WO2004044138A2 - Chimeric oligomeric compounds and their use in gene modulation - Google Patents
Chimeric oligomeric compounds and their use in gene modulation Download PDFInfo
- Publication number
- WO2004044138A2 WO2004044138A2 PCT/US2003/035074 US0335074W WO2004044138A2 WO 2004044138 A2 WO2004044138 A2 WO 2004044138A2 US 0335074 W US0335074 W US 0335074W WO 2004044138 A2 WO2004044138 A2 WO 2004044138A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- nucleotides
- composition
- alkyl
- type
- linkages
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1135—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against oncogenes or tumor suppressor genes
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
- C07H21/00—Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
- C07H21/02—Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids with ribosyl as saccharide radical
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/111—General methods applicable to biologically active non-coding nucleic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1137—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y301/00—Hydrolases acting on ester bonds (3.1)
- C12Y301/03—Phosphoric monoester hydrolases (3.1.3)
- C12Y301/03048—Protein-tyrosine-phosphatase (3.1.3.48)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering N.A.
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/31—Chemical structure of the backbone
- C12N2310/315—Phosphorothioates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/31—Chemical structure of the backbone
- C12N2310/318—Chemical structure of the backbone where the PO2 is completely replaced, e.g. MMI or formacetal
- C12N2310/3181—Peptide nucleic acid, PNA
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/32—Chemical structure of the sugar
- C12N2310/321—2'-O-R Modification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/32—Chemical structure of the sugar
- C12N2310/322—2'-R Modification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/34—Spatial arrangement of the modifications
- C12N2310/341—Gapmers, i.e. of the type ===---===
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/34—Spatial arrangement of the modifications
- C12N2310/345—Spatial arrangement of the modifications having at least two different backbone modifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/34—Spatial arrangement of the modifications
- C12N2310/346—Spatial arrangement of the modifications having a combination of backbone and sugar modifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2320/00—Applications; Uses
- C12N2320/50—Methods for regulating/modulating their activity
- C12N2320/51—Methods for regulating/modulating their activity modulating the chemical stability, e.g. nuclease-resistance
Definitions
- the present invention provides modified oligomers that modulate gene expression via a RNA interference pathway.
- the oligomers ofthe invention include one or more modifications thereon resulting in differences in various physical properties and attributes compared to wild type nucleic acids.
- the modified oligomers are used alone or in compositions to modulate the targeted nucleic acids.
- the modified oligomers are chimeric in nature.
- dsRNA double-stranded RNA
- Timmons and Fire led Timmons and Fire to explore the limits of the dsRNA effects by feeding nematodes bacteria that had been engineered to express dsRNA homologous to the C. elegans unc-22 gene.
- these worms developed an unc-22 nulllike phenotype (Timmons and Fire, Nature 1998, 395, 854; Timmons et al, Gene, 2001, 263, 103-112).
- soaking worms in dsRNA was also able to induce silencing (Tabara et al, Science, 1998, 282, 430-431).
- PCT publication WO 01/48183 discloses methods of inhibiting expression of a target gene in a nematode worm involving feeding to the worm a food organism which is capable of producing a double-stranded RNA structure having a nucleotide sequence substantially identical to a portion ofthe target gene following ingestion of the food organism by the nematode, or by introducing a DNA capable of producing the double- stranded RNA structure (Bogaert et al., 2001).
- dsRNA double-stranded RNA interference
- dsRNA double-stranded RNA
- Montgomery et al. suggests that the primary interference affects of dsRNA are post-transcriptional. This conclusion being derived from examination ofthe primary DNA sequence after dsRNA-mediated interference and a finding of no evidence of alterations, followed by studies involving alteration of an upstream operon having no effect on the activity of its downstream gene. These results argue against an effect on initiation or elongation of transcription.
- dsRNA-mediated interference produced a substantial, although not complete, reduction in accumulation of nascent transcripts in the nucleus, while cytoplasmic accumulation of transcripts was virtually eliminated.
- endogenous mRNA is the primary target for interference and suggest a mechanism that degrades the targeted mRNA before translation can occur. It was also found that this mechanism is not dependent on the SMG system, an mRNA surveillance system in C. elegans responsible for targeting and destroying aberrant messages.
- the authors further suggest a model of how dsRNA might function as a catalytic mechanism to target homologous mRNAs for degradation. (Montgomery et al, Proc. Natl. Acad. Sci. USA, 1998, 95, 15502-15507).
- RNAi Drosophila embryos, which recapitulates many ofthe features of RNAi, has been reported.
- the interference observed in this reaction is sequence specific, is promoted by dsRNA but not single- stranded RNA, functions by specific mRNA degradation, and requires a minimum length of dsRNA.
- preincubation of dsRNA potentiates its activity demonstrating that RNAi can be mediated by sequence-specific processes in soluble reactions (Tuschl et al., Genes Dev., 1999, 13, 3191-3197).
- RNAi short interfering RNAs
- siRNAs short interfering RNAs
- the Drosophila embryo extract system has been exploited, using green fluorescent protein and luciferase tagged siRNAs, to demonstrate that siRNAs can serve as primers to transform the target mRNA into dsRNA.
- the nascent dsRNA is degraded to eliminate the incorporated target mRNA while generating new siRNAs in a cycle of dsRNA synthesis and degradation.
- Evidence is also presented that mRNA-dependent siRNA incorporation to form dsRNA is carried out by an RNA-dependent RNA polymerase activity (RdRP) (Lipardi et al., Cell, 2001, 107, 297-307).
- RdRP RNA-dependent RNA polymerase activity
- RNAi in Caenorhabditis elegans, Sijen et al revealed a substantial fraction of siRNAs that cannot derive directly from input dsRNA. Instead, a population of siRNAs (termed secondary siRNAs) appeared to derive from the action ofthe previously reported cellular RNA-directed RNA polymerase (RdRP) on mRNAs that are being targeted by the RNAi mechanism. The distribution of secondary siRNAs exhibited a distinct polarity (5'-3'; on the antisense strand), suggesting a cyclic amplification process in which RdRP is primed by existing siRNAs. This amplification mechanism substantially augmented the potency of RNAi-based surveillance, wlrier ensuring that the RNAi machinery will focus on expressed mRNAs (Sijen et al., Cell, 2001, 107, 465-476).
- RdRP RNA-directed RNA polymerase
- RNA oligomers of antisense polarity can be potent inducers of gene silencing.
- antisense RNAs act independently ofthe RNAi genes rde-1 and rde-4 but require the mutator/RNAi gene mut-7 and a putative DEAD box RNA helicase, mut- 14.
- RNA-DNA heteroduplexes did not serve as triggers for RNAi.
- dsRNA containing 2'-F-2'-deoxynucleosides appeared to be efficient in triggering RNAi response independent ofthe position (sense or antisense) ofthe 2'-F-2'-deoxynucleosides.
- electroporated dsRNA and a 25mer morpholino oligomer in post implantation mouse embryos (Mellitzer et al, Mehanisms of Development, 2002, 118, 57-63). The morpholino oligomer did show activity but was not as effective as the dsRNA.
- RNAi phenomenon include: PCT publication WO 00/44895; PCT publication WO 00/49035; PCT publication WO 00/63364; PCT publication WO 01/36641; PCT publication WO 01/36646; PCT publication WO 99/32619; PCT publication WO 00/44914; PCT publication WO 01/29058; and PCT publication WO 01/75164.
- RNA interference pathway for modulation of gene expression is an effective means for modulating the levels of specific gene products and, thus, would be useful in a number of therapeutic, diagnostic, and research applications involving gene silencing.
- the present invention therefore provides oligomeric compounds useful for modulating gene expression pathways, including those relying on mechanisms of action such as RNA interference and dsRNA enzymes, as well as antisense and non-antisense mechanisms.
- RNA interference and dsRNA enzymes as well as antisense and non-antisense mechanisms.
- antisense and non-antisense mechanisms One having skill in the art, once armed with this disclosure will be able, without undue experimentation, to identify preferred oligonucleotide compounds for these uses.
- the invention relates to compositions comprising a first oligomer and a second oligomer, each having linked nucleosidic bases. At least a portion ofthe first oligomer is capable of hybridizing with at least a portion ofthe second oligomer, at least a portion ofthe first oligomer is complementary to and capable of hybridizing to a selected target nucleic acid, and at least one ofthe oligomers is a chimeric oligomeric compound.
- the chimeric oligomeric compound is a gapmer, an inverted gapmer, a 3'-hemimer, a 5'-hemimer or a blockmer.
- the chimeric oligomeric compound comprises at least two of DNA, RNA, PNA segments, and mixtures thereof.
- the chimeric oligomeric compound may be a gapmer.
- the gapmer comprises two terminal RNA segments having nucleotides of a first type and an internal RNA segment having nucleotides of a second type and where said nucleotides of said first type are different from said nucleotides of said second type.
- the nucleotides ofthe first type independently include at least one sugar substituent which is halogen, amino, trifluoroalkyl, trifluoroalkoxy, azido, aminooxy, alkyl, alkenyl, alkynyl, O-, S-, or N(R*)-alkyl; O-, S-, or N(R*)-alkenyl; O-, S- or N(R*)-alkynyl; O-, S- or N-aryl, O-, S-, or N(R*)-aralkyl; where the alkyl, alkenyl, alkynyl, aryl and aralkyl may be substituted or unsubstituted C ⁇ to C 10 alkyl, C 2 to C 10 alkenyl, C to C 10 alkynyl, C 5 -C 20 aryl or C 6 -C 2 o aralkyl; and said substituted to C 10 alkyl, C 2 to
- the chimeric oligomeric compound is an inverted gapmer.
- the inverted gapmer comprises two terminal RNA segments having nucleotides of a second type and an internal RNA segment having nucleotides of a first type and where said nucleotides of said first type are different from said nucleotides of said second type.
- each ofthe nucleotides of said first type independently have at least one sugar substituent that is halogen, amino, trifluoroalkyl, trifluoroalkoxy, azido, aminooxy, alkyl, alkenyl, alkynyl, O-, S-, or N(R*)-alkyl; O-, S-, or N(R*)-alkenyl; O-, S- or N(R*)-alkynyl; O-, S- or N-aryl, O-, S-, or N(R*)-aralkyl; where the alkyl, alkenyl, alkynyl, aryl and aralkyl may be substituted or unsubstituted C 1 to C 10 alkyl, C 2 to C 10 alkenyl, C 2 to C 10 alkynyl, C 5 -C 2 o aryl or C 6 -C 20 aralkyl; and said substituted C ⁇ to C 10 alky
- the chimeric oligomeric compound is 3'-hemimer.
- the 3'-hemimer comprises a terminal RNA segment having nucleotides of a first type and a further RNA segment having nucleotides of a second type and where said nucleotides of said first type are different from said nucleotides of said second type.
- each ofthe nucleotides ofthe first type independently includes at least one sugar substituent that is halogen, amino, trifluoroalkyl, trifluoroalkoxy, azido, aminooxy, alkyl, alkenyl, alkynyl, O-, S-, or N(R*)-alkyl; O-, S-, or N(R*)-alkenyl; O-, S- or N(R*)-alkynyl; O-, S- or N-aryl, O-, S-, or N(R*)-aralkyl; where the alkyl, alkenyl, alkynyl, aryl and aralkyl may be substituted or unsubstituted C 1 to C 10 alkyl, C 2 to C 10 alkenyl, C 2 to C 10 alkynyl, C 5 -C 20 aryl or C 6 -C2o aralkyl; and said substituted C 1 to C 10 alkyl
- the invention concerns compositions where chimeric oligomeric compound is 5'-hemimer.
- the 5'-hemimer comprises a terminal RNA segment having nucleotides of a first type and a further RNA segment having nucleotides of a second type and where said nucleotides of said first type are different from said nucleotides of said second type.
- each ofthe nucleotides of said first type independently includes at least one sugar substituent that is halogen, amino, trifluoroalkyl, trifluoroalkoxy, azido, aminooxy, alkyl, alkenyl, alkynyl, O-, S-, or N(R*)-alkyl; O-, S-, or N(R*)-alkenyl; O-, S- or N(R*)-alkynyl; O-, S- or N-aryl, O-, S-, or N(R*)-aralkyl; where the alkyl, alkenyl, alkynyl, aryl and aralkyl may be substituted or unsubstituted to C 10 alkyl, C 2 to C 10 alkenyl, C 2 to C 10 alkynyl, C 5 -C2o aryl or C 6 -C2 0 aralkyl; and said substituted to C 10 alkyl, C 2
- the blockmer is an oligonucleotide having a block of at least two consecutive nucleotides of a first type located immediately adjacent at least one nucleotide of a second type and where said nucleotides of said first type are different from said nucleotides of said second type.
- each ofthe nucleotides of said first type independently includes at least one sugar substituent that is halogen, amino, trifluoroalkyl, trifluoroalkoxy, azido, aminooxy, alkyl, alkenyl, alkynyl, O-, S-, or N(R*)-alkyl; O-, S-, or N(R*)-alkenyl; O-, S- or N(R*)-alkynyl; O-, S- or N-aryl, O-, S-, or N(R*)-aralkyl; where the alkyl, alkenyl, alkynyl, aryl and aralkyl may be substituted or unsubstituted Ci to C 10 alkyl, C 2 to C 10 alkenyl, C 2 to C 10 alkynyl, C 5 -C 20 aryl or C 6 -C2 0 aralkyl; and said substituted d to do alkyl,
- Some embodiments further comprise a plurality of blocks of at least two consecutive nucleotides of a first type and wherein each of said blocks of nucleotides of said first type is separated from others of said blocks of nucleotides of said first type by a nucleotide of said second type.
- the chimeric oligomer compound comprises a gapmer ofthe formula PNA-RNA-PNA.
- the chimeric oligomeric compound comprises a 5'-hemimer the formula PNA-RNA or a 3'-hemimer ofthe formula RNA-PNA.
- the chimeric oligomeric compound comprises an inverted gapmer ofthe formula RNA-PNA-RNA.
