulated kinase

978 at Z79581 1363 BCL6 B-cell CLL/lymphoma 6; Zinc finger protein 51

Claims

What is claimed is:

1. A method of detecting granulocyte activation, comprising:

(a) detecting the level of expression in a sample of one or more genes from Tables 2-8;

(b) comparing the expression level to an expression level in an un-activated granulocyte, wherein differential expression of the genes in Tables 2-8 is indicative of granulocyte activation.

2. A method of modulating granulocyte activation, comprising:

(a) contacting a granulocyte with an agent, wherein the agent alters the expression of at least one gene in Tables 2-8 thereby modulating granulocyte activation.

3. A method of screening for an agent capable of modulating granulocyte activation, comprising:

(a) preparing a first gene expression profile of a cell population comprising granulocytes, wherein the expression profile determines the expression level of one or more genes from Tables 2-8;

(b) exposing the cell population to the agent; (c) preparing second gene expression profile of the agent-exposed cell population; and (d) comparing the first and second gene expression profiles.

4. A method of detecting an inflamation in a tissue, comprising: (a) detecting the level of expression in a sample of the tissue of one or more genes from Tables 2-8; wherein the level of expression of the genes in Tables 2-8 is indicative of inflammation.

5. A method of treating an inflammation in a tissue, comprising: (a) contacting a tissue having an inflammation with an agent, wherein the agent alters the expression in the tissue of at least one gene in Tables 2-8 thereby treating the inflammation.

6. A method of screening for an agent capable of modulating an inflammation in a tissue, comprising:

(a) preparing a first gene expression profile of a sample of the tissue, wherein the expression profile determines the expression level of one or more genes from Tables 2- 8;

(b) exposing the tissue to the agent;

(c) preparing second gene expression profile of the agent-exposed tissue; and

(d) comparing the first and second gene expression profiles.

7. A method of detecting a chronic inflamation in a tissue, comprising:

(a) detecting the level of expression in a sample of the tissue of one or more genes from Tables 2-8; wherein the level of expression of the genes in Tables 2-8 is indicative of a chronic inflammation.

8. A method of treating a chronic inflammation in a tissue, comprising:

(a) contacting a tissue having a chronic inflammation with an agent, wherein the agent alters the expression in the tissue of at least one gene in Tables 2-8 thereby treating the chronic inflammation.

9. A method of screening for an agent capable of modulating a chronic inflammation in a tissue, comprising:

(a) preparing a first gene expression profile of a sample of the tissue, wherein the expression profile determines the expression level of one or more genes from

Tables 2-8; (b) exposing the tissue to the agent;

(c) preparing a second gene expression profile of the agent-exposed tissue; and

(d) comparing the first and second gene expression profiles.

10. A method of detecting an allergic response in a subject, comprising: (a) obtaining a sample from the subject, the sample comprising granulocytes;

(b) preparing a gene expression profile of the sample, wherein the expression profile determines the expression level of one or more genes from Tables 2-8; (c) comparing the expression level to an expression level in a sample from a normal individual, wherein differential expression of the genes in Tables 2-8 is indicative of an allergic response.

11. A method of treating an allergic response in a subject, comprising:

(a) administering to the subject an agent, wherein the agent alters the expression in the tissue of at least one gene in Tables 2-8 thereby treating the allergic response.

12. A method of screening for an agent capable of modulating an allergic response in a subject, comprising:

(a) preparing a first gene expression profile of a sample from the subject, wherein the expression profile determines the expression level of one or more genes from

Tables 2-8; (b) administering to the subject an agent;

(c) preparing a second gene expression profile of a sample from the agent- exposed subject; and

(d) comparing the first and second gene expression profiles.

13. A method of detecting exposure of a subj ect to a pathogen, comprising:

(a) preparing a first gene expression profile of a granulocyte population from the subject, wherein the expression profile determines the expression level of one or more genes from Tables 2-8;

(b) comparing the first gene expression profile to a second gene expression profile from a granulocyte population exposed to the pathogen and to a third gene expression profile from a granulocyte population not exposed to the pathogen; and

(c) determining whether the subject was exposed to the pathogen.

14. A method of treating a subject exposed to a pathogen, comprising: (a) administering to the subject an agent, wherein the agent affects the expression of at least one gene in Tables 2-8 thereby treating the subject.

15. A method of screening for an agent that modulates a response of a granulocyte population to a pathogen, comprising:

(a) preparing a first gene expression profile of a first sample from the granulocyte population, wherein the expression profile determines the expression level of one or more genes from Tables 2-8;

(b) exposing a second sample of the granulocyte population to a pathogen and preparing a second gene expression profile from the second sample;

(c) contacting the pathogen-exposed granulocyte population with an agent and preparing a third gene expression profile from the agent-contacted pathogen-exposed population;

(d) comparing the first, second and third gene expression profiles; and

(e) identifying agents that modulate the response of a granulocyte population to the pathogen.