- the compounds ofthe invention may be chimeric oligomeric compound that are divided into at least two regions: a first region comprising ⁇ -nucleosides linked by charged or neutral 3'-5' phosphorous linkages; ⁇ -nucleosides linked by charged or neutral 2'-5' phosphorous linkages; ⁇ -nucleosides linked by non-phosphorous linkages; 4'-thionucleosides linked by charged or neutral 3'-5' phosphorous linkages; 4'-thionucleosides linked by charged or neutral 2'- 5' phosphorous linkages; 4'-thionucleosides linked by non-phosphorous linkages; carbocyclic- nucleosides linked by charged or neutral 3'-5' phosphorous linkages; carbocyclic-nucleosides linked by charged or neutral 2'-5' phosphorous linkages; carbocyclic-nucleosides linked by non- phosphorous linkages; ⁇ -nucleosides linked by charged or neutral or neutral
- Some preferred embodiments are divided into at least two regions: a first region comprising ⁇ -nucleosides linked by charged or neutral 3'-5' phosphorous linkages, ⁇ -nucleosides linked by charged or neutral 2'-5' phosphorous linkages, ⁇ -nucleosides linked by non- phosphorous linkages, 4'-thionucleosides linked by charged or neutral 3'-5' phosphorous linkages, 4'-thionucleosides linked by charged or neutral 2'-5' phosphorous linkages, 4'- thionucleosides linked by non-phosphorous linkages, carbocyclic-nucleosides linked by charged or neutral phosphorous linkages, carbocyclic-nucleosides linked by non-phosphorous linkages, ⁇ -nucleosides linked by charged or neutral 3'-5' linkages, ⁇ -nucleosides linked by charged or neutral 2'-5' linkages, or ⁇ -nucleosides linked links linked with charged
- the chimeric oligomeric compound is divided into at least two regions: a first region comprising nucleobases linked by non-phosphorous linkages and nucleobases that are attached to phosphate linkages via non-sugar tethering groups, and nucleosides selected from ⁇ -nucleosides linked by charged or neutral 3'-5' phosphorous linkages, ⁇ -nucleosides linked by charged or neutral 2'-5' phosphorous linkages, ⁇ -nucleosides linked by non-phosphorous linkages, 4'-thionucleosides linked by charged or neutral 3'-5' phosphorous linkages, 4'-thionucleosides linked by charged or neutral 2'-5' phosphorous linkages, 4'- thionucleosides linked by non-phosphorous linkages, carbocyclic-nucleosides linked by charged or neutral 3'-5' phosphorous linkages, carbocyclic-nucleosides linked by charged or neutral 3'-5'
- Certain embodiments comprise at least two segments, wherein at least one segment comprises non-naturally occurring internucleoside linkages.
- Other embodiments comprise an oligomer mimetic.
- the nucleotides ofthe first type comprise nucleotides having a 2' halogen sugar substituent.
- the halogen is F.
- the nucleotides ofthe first type comprise nucleotides having a 2' O-alkyl sugar substituent.
- the -O-alkyl is -O-CH 3 .
- the nucleotides of said first type comprise nucleotides having a 2' sugar substituent and where said 2' sugar substituent is ofthe formula -X-Y, wherein:
- X is O, S, NR**, or CR* wherein each R** is independently H or C 1-6 alkyl; and Y is substituted or unsubstituted C 1-2 o alkyl, substituted or unsubstituted C 2-2 o alkenyl, or substituted or unsubstituted C 6- 2o aryl.
- the invention is directed to oligonucleomer/protein compositions comprising an oligomer complementary to and capable of hybridizing to a selected target nucleic acid, and at least one protein comprising at least a portion of a RNA-induced silencing complex (RISC).
- RISC RNA-induced silencing complex
- the invention relates to oligomers having at least a first region and a second region where the first region is complementary to and capable of hybridizing with the second region, and at least a portion ofthe oligomer is complementary to and is capable of hybridizing to a selected target nucleic acid. At least one ofthe regions is a chimeric oligomeric composition.
- the first and second oligomers preferably each have 10 to 40 nucleosidic bases.
- each ofthe first and second oligomers have 18 to 30 nucleosidic bases. In yet other embodiments, the first and second oligomers have 21 to 24 nucleosidic bases.
- compositions comprising any ofthe above compositions or oligomeric compounds and a pharmaceutically acceptable carrier.
- Methods for modulating the expression of a target nucleic acid in a cell comprise contacting the cell with any ofthe above compositions or oligomeric compounds.
- the invention also concerns methods of treating or preventing a disease or condition associated with a target nucleic acid are also provided, wherein the methods comprise administering to a patient having or predisposed to the disease or condition a therapeutically effective amount of any ofthe above compositions or oligomeric compounds.
- the present invention provides oligomeric compounds useful in the modulation of gene expression.
- oligomeric compounds ofthe invention are believed to modulate gene expression by hybridizing to a nucleic acid target resulting in loss of normal function ofthe target nucleic acid.
- target nucleic acid or “nucleic acid target” is used for convenience to encompass any nucleic acid capable of being targeted including without limitation DNA, RNA (including pre-mRNA and mRNA or portions thereof) transcribed from such DNA, and also cDNA derived from such RNA.
- modulation of gene expression is effected via modulation of a RNA associated with the particular gene RNA.
- the invention provides for modulation of a target nucleic acid that is a messenger
- RNA The messenger RNA is degraded by the RNA interference mechanism as well as other mechanisms in which double stranded RNA/RNA structures are recognized and degraded, cleaved or otherwise rendered inoperable.
- RNA to be interfered with can include replication and transcription.
- Replication and transcription for example, can be from an endogenous cellular template, a vector, a plasmid construct or otherwise.
- the functions of RNA to be interfered with can include functions such as translocation ofthe RNA to a site of protein translation, translocation ofthe RNA to sites within the cell which are distant from the site of RNA synthesis, translation of protein from the RNA, splicing ofthe RNA to yield one or more RNA species, and catalytic activity or complex formation involving the RNA which may be engaged in or facilitated by the RNA.
- modulation and modulation of expression mean either an increase (stimulation) or a decrease (inhibition) in the amount or levels of a nucleic acid molecule encoding the gene, e.g., DNA or RNA. Inhibition is often the preferred form of modulation of expression and mRNA is often a preferred target nucleic acid.
- the present invention concerns certain modified oligomeric compounds that are not uniform in chemical composition. Discussed herein are numerous modifications that may be made to oligomeric compounds. In certain embodiments, more than one of these modifications may be incorporated in a single oligomeric compound or even at a single monomeric subunit such as a nucleoside within a oligomeric compound.
- Modified oligomeric compounds ofthe present invention include chimeric oligomeric compounds.
- "Chimeric” oligomeric compounds, or “chimeras,” in the context of this invention are oligomeric compounds that contain two or more chemically distinct regions, each made up of at least one monomer unit, e.g., a nucleotide in the case of a nucleic acid based oligomer.
- Chimeric oligomeric compounds typically contain at least one region modified so as to confer increased resistance to nuclease degradation, increased cellular uptake, and/or increased binding affinity for the target nucleic acid.
- An additional region ofthe oligomeric compound may serve as a substrate for enzymes capable of cleaving RNA:DNA or RNA:RNA hybrids.
- RNase H is a cellular endonuclease which cleaves the RNA strand of an RNA:DNA duplex. Activation of RNase H, therefore, results in cleavage ofthe RNA target, thereby greatly enhancing the efficiency of inliibition of gene expression.
- Chimeric oligomeric compounds ofthe invention may be formed as composite structures of two or more oligonucleotides, oligonucleotide analogs, oligonucleosides and/or oligonucleotide mimetics as described herein.
- Such oligomeric compounds have also been referred to in the art as hybrids, hemimers, gapmers or inverted gapmers.
- Representative United States patents that teach the preparation of such structures include, but are not limited to, U.S.: 5,013,830; 5,149,797; 5,220,007; 5,256,775; 5,366,878; 5,403,711; 5,491,133; 5,565,350; 5,623,065; 5,652,355; 5,652,356; and 5,700,922, certain of which are commonly owned with the instant application, and each of which is herein incorporated by reference in its entirety.
- a blockmer has at least one block or segment of at least two consecutively located nucleotide or nucleoside subunits of a first type positioned adjacent to at least one nucleotide or nucleoside of a second type.
- nucleotides or nucleosides ofthe first type are represented by "X” and those of the second type are represented by “Y” and if"
- nucleotides or nucleosides other that the X or Y type nucleotides or the absence of any nucleotides then the following structures ...XXY..; ...XXYXX... ; ...XXYXXY...; ...XXYXXYXX... on so on for higher homologs are possible where each X containing segment includes two members and each Y containing segment includes only one member.
- each X containing segment includes two members and each Y subunit also includes two members
- other representational blockmers include ...XXYY...; ...XXYYXX...; ...XXYYXXYY...; ...XXYYXXYYXX... and so on for high homologs.
- These can be extended to other representative structures having more X and/or Y members in the blocks or segments, as for instances the structures YXXXYYYXXXY; YYXXXYYXXXXYY; and YYYYXXXXYYYYXXX.
- a block or segment of the first type of nucleotides or nucleoside resides at the 5 ' or the 3' terminus and all ofthe remaining nucleotides or nucleosides ofthe oligomer are ofthe second type, then that blockmer is also a hemimer.
- the representations XXXXXYYYYY and YYYYYXXX represent, respectively, 5' and 3' hemimers.
- gapmers a block or segment of one type of nucleotides or nucleosides is interspaced between first and second blocks ofthe second type.
- XXXXYYYYXXX represents a gapmer
- YYYYXXXXYYYY represents an invertered gapmer.
- the chimric oligomeric compounds may contain any modification known to those skilled in the art. Examples of suitable modifications include modification ofthe sugar moiety, replacement ofthe sugar with a sugar surrogate, and modification to the backbone.
- the chimeric compound comprises at least two segments that are DNA segments, RNA segments, oligomer mimetic segments, or mixtures thereof.
- the oligomer mimetic is a peptide nucleic acid (PNA).
- a chimeric oligomeric compound according to the invention contains DNA and peptide nucleic acid (PNA) segments.
- Oligonucleoside segments according to the invention are formed from units that have pentofuranosyl sugars and naturally-occurring or non-naturally occurring nucleobases.
- DNA segments are formed from nucleoside units that have 2'-deoxy-erythro-pentofuranosyl sugar moieties and such a nucleobase
- RNA segments are formed from nucleoside units that have 2'-hydroxy-erythro-pentofuranosyl sugar moieties and such a nucleobase.
- Modified oligonucleoside segments are formed from nucleoside units that have some other type of pentofuranosyl sugar. The nucleosides are linked together and/or to other moieties by linkages disclosed herein.
- Such linkages include phosphodiester linkages, phosphorothioate linkages and/or phosphorodithioate linkages.
- each ofthe nucleosides ofthe 2'-deoxyoligonucleotide portion are linked together by phosphorothioate linkages.
- -they are linked together -by-phosphodiester linkages and in even further preferred embodiments, a mixture of phosphodiester and phosphorothioate linkages.
- the peptide nucleic acid segments ofthe compounds typically increase the binding affinity ofthe compound to a complementary strand of nucleic acid. They also typically provide for nuclease stability ofthe compound against degradation by cellular nucleases. Selecting the 2'-deoxyoligonucleotide portion ofthe compound to include one or more or all phosphorothioate or phosphorodithioate linkages provides further nuclease stability to the compounds ofthe invention.
- the PNA portions ofthe compounds ofthe invention are made up of units comprising a N-(2-aminoethyl)glycine or analogues thereof having a nucleobase attached thereto via a linker such as a carboxymethyl moiety or analogues thereof to the nitrogen atom ofthe glycine portion ofthe unit.
- the units are coupled together via amide bonds formed between the carboxyl group ofthe glycine moiety and the amine group ofthe aminoethyl moiety.
- the nucleobase can be one ofthe four common nucleobases of nucleic acids or they can include other natural or synthetic nucleobases.
- PNA compositions are discussed in more detail below.
- the chimera is a PNA-RNA-PNA composition where each
- PNA and RNA segment comprises at least one PNA or RNA monomer (also referred to herein as a "subunit").
- the chimera is RNA-PNA-RNA.
- Some segments may contain at least two subunits.
- Other segments contain at least three subunits.
- Yet other segments may contain five or more subunits.
- the PNA-DNA-PNA structure is formed by connecting together the respective N-(2-aminoethyl)glycine PNA units and the respective 2'-ribose sugar phosphate RNA units.
- the nucleobases ofthe PNA portion ofthe compounds ofthe invention are carried on a backbone composed of N-(2-aminoethyl)glycine PNA units and the nucleobases ofthe RNA portion ofthe compounds ofthe invention are carried on a backbone composed of 2'-ribose sugar phosphate units.
- nucleobases ofthe PNA portions and the nucleobases ofthe RNA portion ofthe compounds ofthe invention are connected by their respective backbone units in a sequence that is hybridizable to a complementary nucleic acid, as for instance, a targeted RNA stand.
- PNA and the RNA portions are joined together with amide linkages.
- Such preferred compound ofthe invention areof the structure: PNA-(amide link)-RNA-(amide link)-PNA.
- the amide linkage may be oriented as -C(O)NH- or -NHC(O)-.
- Other linkages that can be used to join the PNA and the RNA portions include those internucleoside linkages disclosed below.
- the linkages are amine ester linkages.
- the chimera is a PNA-RNA or RNA-PNA composition wherein the PNA and DNA segments are as described above.
- RNA and PNA compositions may be made by analogous methods.
- the chimeric oligomeric composition may be a modified
- RNA RNA.
- these chimeric oligomers may be gapmers, an inverted gapmer, or a hemimers.
- the modified segment of RNA comprises a 2'-substiruted- oligoribonucleotide.
- the term "2'-substituted" means replacement ofthe 2'-OH ofthe ribose molecule with a sugar substituent other than H.
- the sugar substituent may be any one ofthe sugar substituents disclosed herein.
- the sugar substituent is -O-alkyl containing 1-6 carbon atoms, aryl or substituted aryl or d- ⁇ allyl.
- substituents examples include 2'-OMe, 2'-O-allyl, 2'-O-aryl, 2'-O-alkyl, 2'-halo, and 2'- amino.
- the sugar substituent is -O-alkyl.
- the sugar substituent is F.
- allyl, aryl, or alkyl groups may be optionally substituted with substituents that include one or more halo, hydroxy, trifluoromethyl, cyano, nitro, acyl, acyloxy, alkoxy, carboxyl, carbalkoxyl and amino groups. Modified sugar compositions are discussed in more detail in U.S. Patent Nos.
- the chimeric oligomeric compositions comprise modified internucleoside linkages and the use of ⁇ -nucleosides and ⁇ -nucleosides. Such modifications may produce segments that increase binding affinity ofthe oligonucleotide to a complementary strand of nucleic acid. See U.S. Patent No. 5,623,065, the disclosure of which is incorporated herein by reference in its entirety.
- the nucleotide units that bear such substituents can be divided into a first nucleotide unit sub-sequence and a second nucleotide unit sub- sequence, with 2'-deoxy-erythro-pentofuranosyl structures being positioned within the oligonucleotide between the first nucleotide unit sub-sequence and the second nucleotide unit sub-sequence.
- nucleotide units bearing substituents that increase binding affinity are located at one or both ofthe 3' or the 5' termini of the oligomer.
- at least five sequential nucleotide units are 2'-deoxy-erythro- pentofuranosyl sugar moieties.
- the present invention also provides compounds formed from a plurality of linked nucleosides selected from ⁇ -nucleosides, ⁇ -nucleosides including 2'-deoxy-erythro- pentofuranosyl ⁇ -nucleosides, 4'-thionucleosides, and carbocyclic-nucleosides. These nucleosides are connected by linkages in a sequence that is hybridizable to a complementary nucleic acid. The linkages are selected from charged phosphorous linkages, neutral phosphorous linkages, and non-phosphorous linkages. The sequence of linked nucleosides is divided into at least two regions.
- the first nucleoside region includes the following types of nucleosides: ⁇ - nucleosides linked by charged or neutral 3'-5' phosphorous linkages; ⁇ -nucleosides linked by charged or neutral 2'-5' phosphorous linkages; ⁇ -nucleosides linked by non-phosphorous linkages; 4'-thionucleosides linked by charged or neutral 3 '-5' phosphorous linkages; 4'- thionucleosides linked by charged or neutral 2'-5' phosphorous linkages; 4'-thionucleosides linked by non-phosphorous linkages; carbocyclic-nucleosides linked by charged or neutral 3'-5' phosphorous linkages; carbocyclic-nucleosides linked by charged or neutral 2'-5' phosphorous linkages; carbocyclic-nucleosides linked by non-phosphorous linkages; ⁇ -nucleosides linked by charged or neutral 3'-5' linkages; ⁇ -nucleo
- a second nucleoside region consists of 2'-ribo- ⁇ -nucleosides linked by charged 3'-5' phosphorous linkages.
- the 3 '-5' phosphorous linkages have a negative charge at physiological pH.
- the compounds include at least 3 of said 2'-deoxy-erythro-pentofuranosyl ⁇ -nucleosides, more preferably at least 5 of said 2'-deoxy-erythro-pentofuranosyl ⁇ -nucleotides.
- there exists a third nucleoside region whose nucleosides are selected from those selectable for the first region.
- the second region is positioned between the first and third regions.
- Certain preferred charged phosphorous linkages include phosphodiester, phosphorothioate, phosphorodithioate, phosphoroselenate and phosphorodiselenate linkages; phosphodiester and phosphorothioate linkages are particularly preferred.
- Preferred neutral phosphorous linkages include alkyl and aryl phosphonates, alkyl and aryl phosphoroamidites, alkyl and aryl phosphotriesters, hydrogen phosphonate and boranophosphate linkages.
- Preferred non-phosphorous linkages include peptide linkages, hydrazine linkages, hydroxy-amine linkages, carbamate linkages, morpholine linkages, carbonate linkages, amide linkages, oxymethyleneimine linkages, hydrazide linkages, silyl linkages, sulfide linkages, disulfide linkages, sulfone linkages, sulfoxide linkages, sulfonate linkages, sulfonamide linkages, formacetal linkages, thioformacetal linkages, oxime linkages and ethylene glycol linkages.
- the invention also provides compounds formed from a plurality of linked units, each of which is selected from nucleosides and nucleobases.
- the nucleosides include ⁇ - nucleosides, ⁇ -nucleosides including 2'-deoxy-erythro-pentofuranosyl ⁇ -nucleosides, 4'- thionucleosides and carbocyclic-nucleosides.
- the nucleobases include purin-9-yl and pyrimidin- 1-yl heterocyclic bases.
- the nucleosides and nucleobases ofthe units are linked together by linkages in a sequence wherein the sequence is hybridizable to a complementary nucleic acid and the sequence of linked units is divided into at least two regions.
- the linkages are selected from charged 3'-5' phosphorous, neutral 3'-5' phosphorous, charged 2'-5' phosphorous, neutral 2'-5' phosphorous or non-phosphorous linkages.
- a first ofthe regions includes nucleobases linked by non-phosphorous linkages and nucleobases that are attached to phosphate linkages via non-sugar tethering groups, and nucleosides selected from ⁇ -nucleosides linked by charged or neutral 3'-5' phosphorous linkages, ⁇ -nucleosides linked by charged or neutral 2'-5' phosphorous linkages, ⁇ - nucleosides linked by non-phosphorous linkages, 4'-thionucleosides linked by charged or neutral 3'-5' phosphorous linkages, 4'-thionucleosides linked by charged or neutral 2'-5' phosphorous linkages, 4'-thionucleosides linked by non-phosphorous linkages, carbocyclic-nucleosides linked by charged or
- a second ofthe regions includes only 2'-ribo- ⁇ -nucleosides linked by charged 3'-5' phosphorous linkages.
- the 3'-5' phosphorous linkages have a negative charge at physiological pH.
- the first region includes at least two nucleobases joined by a non-phosphate linkage such as a peptide linkage.
- the compounds include a third region that is selected from the same groups as described above for the first region. In preferred embodiments, the second region is located between the first and third regions.
- the invention also provides compounds that have a plurality of linked units, each of which is selected from nucleosides and nucleobases.
- the nucleosides are selected from ⁇ - nucleosides, ⁇ -nucleosides, 4'-thionucleosides and carbocyclic-nucleosides and the nucleobases are selected from purin-9-yl and pyrimidin-1-yl heterocyclic bases.
- the nucleosides and nucleobases of said units are linked together by linkages in a sequence wherein the sequence is hybridizable to a complementary nucleic acid.
- the sequence of linked units is divided into at least two regions.
- the linkages are selected from charged phosphorous, neutral phosphorous or non-phosphorous linkages.
- a first ofthe regions include ⁇ -nucleosides linked by charged or neutral 3 -5' phosphorous linkages, ⁇ -nucleosides linked by charged or neutral 2'-5' phosphorous linkages, ⁇ -nucleosides linked by non-phosphorous linkages, 4'-thionucleosides linked by charged or neutral 3'-5' phosphorous linkages, 4'-thionucleosides linked by charged or neutral 2'- 5' phosphorous linkages, 4'-thionucleosides linked by non-phosphorous linkages, carbocyclic- nucleosides linked by charged or neutral phosphorous linkages, carbocyclic-nucleosides linked by non-phosphorous linkages, ⁇ -nucleosides linked by charged or neutral 3 '-5' linkages, ⁇ - nucleosides linked by charged or neutral 2'-5' linkages, and ⁇ -
- two regions ofthe instant oligomers may be linked by a hinge region.
- Hinge regions consist of nucleosidic or non-nucleosidic polymers which preferably facilitate the specific binding ofthe monomers ofthe oligomer regions with their targets.
- the oligonucleotide regions may be connected to hinge regions and/or binding moieties in either 5'->3' or 3'- 5' orientations.
- the hinge region is designed to permit specific hybridization ofthe oligomer regions to their respective target sequences hinge regions applicable to the instant invention include those disclosed in U.S. Patent No. 6,048,974, the disclosure of which is incorporated herein by reference.
- the invention concerns a composition comprising a gapmer composition where the wings are a modified oligomeric composition that is linked by a region of unpaired monomers.
- the wing segments are complementary to each other.
- Such compositions may be made by methods disclosed in U.S. Patent No. 5,565,350, which is incorporated herein by reference.
- At least one segment is modified to comprise at least one non-naturally occurring internucleoside linkages.
- the linkage is a phosphoramidate linkage.
- Suitable chimeric oligomeric compositions include gapmers, inverted gapmers, and hemimers.
- the modification is at one or both ofthe 5' and 3' terminus.
- Phosphoramidate compositions may be made by methods disclosed in U.S. Patent No. 5,256,775, the disclosure of which is incorporated herein in its entirety.
- the chimeric oligomeric composition is modified at the
- 3 '-terminal end to comprise linkages that are resistant to degradation within cells and body fluids.
- modifications include those where the modified 3'-terminal internucleotide phosphodiester linkage is a phosphotriester, phosphonate, phosphoramidate, phosphorothioate, or phosphoroselenate linkage.
- Such linkages are discussed in U.S. Patent Nos. 5,491,133 and 5,220,007, which are incorporated herein by reference in their entirety.
- One preferred composition comprises chimeric phosphoramidate oligonucleotides having both N3 '-phosphoramidate linkages and phosphodiester linkages.
- at least one ofthe phosphodiester linkages is at the 3' end ofthe oligonucleotide.
- These mixed phosphodiester/phosphoramidate linkage compositions are described in U.S. Patent No. 6,043,070, the disclosure of which is incorporated herein in its entirety by reference.
- the chimeric oligomeric composition may comprise a mixed phosphate backbone oligonucleotide consisting essentially of an internal segment of modified nucleotides which activates RNase H and two modified nucleotide sequences which do not activate RNAse H, in which the two modified nucleotide sequences flank the internal segments, one on each side ofthe internal segment, wherein the internucleoside bridging phosphate residues ofthe internal segment are modified phosphates which are phosphorothioates and the internucleoside bridging phosphate residues ofthe two flanking modified nucleotide sequences are modified phosphate selected from the group consisting of: methyl phosphonates, phosphoromorpholidates, phosphoropiperazidates, and phosphoramidates.
- the present compounds incorporate one or more polynucleoside segments having chirally-pure or chirally-enriched modified (non- phosphodiester) internucleoside linkages.
- the chirally-selected linkage segments are preferably selected to include linkages having R chirality at the asymmetric phosphorus atom of one or more ofthe linkage structures ("R p chirality").
- R p chirality linkages having R chirality at the asymmetric phosphorus atom of one or more ofthe linkage structures
- at least about 40% ofthe linkages in a given chirally-selected segment will be R p -chiral.
- segments selectively including one or more S p -chiral linkages are situated at the terminal (3' and 5') portions ofthe compound, surrounding (flanking) a central RNaseH-activating region.
- the flanking chirally-selected segments preferably are substantially non-RNaseH-activating.
- the RNaseH-activating region if linked with asymmetric (chiral) linkage groups, may alternatively or additionally be chirally selected.
- the RNaseH-activating region is situated at or near one terminus ofthe compound, and all or a portion ofthe remainder ofthe compound is chirally selected and preferably is non- RNaseH-activating.
- the chirally-selected R p -enriched segments ofthe invention serve to increase the binding affinity ofthe compound as compared to racemic compounds.
- the chirally-selected modified linkage structures are more resistant to degradation by endo- and/or exonucleases than are non-modified phosphodiester linkages, the chirally-selected segments will tend to protect the compound from degradation in the in vivo environment.
- Such linkages are discussed in U.S. Patent No. 6,262,036, the disclosure of which is incorporated herein by reference in its entirety.
- the internucleoside bridging phosphate residues ofthe two flanking modified nucleotide sequences are methyl phosphonates. In other embodiments, the internucleoside bridging phosphate residues ofthe two flanking modified nucleotide sequences are phosphoromorpholidates. In yet other embodiments, the internucleoside bridging phosphate residues ofthe two flanking modified nucleotide sequences are phosphoropiperazidates. Still other embodiments are those where the internucleoside bridging phosphate residues ofthe two flanking modified nucleotide sequences are phosphoramidates. These compositions may be made by methods disclosed in U.S. Patent Nos. 5,149,797 and 5,366,878, the disclosures of which are incorporated herein in their entirety. [0083] Some compositions ofthe invention have an abasic moiety at the 3' end or at the
- chimeric compounds ofthe invention comprise terminal 3' ⁇ 3' and 5' ⁇ 5' linkages. These compounds are stable to nucleases. These linkages are discussed in U.S. Patent No. 5,750,669, the disclosure of which is inco ⁇ orated herein by reference.
- the 3' and/or 5' end ofthe oligomer may be capped with one or more guanines that are not complementary to the target sequence.
- the number of non-complementary guanines is two to six, more preferably from three to five, and still more preferably four.
- Use of guanine caps is discussed in U.S. Patent No. 6,121,434, the disclosure of which is inco ⁇ orated herein by reference in its entirety.
- Certain embodiments comprise a composition with a terminal modification that is ofthe formula:
- the modification is a 5' terminal modification.
- This terminal group can be made by methods taught in U.S. Patent No. 5,837,852, the disclosure of which is inco ⁇ orated herein by reference in its entirety.
- hybridization means the pairing of complementary strands of oligomeric compounds.
- the preferred mechanism of pairing involves hydrogen bonding, which maybe Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleoside or nucleotide bases (nucleobases) ofthe strands of oligomeric compounds.
- nucleobases complementary nucleoside or nucleotide bases
- adenine and thymine are complementary nucleobases that pair through the formation of hydrogen bonds.
- Hybridization can occur under varying circumstances.
- An oligomeric compound ofthe invention is believed to specifically hybridize to the target nucleic acid and interfere with its normal function to cause a loss of activity. There is preferably a sufficient degree of complementarity to avoid non-specific binding ofthe oligomeric compound to non-target nucleic acid sequences under conditions in which specific binding is desired, i.e., under physiological conditions in the case of in vivo assays or therapeutic treatment, and under conditions in which assays are performed in the case of in vitro assays. [0089] In the context ofthe present invention the phrase "stringent hybridization conditions” or “stringent conditions” refers to conditions under which an oligomeric compound ofthe invention will hybridize to its target sequence, but to a minimal number of other sequences.
- Stringent conditions are sequence-dependent and will vary with different circumstances and in the context of this invention; "stringent conditions" under which oligomeric compounds hybridize to a target sequence are determined by the nature and composition ofthe oligomeric compounds and the assays in which they are being investigated.
- "Complementary,” as used herein, refers to the capacity for precise pairing of two nucleobases regardless of where the two are located. For example, if a nucleobase at a certain position of an oligomeric compound is capable of hydrogen bonding with a nucleobase at a certain position of a target nucleic acid, then the position of hydrogen bonding between the oligomer and the target nucleic acid is considered to be a complementary position.
- oligomeric compound and the target nucleic acid are complementary to each other when a sufficient number of complementary positions in each molecule are occupied by nucleobases that can hydrogen bond with each other.
- “specifically hybridizable” and “complementary” are terms which are used to indicate a sufficient degree of precise pairing or complementarity over a sufficient number of nucleobases such that stable and specific binding occurs between the oligomer and a target nucleic acid.
- the sequence ofthe oligomeric compound need not be 100% complementary to that of its target nucleic acid to be specifically hybridizable. Moreover, an oligomeric compound may hybridize over one or more segments such that intervening or adjacent segments are not involved in the hybridization event (e.g., a loop structure or hai ⁇ in structure). It is preferred that the oligomeric compounds ofthe present invention comprise at least 70% sequence complementarity to a target region within the target nucleic acid, more preferably that they comprise 90% sequence complementarity and even more preferably comprise 95% sequence complementarity to the target region within the target nucleic acid sequence to which they are targeted.
- an oligomeric compound in which 18 of 20 nucleobases ofthe oligomeric compound are complementary to a target region, and would therefore specifically hybridize would represent 90 percent complementarity.
- the remaining noncomplementary nucleobases may be clustered or interspersed with complementary nucleobases and need not be contiguous to each other or to complementary nucleobases.
- an oligomeric compound which is 18 nucleobases in length having 4 (four) noncomplementary nucleobases which are flanked by two regions of complete complementarity with the target nucleic acid would have 77.8% overall complementarity with the target nucleic acid and would thus fall within the scope ofthe present invention.
- Percent complementarity of an oligomeric compound with a region of a target nucleic acid can be determined routinely using BLAST programs (basic local alignment search tools) and PowerBLAST programs known in the art (Altschul et al., J. Mol. Biol., 1990, 215, 403-410; Zhang and Madden, Genome Res., 1997, 7, 649-656).
- Targeting an oligomeric compound to a particular nucleic acid molecule, in the context of this invention, can be a multistep process.
- the process usually begins with the identification of a target nucleic acid whose function is to be modulated.
- This target nucleic acid may be, for example, a mRNA transcribed from a cellular gene whose expression is associated with a particular disorder or disease state, or a nucleic acid molecule from an infectious agent.