16. A method of detecting a sterile inflammatory disease in a subject, comprising:

(a) detecting the level of expression in a sample from the subject of one or more genes from Tables 2-8; wherein the level of expression of the genes in Tables 2-8 is indicative of a sterile inflammatory disease.

17. A method of treating a sterile inflammatory disease in a subject, comprising:

(a) contacting the subject with an agent, wherein the agent alters the expression in the tissue of at least one gene in Tables 2-8 thereby treating the sterile inflammatory disease.

18. A method of screening for an agent capable of modulating a sterile inflammatory disease in a subject, comprising:

(a) preparing a first gene expression profile of a sample from the subject, wherein the expression profile determines the expression level of one or more genes from Tables 2-8;

(b) exposing the subject to the agent;

(c) preparing second gene expression profile of a sample obtained from the J lO- agent-exposed subject; and (d) comparing the first and second gene expression profiles.

19. A composition comprising at least two ohgonucleotides, wherein each of the ohgonucleotides comprises a sequence that specifically hybridizes to a gene in Tables

2-8.

20. A composition according to claim 19, wherein the composition comprises at least 3 ohgonucleotides, wherein each of the ohgonucleotides comprises a sequence that specifically hybridizes to a gene in Tables 2-8.

21. A composition according to claim 19, wherein the composition comprises at least 5 ohgonucleotides, wherein each of the ohgonucleotides comprises a sequence that specifically hybridizes to a gene in Tables 2-8.

22. A composition according to claim 19, wherein the composition comprises at least 7 ohgonucleotides, wherein each of the ohgonucleotides comprises a sequence that specifically hybridizes to a gene in Tables 2-8.

23. A composition according to claim 19, wherein the composition comprises at least 10 ohgonucleotides, wherein each of the ohgonucleotides comprises a sequence that specifically hybridizes to a gene in Tables 2-8.

24. A composition according to any one of claims 19-23, wherein at least one oligonucleotide is attached to a solid support.

25. A composition according to claim 24, wherein the solid support is selected from a group consisting of a membrane, a glass support, a filter, a tissue culture dish, a polymeric material, a bead and a silica support.

26. A solid support comprising at least two ohgonucleotides, wherein each of the ohgonucleotides comprises a sequence that specifically hybridizes to a gene in Tables 2-8.

27. A solid support according to claim 26, wherein at least one of the ohgonucleotides is covalently attached to the solid support.

28. A solid support according to claim 26, wherein at least one of the ohgonucleotides is non-covalently attached to the solid support.

29. A solid support according to claim 26, wherein the support comprises at least 10 different ohgonucleotides in discrete locations per square centimeter.

30. A solid support according to claim 26, wherein the support comprises at least 100 different ohgonucleotides in discrete locations per square centimeter.

31. A solid support according to claim 26, wherein the support comprises at least 1000 different ohgonucleotides in discrete locations per square centimeter.

32. A solid support according to claim 26, wherein the support comprises at least 10,000 different ohgonucleotides in discrete locations per square centimeter.

33. A computer system comprising:

(a) a database containing information identifying an expression level in a cell population comprising granulocytes of a set of genes comprising at least two genes in Tables 2-8; and

(b) a user interface to view the information.

34. A computer system of claim 33, wherein the database further comprises sequence information for the genes.

35. A computer system of claim 33, wherein the database further comprises information identifying the expression level for the set of genes in a cell population comprising non-activated granulocytes.

36. A computer system of claim 33, wherein the database further comprises information identifying the expression level of the set of genes in a cell population comprising activated granulocytes.

37. A computer system of any of claims 33-36, further comprising records including descriptive information from an external database, which information correlates said genes to records in the external database.

38. A computer system of claim 37, wherein the external database is GenBank.

39. A method of using a computer system of any one of claims 33-36 to present information identifying the expression level in a tissue or cell of at least one gene in Tables 2-8, comprising:

(a) comparing the expression level of at least one gene in Tables 2-8 in the tissue or cell to the level of expression of the gene in the database.

40. A method of claim 39, wherein the expression level of at least two genes are compared.

41. A method of claim 39, wherein the expression level of at least five genes are compared.

42. A method of claim 39, wherein the expression level of at least ten genes are compared.

43. A method of claim 39, further comprising displaying the level of expression of at least one gene in the tissue or cell sample compared to the expression level in a cell population comprising activated granulocytes.

44. A method of identifying virulence factor genes in a pathogen, comprising:

(a) preparing a first gene expression profile of a quiescent granulocyte population;

(b) preparing a second gene expression profile of a granulocyte population exposed to a virulent or avirulent strain of pathogen;

(c) preparing a third gene expression profile from a granulocyte population exposed to a strain of pathogen with a mutation in a putative virulence factor gene; and

(d) comparing the first, second and third gene expression profiles to identify a virulence factor gene of the pathogen.