- the targeting process usually also includes determination of at least one target region, segment, or site within the target nucleic acid for the interaction to occur such that the desired effect, e.g., modulation of expression, will result.
- region is defined as a portion ofthe target nucleic acid having at least one identifiable structure, function, or characteristic.
- segments are defined as smaller or sub-portions of regions within a target nucleic acid.
- Sites are defined as positions within a target nucleic acid. The terms region, segment, and site can also be used to describe an oligomeric compound ofthe invention such as for example a gapped oligomeric compound having 3 separate segments.
- the translation initiation codon is also referred to as the "AUG codon,” the “start codon” or the “AUG start codon”.
- a minority of genes have a translation initiation codon having the RNA sequence 5'-GUG, 5'-UUG or 5'-CUG, and 5'-AUA, 5'-ACG and 5'-CUG have been shown to function in vivo.
- the terms "translation initiation codon” and “start codon” can encompass many codon sequences, even though the initiator amino acid in each instance is typically methionine (in eukaryotes) or formylmethionine (in prokaryotes).
- start codon and “translation initiation codon” refer to the codon or codons that are used in vivo to initiate translation of an mRNA transcribed from a gene encoding a nucleic acid target, regardless ofthe sequence(s) of such codons.
- a translation termination codon (or "stop codon") of a gene may have one of three sequences, i.e., 5'-UAA, 5'-UAG and 5'-UGA (the corresponding DNA sequences are 5'-TAA, 5'-TAG and 5'-TGA, respectively).
- start codon region and “translation initiation codon region” refer to a portion of such an mRNA or gene that encompasses from about 25 to about 50 contiguous nucleotides in either direction (i.e., 5' or 3') from a translation initiation codon.
- stop codon region and “translation termination codon region” refer to a portion of such an mRNA or gene that encompasses from about 25 to about 50 contiguous nucleotides in either direction (i.e., 5' or 3') from a translation termination codon. Consequently, the "start codon region” (or “translation initiation codon region”) and the “stop codon region” (or “translation termination codon region”) are all regions which may be targeted effectively with the antisense oligomeric compounds ofthe present invention.
- a preferred region is the intragenic region encompassing the translation initiation or termination codon ofthe open reading frame (ORF) of a gene.
- target regions include the 5' untranslated region (5'UTR), known in the art to refer to the portion of an mRNA in the 5' direction from the translation initiation codon, and thus including nucleotides between the 5' cap site and the translation initiation codon of an mRNA (or corresponding nucleotides on the gene), and the 3' untranslated region (3 'UTR), known in the art to refer to the portion of an mRNA in the 3' direction from the translation termination codon, and thus including nucleotides between the translation termination codon and 3' end of an mRNA (or corresponding nucleotides on the gene).
- 5'UTR 5' untranslated region
- 3 'UTR known in the art to refer to the portion of an mRNA in the 3' direction from the translation termination codon, and thus including nucleotides between the translation termination codon and 3' end of an mRNA (or corresponding nucleotides on the gene).
- the 5' cap site of an mRNA comprises an N7-methylated guanosine residue joined to the 5'-most residue ofthe mRNA via a 5 -5' triphosphate linkage.
- the 5' cap region of an mRNA is considered to include the 5' cap structure itself as well as the first 50 nucleotides adjacent to the cap site. It is also preferred to target the 5' cap region.
- introns regions which are excised from a transcript before it is translated.
- exons regions which are excised from a transcript before it is translated.
- targeting splice sites i.e., intron-exon junctions or exon-intron junctions, may also be particularly useful in situations where aberrant splicing is implicated in disease, or where an ove ⁇ roduction of a particular splice product is implicated in disease. Aberrant fusion junctions due to rearrangements or deletions are also preferred target sites.
- fusion transcripts produced via the process of splicing of two (or more) mRNAs from different gene sources are known as "fusion transcripts". It is also known that introns can be effectively targeted using oligomeric compounds targeted to, for example, pre- mRNA.
- RNA transcripts can be produced from the same genomic region of DNA. These alternative transcripts are generally known as "variants”. More specifically, "pre-mRNA variants" are transcripts produced from the same genomic DNA that differ from other transcripts produced from the same genomic DNA in either their start or stop position and contain both intronic and exonic sequences. [00100] Upon excision of one or more exon or intron regions, or portions thereof during splicing, pre-mRNA variants produce smaller "mRNA variants". Consequently, mRNA variants are processed pre-mRNA variants and each unique pre-mRNA variant must always produce a unique mRNA variant as a result of splicing. These mRNA variants are also known as "alternative splice variants". If no splicing ofthe pre-mRNA variant occurs then the pre-mRNA variant is identical to the mRNA variant.
- variants can be produced through the use of alternative signals to start or stop transcription and that pre-rnRNAs and mRNAs can possess more that one start codon or stop codon.
- Variants that originate from a pre-mRNA or mRNA that use alternative start codons are known as "alternative start variants" of that pre-mRNA or mRNA.
- Those transcripts that use an alternative stop codon are known as “alternative stop variants” of that pre-mRNA or mRNA.
- One specific type of alternative stop variant is the "polyA variant” in which the multiple transcripts produced result from the alternative selection of one ofthe "polyA stop signals" by the transcription machinery, thereby producing transcripts that terminate at unique polyA sites.
- the types of variants described herein are also preferred target nucleic acids.
- preferred target segments are locations on the target nucleic acid to which preferred compounds and compositions ofthe invention hybridize.
- preferred target segment is defined as at least an 8- nucleobase portion of a target region to which an active antisense oligomeric compound is targeted. While not wishing to be bound by theory, it is presently believed that these target segments represent portions ofthe target nucleic acid that are accessible for hybridization.
- oligomeric compounds are chosen which are sufficiently complementary to the target, i.e., hybridize sufficiently well and with sufficient specificity, to give the desired effect.
- a series of nucleic acid duplexes comprising the antisense strand oligomeric compounds ofthe present invention and their respective complement sense strand compounds can be designed for a specific target or targets.
- the ends ofthe strands may be modified by the addition of one or more natural or modified nucleobases to form an overhang.
- the sense strand ofthe duplex is designed and synthesized as the complement ofthe antisense strand and may also contain modifications or additions to either terminus.
- both strands ofthe duplex would be complementary over the central nucleobases, each having overhangs at one or both termini.
- the combination of an antisense strand and a sense strand each of can be of a specified length, for example from 18 to 29 nucleotides long, is identified as a complementary pair of siRNA oligomers.
- This complementary pair of siRNA oligomers can include additional nucleotides on either of their 5' or 3' ends. Further they can include other molecules or molecular structures on their 3' or 5' ends such as a phosphate group on the 5' end.
- a preferred group of compounds ofthe invention include a phosphate group on the 5' end ofthe antisense strand compound. Other preferred compounds also include a phosphate group on the 5' end ofthe sense strand compound. Even further preferred compounds would include additional nucleotides such as a two base overhang on the 3' end.
- a preferred siRNA complementary pair of oligomers comprise an antisense strand oligomeric compound having the sequence CGAGAGGCGGACGGGACCG (SEQ ID NO:l) and having a two-nucleobase overhang of deoxythymidine(dT) and its complement sense strand.
- These oligomers would have the following structure:
- a single oligomer having both the antisense portion as a first region in the oligomer and the sense portion as a second region in the oligomer is selected.
- the first and second regions are linked together by either a nucleotide linker (a string of one or more nucleotides that are linked together in a sequence) or by a non- nucleotide linker region or by a combination of both a nucleotide and non-nucleotide structure.
- the oligomer when folded back on itself, would be complementary at least between the first region, the antisense portion, and the second region, the sense portion.
- the oligomer would have a palindrome within it structure wherein the first region, the antisense portion in the 5' to 3' direction, is complementary to the second region, the sense portion in the 3' to 5' direction.
- the invention includes oligomer/protein compositions.
- compositions have both an oligomer component and a protein component.
- the oligomer component comprises at least one oligomer, either the antisense or the sense oligomer but preferably the antisense oligomer (the oligomer that is antisense to the target nucleic acid).
- the oligomer component can also comprise both the antisense and the sense strand oligomers.
- the protein component ofthe composition comprises at least one protein that forms a portion ofthe RNA-induced silencing complex, i.e., the RISC complex.
- RISC is a ribonucleoprotein complex that contains an oligomer component and proteins ofthe Argonaute family of proteins, among others.
- the Argonaute proteins make up a highly conserved family whose members have been implicated in RNA interference and the regulation of related phenomena. Members of this family have been shown to possess the canonical PAZ and Piwi domains, thought to be a region of protein-protein interaction. Other proteins containing these domains have been shown to effect target cleavage, including the RNAse, Dicer.
- the Argonaute family of proteins includes, but depending on species, are not necessary limited to, elF2Cl and elF2C2. elF2C2 is also known as human GERp95.
- the antisense oligomer strand is bound to the protein component ofthe RISC complex. Additionally, the complex might also include the sense strand oligomer. Carmell et al, Genes and Development 2002, 16, 2733-2742.
- RISC complex may interact with one or more ofthe translation machinery components.
- Translation machinery components include but are not limited to proteins that effect or aid in the translation of an RNA into protein including the ribosomes or polyribosome complex. Therefore, in a further embodiment ofthe invention, the oligomer component ofthe invention is associated with a RISC protein component and further associates with the translation machinery of a cell. Such interaction with the translation machinery ofthe cell would include interaction with structural and enzymatic proteins ofthe translation machinery including but not limited to the polyribosome and ribosomal subunits.
- the oligomer ofthe invention is associated with cellular factors such as transporters or chaperones.
- cellular factors can be protein, lipid or carbohydrate based and can have structural or enzymatic functions that may or may not require the complexation of one or more metal ions.
- the oligomer of the invention itself may have one or more moieties which are bound to the oligomer which facilitate the active or passive transport, localization or compartmentalization ofthe oligomer.
- Cellular localization includes, but is not limited to, localization to within the nucleus, the nucleolus or the cytoplasm.
- Compartmentalization includes, but is not limited to, any directed movement ofthe oligomers ofthe invention to a cellular compartment including the nucleus, nucleolus, mitochondrion, or imbedding into a cellular membrane surrounding a compartment or the cell itself.
- the oligomer ofthe invention is associated with cellular factors that affect gene expression, more specifically those involved in RNA modifications. These modifications include, but are not limited to posttrascriptional modifications such as methylation.
- the oligomer ofthe invention itself may have one or more moieties which are bound to the oligomer which facilitate the posttranscriptional modification.
- the oligomeric compounds of the invention may be used in the form of single- stranded, double-stranded, circular or hai ⁇ in oligomeric compounds and may contain structural elements such as internal or terminal bulges or loops. Once introduced to a system, the oligomeric compounds ofthe invention may interact with or elicit the action of one or more enzymes or may interact with one or more structural proteins to effect modification ofthe target nucleic acid.
- oligomeric compound ofthe invention include a single- stranded antisense oligomer that binds in a RISC complex, a double stranded antisense/sense pair of oligomer or a single strand oligomer that includes both an antisense portion and a sense portion. Each of these compounds or compositions is used to induce potent and specific modulation of gene function.
- dsRNA double-stranded RNA
- the compounds and compositions ofthe invention are used to modulate the expression of a target nucleic acid.
- “Modulators” are those oligomeric compounds that decrease or increase the expression of a nucleic acid molecule encoding a target and which comprise at least an 8-nucleobase portion that is complementary to a preferred target segment.
- the screening method comprises the steps of contacting a preferred target segment of a nucleic acid molecule encoding a target with one or more candidate modulators, and selecting for one or more candidate modulators which decrease or increase the expression of a nucleic acid molecule encoding a target. Once it is shown that the candidate modulator or modulators are capable of modulating (e.g.
- the modulator may then be employed in further investigative studies ofthe function of a target, or for use as a research, diagnostic, or therapeutic agent in accordance with the present invention.
- oligomeric compound refers to a polymeric structure capable of hybridizing a region of a nucleic acid molecule. This term includes oligonucleotides, oligonucleosides, oligonucleotide analogs, oligonucleotide mimetics and combinations of these. Oligomeric compounds are routinely prepared linearly but can be joined or otherwise prepared to be circular, and may also include branching. Oligomeric compounds can hybridized to form double stranded compounds that can be blunt ended or may include overhangs. In general an oligomeric compound comprises a backbone of linked monomeric subunits where each linked monomeric subunit is directly or indirectly attached to a heterocyclic base moiety.
- linkages joining the monomeric subunits, the sugar moieties or surrogates and the heterocyclic base moieties can be independently modified giving rise to a plurality of motifs for the resulting oligomeric compounds including hemimers, gapmers and chimeras.
- nucleoside is a base-sugar combination.
- the base portion ofthe nucleoside is normally a heterocyclic base moiety.
- the two most common classes of such heterocyclic bases are purines and pyrimidines.
- Nucleotides are nucleosides that further include a phosphate group covalently linked to the sugar portion ofthe nucleoside.
- the phosphate group can be linked to either the 2', 3' or 5' hydroxyl moiety ofthe sugar.
- the phosphate groups covalently link adjacent nucleosides to one another to form a linear polymeric compound.
- oligonucleotide refers to an oligomer or polymer of ribonucleic acid (RNA) or deoxyribonucleic acid (DNA).
- oligonucleotides composed of naturally-occurring nucleobases, sugars and covalent internucleoside linkages.
- oligonucleotide analog refers to oligonucleotides that have one or more non-naturally occurring portions which function in a similar manner to oligonulceotides. Such non-naturally occurring oligonucleotides are often preferred over the naturally occurring forms because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for nucleic acid target and increased stability in the presence of nucleases.
- oligonucleoside refers to nucleosides that are joined by internucleoside linkages that do not have phosphorus atoms. Internucleoside linkages of this type include short chain alkyl, cycloalkyl, mixed heteroatom alkyl, mixed heteroatom cycloalkyl, one or more short chain heteroatomic and one or more short chain heterocyclic.
- internucleoside linkages include but are not limited to siloxane, sulfide, sulfoxide, sulfone, acetal, formacetal, thioformacetal, methylene formacetal, thioformacetal, alkeneyl, sulfamate; methyleneimino, methylenehydrazino, sulfonate, sulfonamide, amide and others having mixed N, O, S and CH 2 component parts.
- nucleosides ofthe oligomeric compounds ofthe invention can have a variety of other modifications so long as these other modifications either alone or in combination with other nucleosides enhance one or more ofthe desired properties described above.
- these nucleotides can have sugar portions that correspond to naturally-occurring sugars or modified sugars.
- Representative modified sugars include carbocyclic or acyclic sugars, sugars having substituent groups at one or more of their 2', 3' or 4' positions and sugars having substituents in place of one or more hydrogen atoms ofthe sugar. Additional nucleosides amenable to the present invention having altered base moieties and or altered sugar moieties are disclosed in United States Patent 3,687,808 and PCT application PCT/US89/02323.
- Altered base moieties or altered sugar moieties also include other modifications consistent with the spirit of this invention.
- Such oligomers are best described as being structurally distinguishable from, yet functionally interchangeable with, naturally occurring or synthetic wild type oligonucleotides. All such oligomers are comprehended by this invention so long as they function effectively to mimic the structure of a desired RNA or DNA strand.
- a class of representative base modifications include tricyclic cytosine analog, termed "G clamp” (Lin, et al, J. Am. Chem. Soc. 1998, 120, 8531). This analog makes four hydrogen bonds to a complementary guanine (G) within a helix by simultaneously recognizing the Watson-Crick and
- the oligomers ofthe invention also can include phenoxazine-substituted bases ofthe type disclosed by Flanagan, et al, Nat. Biotechnol. 1999, 17(1), 48-52.
- the oligomeric compounds in accordance with this invention preferably comprise from about 8 to about 80 nucleobases (i.e. from about 8 to about 80 linked nucleosides).
- nucleobases i.e. from about 8 to about 80 linked nucleosides.
- the oligomeric compounds ofthe invention are 12 to 50 nucleobases in length.
- One having ordinary skill in the art will appreciate that this embodies oligomeric compounds of 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27,
- the oligomeric compounds ofthe invention are N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N
- Particularly preferred oligomeric compounds are oligomers from about 15 to about 30 nucleobases, even more preferably those comprising from about 21 to about 24 nucleobases.
- Oligomerization of modified and unmodified nucleosides is performed according to literature procedures for DNA-like compounds (Protocols for Oligonucleotides and Analogs, Ed. Agrawal (1993), Humana Press) and/or RNA like compounds (Scaringe, Methods (2001), 23, 206-217. Gait et al, Applications of Chemically synthesized RNA in RNA:Protein Interactions, Ed. Smith (1998), 1-36. Gallo et al., Tetrahedron (2001), 57, 5707-5713) synthesis as appropriate, hi addition specific protocols for the synthesis of oligomeric compounds ofthe invention are illustrated in the examples below.
- RNA oligomers can be synthesized by methods disclosed herein or purchased from various RNA synthesis companies such as for example Dharmacon Research Inc., (Lafayette, CO).
- the oligomeric compounds used in accordance with this invention may be conveniently and routinely made through the well-known technique of solid phase synthesis.
- Equipment for such synthesis is sold by several vendors including, for example, Applied Biosystems (Foster City, CA). Any other means for such synthesis known in the art may additionally or alternatively be employed.
- the complementary strands preferably are annealed. The single strands are aliquoted and diluted to a concentration of 50 uM. Once diluted, 30 uL of each strand is combined with 15uL of a 5X solution of annealing buffer.
- the final concentration ofthe buffer is 100 mM potassium acetate, 30 mM HEPES-KOH pH 7.4, and 2mM magnesium acetate.
- the final volume is 75 uL.
- This solution is incubated for 1 minute at 90°C and then centrifuged for 15 seconds. The tube is allowed to sit for 1 hour at 37°C at which time the dsRNA duplexes are used in experimentation.
- the final concentration ofthe dsRNA compound is 20 uM. This solution can be stored frozen (- 20°C) and freeze-thawed up to 5 times.
- the desired synthetic duplexes are evaluated for their ability to modulate target expression.
- they are treated with synthetic duplexes comprising at least one oligomeric compound ofthe invention.
- synthetic duplexes comprising at least one oligomeric compound ofthe invention.
- For cells grown in 96- well plates, wells are washed once with 200 ⁇ L OPTI-MEM-1 reduced-serum medium (Gibco BRL) and then treated with 130 ⁇ L of OPTI-MEM-1 containing 12 ⁇ g/mL LIPOFECTIN (Gibco BRL) and the desired dsRNA compound at a final concentration of 200 nM. After 5 hours of treatment, the medium is replaced with fresh medium. Cells are harvested 16 hours after treatment, at which time RNA is isolated and target reduction measured by RT-PCR.
- nucleoside is a base-sugar combination.
- the base portion ofthe nucleoside is normally a heterocyclic base.
- the two most common classes of such heterocyclic bases are the purines and the pyrimidines.
- Nucleotides are nucleosides that further include a phosphate group covalently linked to the sugar portion ofthe nucleoside.
- the phosphate group can be linked to either the 2', 3' or 5' hydroxyl moiety ofthe sugar.
- the phosphate groups covalently link adjacent nucleosides to one another to form a linear polymeric compound.
- the respective ends of this linear polymeric compound can be further joined to form a circular compound, however, linear compounds are generally preferred.
- linear compounds may have internal nucleobase complementarity and may therefore fold in a manner as to produce a fully or partially double-stranded compound.
- the phosphate groups are commonly referred to as forming the internucleoside linkage or in conjunction with the sugar ring the backbone ofthe oligomer.
- the normal internucleoside linkage that makes up the backbone of RNA and DNA is a 3' to 5' phosphodiester linkage.
- oligomers having modified internucleoside linkages include internucleoside linkages that retain a phosphorus atom and internucleoside linkages that do not have a phosphorus atom.
- modified oligomers that do not have a phosphorus atom in their internucleoside backbone can also be considered to be oligonucleosides.
- phosphorothioate did not significantly interfere with RNAi activity. Based on this observation, it is suggested that certain preferred oligomeric compounds ofthe invention can also have one or more modified internucleoside linkages.
- a preferred phosphorus containing modified internucleoside linkage is the phosphorothioate internucleoside linkage.
- Preferred modified oligomer backbones containing a phosphorus atom therein include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3'- alkylene phosphonates, 5'-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3 '-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, selenophosphates and boranophosphates having normal 3'-5' linkages, 2'-5' linked analogs of these, and those having inverted polarity wherein one or more internucleotide linkages is a 3' to 3', 5' to 5' or 2' to 2' link
- Preferred oligomers having inverted polarity comprise a single 3' to 3' linkage at the 3'-most internucleotide linkage i.e. a single inverted nucleoside residue which may be abasic (the nucleobase is missing or has a hydroxyl group in place thereof).
- Various salts, mixed salts and free acid forms are also included.
- Representative United States patents that teach the preparation of the above phosphorus-containing linkages include, but are not limited to, U.S.: 3,687,808; 4,469,863; 4,476,301; 5,023,243; 5,177,196; 5,188,897; 5,264,423; 5,276,019; 5,278,302; 5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496; 5,455,233; 5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,306; 5,550,111; 5,563,253; 5,571,799; 5,587,361; 5,194,599; 5,565,555; 5,527,899; 5,721,218; 5,672,697 and 5,625,050, certain of which are commonly owned with this application, and each of which is herein inco ⁇ orated by reference.
- the MMI type internucleoside linkages are disclosed in the above referenced U.S. patent 5,489,677.
- Preferred amide internucleoside linkages are disclosed in the above referenced U.S. patent 5,
- Preferred modified oligomer backbones that do not include a phosphorus atom therein have backbones that are formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages.
- mo ⁇ holino linkages formed in part from the sugar portion of a nucleoside
- siloxane backbones sulfide, sulfoxide and sulfone backbones
- formacetal and thioformacetal backbones methylene formacetal and thioformacetal backbones
- riboacetal backbones alkene containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S and CH 2 component parts.
- Representative United States patents that teach the preparation ofthe above oligonucleosides include, but are not limited to, U.S.: 5,034,506; 5,166,315; 5,185,444; 5,214,134; 5,216,141; 5,235,033; 5,264,562; 5,264,564; 5,405,938; 5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225; 5,596,086; 5,602,240; 5,610,289; 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; 5,792,608; 5,646,269 and 5,677,439, certain of which are commonly owned with this application, and each of which is herein inco ⁇ orated by reference.
- oligonucleotide mimetics Another preferred group of oligomeric compounds amenable to the present invention includes oligonucleotide mimetics.
- mimetic as it is applied to oligonucleotides is intended to include oligomeric compounds wherein only the furanose ring or both the furanose ring and the internucleotide linkage are replaced with novel groups, replacement of only the furanose ring is also referred to in the art as being a sugar surrogate.
- the heterocyclic base moiety or a modified heterocyclic base moiety is maintained for hybridization with an appropriate target nucleic acid.
- PNA peptide nucleic acid
- PNA oligomeric compounds include, but are not limited to, U.S.: 5,539,082; 5,714,331; and 5,719,262, each of which is herein inco ⁇ orated by reference. Further teaching of PNA oligomeric compounds can be found in Nielsen et al, Science, 1991, 254, 1497-1500.
- PNA peptide nucleic acids
- the backbone in PNA compounds is two or more linked aminoethylglycine units which gives PNA an amide containing backbone.
- the heterocyclic base moieties are bound directly or indirectly to aza nifrogen atoms ofthe amide portion ofthe backbone.
- Representative United States patents that teach the preparation of PNA compounds include, but are not limited to, U.S.: 5,539,082; 5,714,331; and 5,719,262, each of which is herein inco ⁇ orated by reference. Further teaching of PNA compounds can be found in Nielsen et al, Science, 1991, 254, 1497-1500.
- PNA structure was first prepared.
- the basic structure is shown below:
- Bx is a heterocyclic base moiety
- T is hydrogen, an amino protecting group, -C(O)R 5 , substituted or unsubstituted d-C 10 alkyl, substituted or unsubstituted C2-C1 0 alkenyl, substituted or unsubstituted d-do alkynyl, alkylsulfonyl, arylsulfonyl, a chemical functional group, a reporter group, a conjugate group, a D or L ⁇ -amino acid linked via the ⁇ -carboxyl group or optionally through the ⁇ -carboxyl group when the amino acid is aspartic acid or glutamic acid or a peptide derived from D, L or mixed D and L amino acids linked through a carboxyl group, wherein the substituent groups are selected from hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkeny
- T 5 is -OH, -N(Z Z2, R 5 , D or L ⁇ -amino acid linked via the ⁇ -amino group or optionally through the ⁇ -amino group when the amino acid is lysine or ornithine or a peptide derived from D, L or mixed D and L amino acids linked through an amino group, a chemical functional group, a reporter group or a conjugate group;
- Z is hydrogen, d-C 6 alkyl, or an amino protecting group
- Another class of oligonucleotide mimetic that has been studied is based on linked mo ⁇ holino units (mo ⁇ holino nucleic acid) having heterocyclic bases attached to the mo ⁇ holino ring. A number of linking groups have been reported that link the mo ⁇ holino monomeric units in a mo ⁇ holino nucleic acid.
- a preferred class of linking groups have been selected to give a non-ionic oligomeric compound.
- the non-ionic mo ⁇ holino-based oligomeric compounds are less likely to have undesired interactions with cellular proteins.
- Mo ⁇ holino- based oligomeric compounds are non-ionic mimics of oligonucleotides which are less likely to form undesired interactions with cellular proteins (Dwaine A. Braasch and David R. Corey, Biochemistry, 2002, 41(14), 4503-4510).
- Mo ⁇ holino-based oligomeric compounds are disclosed in United States Patent 5,034,506, issued July 23, 1991.
- the mo ⁇ holino class of oligomeric compounds have been prepared having a variety of different linking groups joining the monomeric subunits.
- T ⁇ is hydroxyl or a protected hydroxyl
- T 5 is hydrogen or a phosphate or phosphate derivative
- L 2 is a linking group; and n is from 2 to about 50.
- a further class of oligonucleotide mimetic is referred to as cyclohexenyl nucleic acids (CeNA).
- CeNA DMT protected phosphoramidite monomers have been prepared and used for oligomeric compound synthesis following classical phosphoramidite chemistry. Fully modified CeNA oligomeric compounds and oligomers having specific positions modified with CeNA have been prepared and studied (see Wang et al, J. Am. Chem. Soc, 2000, 122, 8595- 8602).
- CeNA oligoadenylates formed complexes with RNA and DNA complements with similar stability to the native complexes.
- the study of inco ⁇ orating CeNA structures into natural nucleic acid structures was shown by NMR and circular dichroism to proceed with easy conformational adaptation.
- the inco ⁇ oration of CeNA into a sequence targeting RNA was stable to serum and able to activate E. Coli RNase resulting in cleavage ofthe target RNA strand.
- each Bx is a heterocyclic base moiety
- Ti is hydroxyl or a protected hydroxyl
- T2 is hydroxyl or a protected hydroxyl.
- Another class of oligonucleotide mimetic can be prepared from one or more anhydrohexitol nucleosides (see, Wouters and Herdewijn, Bioorg. Med. Chem. Lett., 1999, P, 1563-1566) and would have the general formula:
- a further preferred modification includes Locked Nucleic Acids (LNAs) in which the 2'-hydroxyl group is linked to the 4' carbon atom ofthe sugar ring thereby forming a 2'-C,4'- C-oxymethylene linkage thereby forming a bicyclic sugar moiety.
- the linkage is preferably a methylene (-CH2-) n group bridging the 2' oxygen atom and the 4' carbon atom wherein n is 1 or 2 (Singh et al., Chem. Commun., 1998, 4, 455-456).
- Tm +3 to +10 C
- LNA has been shown to form exceedingly stable LNA:LNA duplexes (Koshkin et al., J. Am. Chem. Soc, 1998, 120, 13252-13253).
- LNA:LNA hybridization was shown to be the most thermally stable nucleic acid type duplex system, and the RNA-mimicking character of LNA was established at the duplex level.
- Tm +15/+11) toward DNA complements.
- Tm +15/+111
- LNAs also form duplexes with complementary DNA, RNA or LNA with high thermal affinities.
- Circular dichroism (CD) spectra show that duplexes involving fully modified LNA (esp. LNA:RNA) structurally resemble an A-form RNA:RNA duplex.
- Nuclear magnetic resonance (NMR) examination of an LNA:DNA duplex confirmed the 3'-endo conformation of an LNA monomer. Recognition of double-stranded DNA has also been demonsfrated suggesting strand invasion by LNA.
- Studies of mismatched sequences show that LNAs obey the Watson- Crick base pairing rules with generally improved selectivity compared to the corresponding unmodified reference strands.
- Novel types of LNA-oligomeric compounds, as well as the LNAs, are useful in a wide range of diagnostic and therapeutic applications. Among these are antisense applications, PCR applications, strand-displacement oligomers, substrates for nucleic acid polymerases and generally as nucleotide based drugs.
- LNAs confer several desired properties to antisense agents.
- LNA/DNA copolymers were not degraded readily in blood serum and cell extracts.
- LNA/DNA copolymers exhibited potent antisense activity in assay systems as disparate as G-protein-coupled receptor signaling in living rat brain and detection of reporter genes in Escherichia coli. Lipofectin- mediated efficient delivery of LNA into living human breast cancer cells has also been accomplished.
- oligonucleotide mimetics have been prepared to include bicyclic and tricyclic nucleoside analogs having the formulas (amidite monomers shown):
- oligonucleotide mimetic is referred to as phosphonomonoester nucleic acids inco ⁇ orate a phosphorus group in a backbone the backbone.
- This class of oligonucleotide mimetic is reported to have useful physical and biological and pharmacological properties in the areas of inhibiting gene expression (antisense oligonucleotides, ribozymes, sense oligonucleotides and triplex-forming oligonucleotides), as probes for the detection of nucleic acids and as auxiliaries for use in molecular biology.
- the general formula for definitions of variables see: United States Patents
- Oligomeric compounds ofthe invention may also contain one or more substituted sugar moieties.
- Preferred oligomeric compounds comprise a sugar substituent group selected from: OH; F; O-, S-, or N-alkyl; O-, S-, orN-alkenyl; O-, S- orN-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl may be substituted or unsubstituted d to C 10 alkyl or C 2 to do alkenyl and alkynyl.
- oligomers comprise a sugar substituent group selected from: d to C 10 lower alkyl, substituted lower alkyl, alkenyl, alkynyl, alkaryl, aralkyl, O-alkaryl or O- aralkyl, SH, SCH 3 , OCN, Cl, Br, CN, CF 3 , OCF 3 , SOCH 3 , SO 2 CH 3 , ONO 2 , NO 2 , N 3 , NH 2 , heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving the pharmacokinetic properties of an oligomer, or a group for improving the pharmacodynamic properties of an oligomer, and other substituents having similar properties.
- a preferred modification includes 2'-methoxyethoxy (2'-O-CH 2 CH 2 OCH 3 , also known as 2'-O-(2- methoxyethyl) or 2'-MOE) (Martin et al, Helv. Chim. Acta, 1995, 78, 486-504) i.e., an alkoxyalkoxy group.
- a further preferred modification includes 2'-dimethylaminooxyethoxy, i.e., a O(CH 2 ) 2 ON(CH 3 ) 2 group, also known as 2'-DMAOE, as described in examples herein below, and 2'-dimethylaminoethoxyethoxy (also known in the art as 2'-O-dimethyl-amino-ethoxy-ethyl or 2'-DMAEOE), i.e., 2'-O-CH 2 -O-CH 2 -N(CH 3 )2.
- 2'-Sugar substituent groups may be in the arabino (up) position or ribo (down) position.
- a preferred 2'-arabino modification is 2'-F.
- Similar modifications may also be made at other positions on the oligomeric compound, particularly the 3' position ofthe sugar on the 3' terminal nucleoside or in 2'-5' linked oligomers and the 5' position of 5' terminal nucleotide.
- Oligomeric compounds may also have sugar mimetics such as cyclobutyl moieties in place ofthe pentofuranosyl sugar.
- Representative United States patents that teach the preparation of such modified sugar structures include, but are not limited to, U.S.: 4,981,957; 5,118,800; 5,319,080; 5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785; 5,519,134; 5,567,811; 5,576,427; 5,591,722; 5,597,909; 5,610,300; 5,627,053; 5,639,873; 5,646,265; 5,658,873; 5,670,633; 5,792,747; and 5,700,920, certain of which are commonly owned with the instant application, and each of which is herein inco ⁇ orated by reference in its entirety.
- Further representative sugar substituent groups include groups of formula I a or II a :
- R is O, S orNH
- R p and Rq are each independently hydrogen or d-do alkyl;
- R r is -R x -R y ;
- each R s , Rt, R u and R v is, independently, hydrogen, C(O)R w , substituted or unsubstituted d-do alkyl, substituted or unsubstituted C 2 -do alkenyl, substituted or unsubstituted C 2 -C 10 alkynyl, alkylsulfonyl, arylsulfonyl, a chemical functional group or a conjugate group, wherein the substituent groups are selected from hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl and alkynyl; or optionally, R u and R v , together form a phthalimido
- R is hydrogen, a nitrogen protecting group or -R x -R y ;
- R p is hydrogen, a nitrogen protecting group or -R x -R y ;
- R x is a bond or a linking moiety
- R y is a chemical functional group, a conjugate group or a solid support medium; each R m and R n is, independently, H, a nitrogen protecting group, substituted or unsubstituted d-do alkyl, substituted or unsubstituted C -do alkenyl, substituted or unsubstituted C 2 -C 10 alkynyl, wherein the substituent groups are selected from hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl, alkynyl; NH 3 + , N(R U )(R V ), guanidino and acyl where said acyl is an acid amide or an ester; or R m and R n , together, are a nitrogen protecting group, are joined in a ring structure that optionally includes an additional heteroatom selected from N and O or are
- R f , R g and R comprise a ring system having from about 4 to about 7 carbon atoms or having from about 3 to about 6 carbon atoms and 1 or 2 heteroatoms wherein said heteroatoms are selected from oxygen, nitrogen and sulfur and wherein said ring system is aliphatic, unsaturated aliphatic, aromatic, or saturated or unsaturated heterocyclic;
- R j is alkyl or haloalkyl having 1 to about 10 carbon atoms, alkenyl having 2 to about 10 carbon atoms, alkynyl having 2 to about 10 carbon atoms, aryl having 6 to about 14 carbon atoms, N(R k )(R m ) OR k , halo, SR k or CN;
- m a is 1 to about 10; each mb is, independently, 0 or 1;
- mc is 0 or an integer from 1 to 10;
- md is an integer from 1 to 10; me is from 0, 1 or 2; and provided that when mc is 0, md is greater than 1.
- sugar substituent groups include O[(CH 2 ) n O] ra CH 3 ,
- Oligomeric compounds may also include nucleobase (often referred to in the art simply as “base” or “heterocyclic base moiety”) modifications or substitutions.
- nucleobases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U).
- Modified nucleobases also referred herein as heterocyclic base moieties include other synthetic and natural nucleobases such as 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2- aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5- halouracil and cytosine, 5- ⁇ ropynyl (-C ⁇ C-CH 3 ) uracil and cytosine and other alkynyl derivatives of pyrimidine bases, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4- thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other
- Heterocyclic base moieties may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7- deazaguanosine, 2-aminopyridine and 2-pyridone.
- Further nucleobases include those disclosed in United States Patent No. 3,687,808, those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, pages 858-859, Kroschwitz, J.I., ed.
- nucleobases are particularly useful for increasing the binding affinity ofthe oligomeric compounds ofthe invention. These include 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and O-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil and 5-propynylcytosine.
- oligomeric compounds are prepared having polycyclic heterocyclic compounds in place of one or more heterocyclic base moieties. A number of tricyclic heterocyclic compounds have been previously reported.
- the gain in helical stability does not compromise the specificity ofthe oligonucleotides.
- the T m data indicate an even greater discrimination between the perfect match and mismatched sequences compared to dC5 me . It was suggested that the tethered amino group serves as an additional hydrogen bond donor to interact with the Hoogsteen face, namely the O6, of a complementary guanine thereby forming 4 hydrogen bonds.
- a further preferred substitution that can be appended to the oligomeric compounds ofthe invention involves the linkage of one or more moieties or conjugates which enhance the activity, cellular distribution or cellular uptake ofthe resulting oligomeric compounds.
- such modified oligomeric compounds are prepared by covalently attaching conjugate groups to functional groups such as hydroxyl or amino groups.
- Conjugate groups ofthe invention include intercalators, reporter molecules, polyamines, polyamides, polyethylene glycols, polyethers, groups that enhance the pharmacodynamic properties of oligomers, and groups that enhance the pharmacokinetic properties of oligomers.
- Typical conjugates groups include cholesterols, lipids, phospholipids, biotin, phenazine, folate, phenanthridine, anthraquinone, acridine, fluoresceins, rhodamines, coumarins, and dyes.
- Groups that enhance the pharmacodynamic properties include groups that improve oligomer uptake, enhance oligomer resistance to degradation, and/or strengthen sequence-specific hybridization with RNA.
- Groups that enhance the pharmacokinetic properties include groups that improve oligomer uptake, distribution, metabolism or excretion.
- Conjugate moieties include but are not limited to lipid moieties such as a cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Let., 1994, 4, 1053-1060), a thioether, e.g., hexyl-S-tritylthiol (Manoharan et al., Ann. NY. Acad.
- Acids Res., 1990, 18, 3777-3783 a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651- 3654), apalmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), or an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923-937.
- the oligomeric compounds ofthe invention may also be conjugated to active drug substances, for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fenbufen, ketoprofen, (S)-(+)-pranoprofen, ca ⁇ rofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, flufenamic acid, folinic acid, a benzothiadiazide, chlorothiazide, a diazepine, indomethicin, a barbiturate, a cephalosporin, a sulfa drug, an antidiabetic, an antibacterial or an antibiotic.
- active drug substances for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fenbufen, ketoprofen, (S)-(+)-pranoprofen, ca ⁇ rof
- oligomeric compounds include nucleosides synthetically modified to induce a 3'-endo sugar conformation.
- a nucleoside can inco ⁇ orate synthetic modifications ofthe heterocyclic base, the sugar moiety or both to induce a desired 3'- endo sugar conformation.
- These modified nucleosides are used to mimic RNA like nucleosides so that particular properties of an oligomeric compound can be enhanced while maintaining the desirable 3'-endo conformational geometry.
- RNA type duplex A form helix, predominantly 3'-endo
- RNA interference which is supported in part by the fact that duplexes composed of 2'-deoxy-2'-F-nucleosides appears efficient in triggering RNAi response in the C. elegans system.
- Properties that are enhanced by using more stable 3'-endo nucleosides include but aren't limited to modulation of pharmacokinetic properties through modification of protein binding, protein off-rate, abso ⁇ tion and clearance; modulation of nuclease stability as well as chemical stability; modulation ofthe binding affinity and specificity ofthe oligomer (affinity and specificity for enzymes as well as for complementary sequences); and increasing efficacy of RNA cleavage.
- the present invention provides oligomeric triggers of RNAi having one or more nucleosides modified in such a way as to favor a C3'-endo type conformation.
- Nucleoside conformation is influenced by various factors including substitution at the 2', 3' or 4'-positions ofthe pentofuranosyl sugar. Electronegative substituents generally prefer the axial positions, while sterically demanding substituents generally prefer the equatorial positions (Principles of Nucleic Acid Structure, Wolfgang Sanger, 1984, Springer- Verlag.) Modification ofthe 2' position to favor the 3'-endo conformation can be achieved while maintaining the 2'-OH as a recognition element, as illustrated in Figure 2, below (Gallo et al., Tetrahedron (2001), 57, 5707-5713. Harry-O'kuru et al, J. Org.
- preference for the 3'-endo conformation can be achieved by deletion ofthe 2'-OH as exemplified by 2'deoxy-2'F- nucleosides (Kawasaki et al, J. Med. Chem. (1993), 36, 831-841), which adopts the 3'-endo conformation positioning the electronegative fluorine atom in the axial position.
- oligomeric triggers of RNAi response might be composed of one or more nucleosides modified in such a way that conformation is locked into a C3'-endo type conformation, i.e. Locked Nucleic Acid (LNA, Singh et al, Chem. Commun. (1998), 4, 455-456), and ethylene bridged Nucleic Acids (ENA, Morita et al, Bioorganic & Medicinal Chemistry Letters (2002), 12, 73-76.)
- LNA Locked Nucleic Acid
- ENA ethylene bridged Nucleic Acids
- modified nucleosides and their oligomers can be estimated by various methods such as molecular dynamics calculations, nuclear magnetic resonance spectroscopy and CD measurements. Hence, modifications predicted to induce RNA like conformations, A-form duplex geometry in an oligomeric context, are selected for use in the modified oligonucleotides ofthe present invention.
- the synthesis of numerous ofthe modified nucleosides amenable to the present invention are known in the art (see for example, Chemistry of Nucleosides and Nucleotides Vol 1-3, ed. Leroy B. Townsend, 1988, Plenum press, and the examples section below.)
- the present invention is directed to oligomers that are prepared having enhanced properties compared to native RNA against nucleic acid targets.
- a target is identified and an oligomer is selected having an effective length and sequence that is complementary to a portion ofthe target sequence.
- Each nucleoside ofthe selected sequence is scrutinized for possible enhancing modifications.
- a preferred modification would be the replacement of one or more RNA nucleosides with nucleosides that have the same 3'-endo conformational geometry.
- Such modifications can enhance chemical and nuclease stability relative to native RNA while at the same time being much cheaper and easier to synthesize and/or inco ⁇ orate into an oligonucleotide.
- the selected sequence can be further divided into regions and the nucleosides of each region evaluated for enhancing modifications that can be the result of a chimeric configuration. Consideration is also given to the 5' and 3'-termini as there are often advantageous modifications that can be made to one or more ofthe terminal nucleosides.
- the oligomeric compounds ofthe present invention include at least one 5'-modified phosphate group on a single strand or on at least one 5'-position of a double stranded sequence or sequences. Further modifications are also considered such as internucleoside linkages, conjugate groups, substitute sugars or bases, substitution of one or more nucleosides with nucleoside mimetics and any other modification that can enhance the selected sequence for its intended target.
- RNA:RNA duplexes are more stable and have higher melting temperatures (Tm's) than DNA:DNA duplexes (S anger et al. Principles of Nucleic Acid Structure, 1984, Springer- Verlag; New York, NY.; Lesnik et al.
- RNA duplex RNA duplex
- 2 1 " hydroxyl in RNA biases the sugar toward a C3' endo pucker, i.e., also designated as Northern pucker, which causes the duplex to favor the A-form geometry.
- the 2' hydroxyl groups of RNA can form a network of water mediated hydrogen bonds that help stabilize the RNA duplex (Egli et al.
- deoxy nucleic acids prefer a C2' endo sugar pucker, i.e., also known as Southern pucker, which is thought to impart a less stable B-form geometry (Sanger, W. (1984) Principles of Nucleic Acid Structure, Springer-Verlag, New York, NY).
- B-form geometry is inclusive of both C2'- endo pucker and O4'-endo pucker. This is consistent with Berger, et. al, Nucleic Acids Research, 1998, 26, 2473-2480, who pointed out that in considering the furanose conformations which give rise to B-form duplexes consideration should also be given to a O4'-endo pucker contribution.
- DNA:RNA hybrid duplexes are usually less stable than pure
- RNA:RNA duplexes and depending on their sequence may be either more or less stable than DNA:DNA duplexes (Searle et al, Nucleic Acids Res., 1993, 21, 2051-2056).
- the structure of a hybrid duplex is intermediate between A- and B-form geometries, which may result in poor stacking interactions (Lane et al, Eur. J. Biochem., 1993, 215, 297-306; Fedoroff et al, J. Mol. Biol, 1993, 233, 509-523; Gonzalez et al, Biochemistry, 1995, 34, 4969-4982; Horton et al, J. Mol. Biol, 1996, 264, 521-533).
- the stability ofthe duplex formed between a target RNA and a synthetic sequence is central to therapies such as but not limited to antisense and RNA interference as these mechanisms require the binding of a synthetic oligomer strand to an RNA target strand.
- therapies such as but not limited to antisense and RNA interference as these mechanisms require the binding of a synthetic oligomer strand to an RNA target strand.
- antisense effective inhibition ofthe mRNA requires that the antisense DNA have a very high binding affinity with the mRNA. Otherwise the desired interaction between the synthetic oligomer strand and target mRNA strand will occur infrequently, resulting in decreased efficacy.
- One routinely used method of modifying the sugar puckering is the substitution of the sugar at the 2'-position with a substituent group that influences the sugar geometry.
- the influence on ring conformation is dependant on the nature ofthe substituent at the 2'-position.
- a number of different substituents have been studied to determine their sugar puckering effect. For example, 2'-halogens have been studied showing that the 2'-fluoro derivative exhibits the largest population (65%) ofthe C3'-endo form, and the 2'-iodo exhibits the lowest population (7%).
- the populations of adenosine (2'-OH) versus deoxyadenosine (2'-H) are 36% and 19%, respectively.
- the effect ofthe 2'-fluoro group of adenosine dimers (2'-deoxy-2'-fluoroadenosine - 2'-deoxy-2'-fluoro-adenosine) is further correlated to the stabilization ofthe stacked conformation.
- a 2'-substituent on the 3'-terminus of a dinucleoside monophosphate is thought to exert a number of effects on the stacking conformation: steric repulsion, furanose puckering preference, electrostatic repulsion, hydrophobic attraction, and hydrogen bonding capabilities. These substituent effects are thought to be determined by the molecular size, electronegativity, and hydrophobicity ofthe substituent. Melting temperatures of complementary strands is also increased with the 2'-substituted adenosine diphosphates. It is not clear whether the 3'-endo preference ofthe conformation or the presence ofthe substituent is responsible for the increased binding. However, greater overlap of adjacent bases (stacking) can be achieved with the 3 '-endo conformation.
- Oligomers having the 2'-O-methoxyethyl substituent also have been shown to be antisense inliibitors of gene expression with promising features for in vivo use (Martin, P, Helv. Chim. Acta, 1995, 78, 486-504; Altmann et al, Chimia, 1996, 50, 168-176; Altmann et al, Biochem. Soc. Trans., 1996, 24, 630-637; and Altmann et al, Nucleosides Nucleotides, 1997, 16, 917-926). Relative to DNA, the oligomers having the 2'-MOE modification displayed improved RNA affinity and higher nuclease resistance.
- Chimeric oligomers having 2'-MOE substituents in the wing nucleosides and an internal region of deoxy-phosphorothioate nucleotides have shown effective reduction in the growth of tumors in animal models at low doses.
- 2'-MOE substituted oligomers have also shown outstanding promise as antisense agents in several disease states.
- One such MOE substituted oligomer is presently being investigated in clinical trials for the treatment of CMV retinitis.
- alkyl means d-C ⁇ , preferably d-Cg, and more preferably d-C 6 , straight or (where possible) branched chain aliphatic hydrocarbyl.
- heteroalkyl means d-C 12 , preferably d-d, and more preferably d-C 6 , straight or (where possible) branched chain aliphatic hydrocarbyl containing at least one, and preferably about 1 to about 3, hetero atoms in the chain, including the terminal portion ofthe chain.
- Preferred heteroatoms include N, O and S.
- cycloalkyl means C 3 -Ci2, preferably C 3 -C 8 , and more preferably C 3 -C 6 , aliphatic hydrocarbyl ring.
- alkenyl means -C ⁇ , preferably -d, and more preferably d-C 6 alkenyl, which may be straight or (where possible) branched hydrocarbyl moiety, which contains at least one carbon-carbon double bond.
- alkynyl means -C ⁇ , preferably d-d, and more preferably d-C 6 alkynyl, which may be straight or (where possible) branched hydrocarbyl moiety, which contains at least one carbon-carbon triple bond.
- heterocycloalkyl means a ring moiety containing at least three ring members, at least one of which is carbon, and of which 1, 2 or three ring members are other than carbon.
- the number of carbon atoms varies from 1 to about
- Preferred ring heteroatoms are N, O and S.
- Preferred heterocycloalkyl groups include mo ⁇ holino, thiomo ⁇ holino, piperidinyl, piperazinyl, homopiperidinyl, homopiperazinyl, homomo ⁇ holino, homothiomo ⁇ holino, pyrrolodinyl, tetrahydrooxazolyl, tetrahydroimidazolyl, tetrahydrothiazolyl, tetrahydroisoxazolyl, tetrahydropyrrazolyl, furanyl, pyranyl, and tetrahydroisothiazolyl.
- aryl means any hydrocarbon ring structure containing at least one aryl ring. Preferred aryl rings have about 6 to about 20 ring carbons.
- aryl rings include phenyl, napthyl, anthracenyl, and phenanthrenyl.
- hetaryl means a ring moiety containing at least one fully unsaturated ring, the ring consisting of carbon and non-carbon atoms.
- the ring system contains about 1 to about 4 rings.
- the number of carbon atoms varies from 1 to about 12, preferably 1 to about 6, and the total number of ring members varies from three to about 15, preferably from about 3 to about 8.
- Preferred ring heteroatoms are N, O and S.
- Preferred hetaryl moieties include pyrazolyl, thiophenyl, pyridyl, imidazolyl, tefrazolyl, pyridyl, pyrimidinyl, purinyl, quinazolinyl, quinoxalinyl, benzimidazolyl, benzothiophenyl, etc.
- haloalkyl is defined as an alkyl containing one or more halogen atoms.
- the alkyl is fully halogenated.
- the haloalkyl may be trifluoromethyl.
- the term haloalkoxy is defined as an alkoxy group where the alkyl group is a haloalkyl.
- the haloalkoxy may be trifluoroalkoxy.
- an electron withdrawing group is a group, such as the cyano or isocyanato group that draws electronic charge away from the carbon to which it is attached.
- Other electron withdrawing groups of note include those whose electronegativities exceed that of carbon, for example halogen, nitro, or phenyl substituted in the ortho- or para- position with one or more cyano, isothiocyanato, nitro or halo groups.
- halogen and halo have their ordinary meanings.
- Preferred halo (halogen) substituents are Cl, Br, and I.
- the aforementioned optional substituents are, unless otherwise herein defined, suitable substituents depending upon desired properties. Included are halogens (Cl, Br, I), alkyl, alkenyl, and alkynyl moieties, NO2, NH 3 (substituted and unsubstituted), acid moieties (e.g. - CO 2 H, -OSO 3 H 2 , etc.), heterocycloalkyl moieties, hetaryl moieties, aryl moieties, etc. [00203] hi all the preceding formulae, the squiggle ( ⁇ ) indicates a bond to an oxygen or sulfur ofthe 5 '-phosphate.
- Phosphate protecting groups include those described in US Patents No. US
- the compounds and compositions ofthe invention are used to modulate the expression of a selected protein.
- “Modulators” are those oligomeric compounds and compositions that decrease or increase the expression of a nucleic acid molecule encoding a protein and which comprise at least an 8-nucleobase portion which is complementary to a preferred target segment.
- the screening method comprises the steps of contacting a preferred target segment of a nucleic acid molecule encoding a protein with one or more candidate modulators, and selecting for one or more candidate modulators which decrease or increase the expression of a nucleic acid molecule encoding a protein. Once it is shown that the candidate modulator or modulators are capable of modulating (e.g.
- oligomeric compounds of invention can be used combined with their respective complementary strand oligomeric compound to form stabilized double-stranded (duplexed) oligomers.
- Double stranded oligomer moieties have been shown to modulate target expression and regulate translation as well as RNA processing via an antisense mechanism.
- the double-stranded moieties may be subject to chemical modifications (Fire et al.
- oligomeric compounds ofthe present invention are used to elucidate relationships that exist between proteins and a disease state, phenotype, or condition. These methods include detecting or modulating a target peptide comprising contacting a sample, tissue, cell, or organism with the oligomeric compounds and compositions ofthe present invention, measuring the nucleic acid or protein level ofthe target and/or a related phenotypic or chemical endpoint at some time after treatment, and optionally comparing the measured value to a non-treated sample or sample treated with a further oligomeric compound ofthe invention. These methods can also be performed in parallel or in combination with other experiments to determine the function of unknown genes for the process of target validation or to determine the validity of a particular gene product as a target for treatment or prevention of a disease or disorder.
- the oligomeric compounds and compositions ofthe present invention can additionally be utilized for diagnostics, therapeutics, prophylaxis and as research reagents and kits. Such uses allows for those of ordinary skill to elucidate the function of particular genes or to distinguish between functions of various members of a biological pathway. [00209] For use in kits and diagnostics, the oligomeric compounds and compositions of the present invention, either alone or in combination with other compounds or therapeutics, can be used as tools in differential and/or combinatorial analyses to elucidate expression patterns of a portion or the entire complement of genes expressed within cells and tissues.
- expression patterns within cells or tissues treated with one or more compounds or compositions ofthe invention are compared to control cells or tissues not treated with the compounds or compositions and the patterns produced are analyzed for differential levels of gene expression as they pertain, for example, to disease association, signaling pathway, cellular localization, expression level, size, structure or function ofthe genes examined. These analyses can be performed on stimulated or unstimulated cells and in the presence or absence of other compounds that affect expression patterns.
- Examples of methods of gene expression analysis known in the art include DNA arrays or microarrays (Brazma and Vilo, FEBSLett, 2000, 480, 17-24; Celis, et al, FEBSLett, 2000, 480, 2-16), SAGE (serial analysis of gene expression)(Madden, et al, Drug Discov. Today, 2000, 5, 415-425), READS (restriction enzyme amplification of digested cDNAs) (Prashar and Weissman, Methods Enzymol, 1999, 303, 258-72), TOGA (total gene expression analysis) (Sutcliffe, et al, Proc. Natl. Acad. Sci. U. S.
- the compounds and compositions ofthe invention are useful for research and diagnostics, because these compounds and compositions hybridize to nucleic acids encoding proteins.
- Hybridization ofthe compounds and compositions ofthe invention with a nucleic acid can be detected by means known in the art. Such means may include conjugation of an enzyme to the compound or composition, radiolabelling or any other suitable detection means. Kits using such detection means for detecting the level of selected proteins in a sample may also be prepared.
- Antisense oligomeric compounds have been employed as therapeutic moieties in the treatment of disease states in animals, including humans.
- Antisense oligomer drugs, including ribozymes have been safely and effectively administered to humans and numerous clinical trials are presently underway. It is thus established that oligomeric compounds can be useful therapeutic modalities that can be configured to be useful in treatment regimes for the treatment of cells, tissues and animals, especially humans.
- an animal preferably a human, suspected of having a disease or disorder that can be treated by modulating the expression of a selected protein is treated by administering the compounds and compositions.
- the methods comprise the step of administering to the animal in need of treatment, a therapeutically effective amount of a protein inhibitor.
- the protein inhibitors ofthe present , invention effectively inhibit the activity ofthe protein or inhibit the expression ofthe protein.
- the activity or expression of a protein in an animal is inhibited by about 10%.
- the activity or expression of a protein in an animal is inhibited by about 30%. More preferably, the activity or expression of a protein in an animal is inhibited by 50% or more.
- the reduction of the expression of a protein may be measured in serum, adipose tissue, liver or any other body fluid, tissue or organ ofthe animal.
- the cells contained within the fluids, tissues or organs being analyzed contain a nucleic acid molecule encoding a protein and/or the protein itself.
- the compounds and compositions ofthe invention can be utilized in pharmaceutical compositions by adding an effective amount ofthe compound or composition to a suitable pharmaceutically acceptable diluent or carrier.
- Use ofthe oligomeric compounds and methods ofthe invention may also be useful prophylactically.
- compositions ofthe invention may also be admixed, encapsulated, conjugated or otherwise associated with other molecules, molecule structures or mixtures of compounds, as for example, liposomes, receptor-targeted molecules, oral, rectal, topical or other formulations, for assisting in uptake, distribution and/or abso ⁇ tion.
- Representative United States patents that teach the preparation of such uptake, distribution and/or abso ⁇ tion-assisting formulations include, but are not limited to, U.S.: 5,108,921;
- the compounds and compositions ofthe invention encompass any pharmaceutically acceptable salts, esters, or salts of such esters, or any other compound which, upon administration to an animal, including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Accordingly, for example, the disclosure is also drawn to prodrugs and pharmaceutically acceptable salts ofthe oligomeric compounds ofthe invention, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents.
- prodrug indicates a therapeutic agent that is prepared in an inactive form that is converted to an active form (i.e., drug) within the body or cells thereof by the action of endogenous enzymes or other chemicals and/or conditions.
- prodrug versions of the oligomers ofthe invention are prepared as SATE [(S-acetyl-2-thioethyl) phosphate] derivatives according to the methods disclosed in WO 93/24510 to Gosselin et al, published
- pharmaceutically acceptable salts refers to physiologically and pharmaceutically acceptable salts ofthe compounds and compositions ofthe invention: i.e., salts that retain the desired biological activity ofthe parent compound and do not impart undesired toxicological effects thereto.
- pharmaceutically acceptable salts and their uses are further described in U.S. Patent 6,287,860, which is inco ⁇ orated herein in its entirety.
- the present invention also includes pharmaceutical compositions and formulations that include the compounds and compositions ofthe invention.
- the pharmaceutical compositions ofthe present invention may be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. Administration may be topical (including ophthalmic and to mucous membranes including vaginal and rectal delivery), pulmonary, e.g, by inhalation or insufflation of powders or aerosols, including by nebulizer; infratracheal, intranasal, epidermal and transdermal), oral or parenteral.
- Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; or intracranial, e.g, intrathecal or intraventricular, administration.
- Pharmaceutical compositions and formulations for topical administration may include transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders.
- Conventional pharmaceutical carriers, aqueous, powder or oily bases, thickeners and the like may be necessary or desirable.
- Coated condoms, gloves and the like may also be useful.
- the pharmaceutical formulations ofthe present invention which may conveniently be presented in unit dosage form, may be prepared according to conventional techniques well known in the pharmaceutical industry.
- Such techniques include the step of bringing into association the active ingredients with the pharmaceutical carrier(s) or excipient(s).
- the formulations are prepared by uniformly and intimately bringing into association the active ingredients with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product.
- compositions ofthe present invention may be formulated into any of many possible dosage forms such as, but not limited to, tablets, capsules, gel capsules, liquid syrups, soft gels, suppositories, and enemas.
- the compositions ofthe present invention may also be formulated as suspensions in aqueous, non-aqueous or mixed media.
- Aqueous suspensions may further contain substances which increase the viscosity ofthe suspension including, for example, sodium carboxymethylcellulose, sorbitol and/or dextran.
- the suspension may also contain stabilizers.
- compositions ofthe present invention include, but are not limited to, solutions, emulsions, foams and liposome-containing formulations.
- the pharmaceutical compositions and formulations ofthe present invention may comprise one or more penetration enhancers, carriers, excipients or other active or inactive ingredients.
- Emulsions are typically heterogenous systems of one liquid dispersed in another in the form of droplets usually exceeding 0.1 ⁇ m in diameter. Emulsions may contain additional components in addition to the dispersed phases, and the active drug that may be present as a solution in either the aqueous phase, oily phase or itself as a separate phase. Microemulsions are included as an embodiment ofthe present invention. Emulsions and their uses are well known in the art and are further described in U.S. Patent 6,287,860, which is inco ⁇ orated herein in its entirety.
- Formulations ofthe present invention include liposomal formulations.
- liposome means a vesicle composed of amphiphilic lipids arranged in a spherical bilayer or bilayers. Liposomes are unilamellar or multilamellar vesicles which have a membrane formed from a lipophilic material and an aqueous interior that contains the composition to be delivered. Cationic liposomes are positively charged liposomes which are believed to interact with negatively charged DNA molecules to form a stable complex.
- Liposomes that are pH-sensitive or negatively-charged are believed to entrap DNA rather than complex with it. Both cationic and noncationic liposomes have been used to deliver DNA to cells.
- Liposomes also include "sterically stabilized" liposomes, a term which, as used herein, refers to liposomes comprising one or more specialized lipids that, when inco ⁇ orated into liposomes, result in enhanced circulation lifetimes relative to liposomes lacking such specialized lipids.
- sterically stabilized liposomes are those in which part ofthe vesicle-forming lipid portion ofthe liposome comprises one or more glycolipids or is derivatized with one or more hydrophilic polymers, such as a polyethylene glycol (PEG) moiety.
- PEG polyethylene glycol
- compositions ofthe present invention may also include surfactants.
- surfactants used in drug products, formulations and in emulsions is well known in the art. Surfactants and their uses are further described in U.S. Patent 6,287,860, which is inco ⁇ orated herein in its entirety.
- the present invention employs various penetration enhancers to effect the efficient delivery of nucleic acids, particularly oligomers.
- penetration enhancers hi addition to aiding the diffusion of non-lipophilic drugs across cell membranes, penetration enhancers also enhance the permeability of lipophilic drugs.
- Penetration enhancers may be classified as belonging to one of five broad categories, i.e., surfactants, fatty acids, bile salts, chelating agents, and non-chelating non-surfactants. Penetration enhancers and their uses are further described in U.S. Patent 6,287,860, which is inco ⁇ orated herein in its entirety.
- formulations are routinely designed according to their intended use, i.e. route of administration.
- Preferred formulations for topical administration include those in which the oligomers ofthe invention are in admixture with a topical delivery agent such as lipids, liposomes, fatty acids, fatty acid esters, steroids, chelating agents and surfactants.
- a topical delivery agent such as lipids, liposomes, fatty acids, fatty acid esters, steroids, chelating agents and surfactants.
- Preferred lipids and liposomes include neutral (e.g. dioleoylphosphatidyl DOPE ethanolamine, dimyristoylphosphatidyl choline DMPC, distearolyphosphatidyl choline) negative (e.g. dimyristoylphosphatidyl glycerol DMPG) and cationic (e.g. dioleoyltetramethylaminopropyl DOTAP and dioleoylphosphatidyl ethanolamine DOTMA).
- neutral e.g. dio
- compounds and compositions ofthe invention may be encapsulated within liposomes or may form complexes thereto, in particular to cationic liposomes. Alternatively, they may be complexed to lipids, in particular to cationic lipids.
- Preferred fatty acids and esters, pharmaceutically acceptable salts thereof, and their uses are further described in U.S. Patent 6,287,860, which is inco ⁇ orated herein in its entirety.
- Topical formulations are described in detail in United States patent application 09/315,298 filed on May 20, 1999, which is inco ⁇ orated herein by reference in its entirety.
- compositions and formulations for oral administration include powders or granules, microparticulates, nanoparticulates, suspensions or solutions in water or non-aqueous media, capsules, gel capsules, sachets, tablets or minitablets. Thickeners, flavoring agents, diluents, emulsifiers, dispersing aids or binders may be desirable.
- Preferred oral formulations are those in which oligomers ofthe invention are administered in conjunction with one or more penetration enhancers surfactants and chelators.
- Preferred surfactants include fatty acids and/or esters or salts thereof, bile acids and/or salts thereof.
- bile acids/salts and fatty acids and their uses are further described in U.S. Patent 6,287,860, which is inco ⁇ orated herein in its entirety.
- penetration enhancers for example, fatty acids/salts in combination with bile acids/salts.
- a particularly preferred combination is the sodium salt of lauric acid, capric acid and UDCA.
- Further penetration enhancers include polyoxyethylene-9- lauryl ether, polyoxyethylene-20-cetyl ether.
- Compounds and compositions ofthe invention may be delivered orally, in granular form including sprayed dried particles, or complexed to form micro or nanoparticles. Complexing agents and their uses are further described in U.S.
- Patent 6,287,860 which is inco ⁇ orated herein in its entirety.
- Certain oral formulations for oligomers and their preparation are described in detail in United States applications 09/108,673 (filed July 1, 1998), 09/315,298 (filed May 20, 1999) and 10/071,822, filed February 8, 2002, each of which is inco ⁇ orated herein by reference in their entirety.
- compositions and formulations for parenteral, intrathecal or intraventricular administration may include sterile aqueous solutions that may also contain buffers, diluents and other suitable additives such as, but not limited to, penetration enhancers, carrier compounds and other pharmaceutically acceptable carriers or excipients.
- Certain embodiments of the invention provide pharmaceutical compositions containing one or more ofthe compounds and compositions ofthe invention and one or more other chemotherapeutic agents that function by a non-antisense mechanism.
- chemotherapeutic agents include but are not limited to cancer chemotherapeutic drugs such as daunorubicin, daunomycin, dactinomycin, doxorubicin, epirubicin, idarubicin, esorubicin, bleomycin, mafosfamide, ifosfamide, cytosine arabinoside, bis-chloroethylnitrosurea, busulfan, mitomycin C, a'ctinomycin D, mithramycin, prednisone, hydroxyprogesterone, testosterone, tamoxifen, dacarbazine, procarbazine, hexamethylmelamine, pentamethylmelamine, mitoxantrone, amsacrine, chlorambucil
- chemotherapeutic agents When used with the oligomeric compounds ofthe invention, such chemotherapeutic agents may be used individually (e.g., 5-FU and oligomer), sequentially (e.g., 5-FU and oligomer for a period of time followed by MTX and oligomer), or in combination with one or more other such chemotherapeutic agents (e.g., 5-FU, MTX and oligomer, or 5-FU, radiotherapy and oligomer).
- Anti-inflammatory drugs including but not limited to nonsteroidal anti-inflammatory drugs and corticosteroids
- antiviral drugs including but not limited to ribivirin, vidarabine, acyclovir and ganciclovir, may also be combined in compositions ofthe invention. Combinations of compounds and compositions ofthe invention and other drugs are also within the scope of this invention. Two or more combined compounds such as two oligomeric compounds or one oligomeric compound combined with further compounds may be used together or sequentially.
- compositions ofthe invention may contain one or more ofthe compounds and compositions ofthe invention targeted to a first nucleic acid and one or more additional compounds such as antisense oligomeric compounds targeted to a second nucleic acid target.
- additional compounds such as antisense oligomeric compounds targeted to a second nucleic acid target.
- antisense oligomeric compounds are known in the art.
- compositions ofthe invention may contain two or more oligomeric compounds and compositions targeted to different regions ofthe same nucleic acid target. Two or more combined compounds may be used together or sequentially
- compositions ofthe invention are believed to be within the skill of those in the art. Dosing is dependent on severity and responsiveness ofthe disease state to be treated, with the course of treatment lasting from several days to several months, or until a cure is effected or a diminution ofthe disease state is achieved. Optimal dosing schedules can be calculated from measurements of drug accumulation in the body ofthe patient. Persons of ordinary skill can easily determine optimum dosages, dosing methodologies and repetition rates. Optimum dosages may vary depending on the relative potency of individual oligomers, and can generally be estimated based on EC 50 S found to be effective in in vitro and in vivo animal models.
- dosage is from 0.01 ug to 100 g per kg of body weight, and may be given once or more daily, weekly, monthly or yearly, or even once every 2 to 20 years. Persons of ordinary skill in the art can easily estimate repetition rates for dosing based on measured residence times and concentrations ofthe drug in bodily fluids or tissues. Following successful treatment, it may be desirable to have the patient undergo maintenance therapy to prevent the rec rence ofthe disease state, wherein the oligomer is administered in maintenance doses, ranging from 0.01 ug to 100 g per kg of body weight, once or more daily, to once every 20 years.
- Alkyl phosphonate oligomers are prepared as described in U.S. Patent 4,469,863, herein inco ⁇ orated by reference.
- 3 '-Deoxy-3 '-methylene phosphonate oligomers are prepared as described in U.S .
- Phosphoramidite oligomers are prepared as described in U.S. Patent, 5,256,775 or
- Alkylphosphonothioate oligomers are prepared as described in published PCT applications PCT/US94/00902 and PCT/US93/06976 (published as WO 94/17093 and WO 94/02499, respectively), herein inco ⁇ orated by reference.
- 3'-Deoxy-3'-amino phosphoramidate oligomers are prepared as described in U.S.
- Patent 5,476,925 herein inco ⁇ orated by reference. '
- Phosphotriester oligomers are prepared as described in U.S. Patent 5,023,243, herein inco ⁇ orated by reference.
- Borano phosphate oligomers are prepared as described in U.S. Patents 5,130,302 and 5,177,198, both herein inco ⁇ orated by reference.
- Formacetal and thioformacetal linked ohgonucleosides are prepared as described in U.S. Patents 5,264,562 and 5,264,564, herein inco ⁇ orated by reference.
- Ethylene oxide linked ohgonucleosides are prepared as described in U.S. Patent
- RNA synthesis chemistry is based on the selective inco ⁇ oration of various protecting groups at strategic intermediary reactions.
- a useful class of protecting groups includes silyl ethers.
- bulky silyl ethers are used to protect the 5 '- hydroxyl in combination with an acid-labile orthoester protecting group on the 2 '-hydroxyl.
- This set of protecting groups is then used with standard solid-phase synthesis technology. It is important to lastly remove the acid labile orthoester protecting group after all other synthetic steps.
- RNA oligonucleotides were synthesized. [00255] RNA oligonucleotides are synthesized in a stepwise fashion. Each nucleotide is added sequentially (3 '- to 5 '-direction) to a solid support-bound oligonucleotide.
- the first nucleoside at the 3 '-end ofthe chain is covalently attached to a solid support.
- the nucleotide precursor, a ribonucleoside phosphoramidite, and activator are added, coupling the second base onto the 5 '-end ofthe first nucleoside.
- the support is washed and any unreacted 5 '-hydroxyl groups are capped with acetic anhydride to yield 5 '-acetyl moieties.
- the linkage is then oxidized to the more stable and ultimately desired P(V) linkage.
- the 5 '-silyl group is cleaved with fluoride. The cycle is repeated for each subsequent nucleotide.
- the methyl protecting groups on the phosphates are cleaved in 30 minutes utilizing 1 M disodium-2-carbamoyl-2-cyanoethylene-l,l-dithiolate trihydrate (S 2 Na 2 ) in DMF.
- the deprotection solution is washed from the solid support-bound oligonucleotide using water.
- the support is then treated with 40% methylamine in water for 10 minutes at 55 °C. This releases the RNA oligonucleotides into solution, deprotects the exocyclic amines, and modifies the 2'- groups.
- the oligonucleotides can be analyzed by anion exchange HPLC at this stage.
- the 2 '-orthoester groups are the last protecting groups to be removed.
- the ethylene glycol monoacetate orthoester protecting group developed by Dharmacon Research, Inc. (Lafayette, CO), is one example of a useful orthoester protecting group which, has the following important properties. It is stable to the conditions of nucleoside phosphoramidite synthesis and oligomer synthesis. However, after oligomer synthesis the oligomer is treated with methylamine which not only cleaves the oligomer from the solid support but also removes the acetyl groups from the orthoesters. The resulting 2-ethyl-hydroxyl substituents on the orthoester are less electron withdrawing than the acetylated precursor.
- the modified orthoester becomes more labile to acid-catalyzed hydrolysis. Specifically, the rate of cleavage is approximately 10 times faster after the acetyl groups are removed. Therefore, this orthoester possesses sufficient stability in order to be compatible with oligomer synthesis and yet, when subsequently modified, permits deprotection to be carried out under relatively mild aqueous conditions compatible with the final RNA oligonucleotide product.
- Chimeric oligomers, ohgonucleosides or mixed oligomers/oligonucleosides ofthe invention can be of several different types. These include a first type wherein the "gap" segment of linked nucleosides is positioned between 5' and 3' "wing" segments of linked nucleosides and a second "open end” type wherein the "gap” segment is located at either the 3' or the 5' terminus ofthe oligomeric compound. Oligomers ofthe first type are also known in the art as “gapmers” or gapped oligomers. Oligomers ofthe second type are also known in the art as “hemimers" or "wingmers”.
- the standard synthesis cycle is modified by inco ⁇ orating coupling steps with increased reaction times for the 5'- dimethoxytrityl-2'-O-methyl-3'-O-phosphoramidite.
- the fully protected oligomer is cleaved from the support and deprotected in concentrated ammonia (NH 4 OH) for 12-16 hr at 55°C.
- the deprotected oligo is then recovered by an appropriate method (precipitation, column chromatography, volume reduced in vacuo and analyzed spetrophotometrically for yield and for purity by capillary electrophoresis and by mass spectrometry.
- Phosphorothioate Oligomers [00261] [2'-O-(2-methoxyethyl)] ⁇ [2'-deoxy] ⁇ [-2'-O-(methoxyethyl)] chimeric phosphorothioate oligomers were prepared as per the procedure above for the 2'-O-methyl chimeric oligomer, with the substitution of 2'-O-(methoxyethyl) amidites for the 2'-O-methyl amidites.
- (methoxyethyl) phosphodiester] chimeric oligomers are prepared as per the above procedure for the 2'-O-methyl chimeric oligomer with the substitution of 2'-O-(methoxyethyl) amidites for the 2'-O-methyl amidites, oxidation with iodine to generate the phosphodiester internucleotide linkages within the wing portions ofthe chimeric structures and sulfurization utilizing 3,H-1,2 benzodithiole-3-one 1,1 dioxide (Beaucage Reagent) to generate the phosphorothioate internucleotide linkages for the center gap.
- t-Butyloxycarbonylglycyl Merrifield resin may be synthesized methods detailed in U.S. Patent No. 5,700,922.
- composition may be synthesized methods detailed in U.S.
- composition may be synthesized methods detailed in U.S.
- composition may be synthesized methods detailed in U.S.
- Hybrid oligomeric phosphorthioates may be made by methods disclosed in U.S.
- ⁇ - ⁇ Mixed oligomers having non-symmetrical 3'-3' and 5'-5' linkages may be synthesized by methods taught in U.S. Patent No. 5,623,065.
- ⁇ - ⁇ Mixed oligomers having symmetrical 4 atom linkages may be synthesized by methods taught in U.S. Patent No. 5,623,065.
- compositions may be synthesized by methods taught in U.S.
- compositions may be synthesized by methods taught in U.S.
- compositions may be synthesized by methods taught in U.S.
- compositions may be synthesized by methods taught in U.S.
- compositions may be synthesized by methods taught in U.S.
- a series of nucleic acid duplexes comprising the antisense oligomeric compounds ofthe present invention and their complements can be designed to target a target.
- the ends ofthe strands may be modified by the addition of one or more natural or modified nucleobases to form an overhang.
- the sense strand ofthe dsRNA is then designed and synthesized as the complement ofthe antisense strand and may also contain modifications or additions to either terminus.
- both strands of the dsRNA duplex would be complementary over the central nucleobases, each having overhangs at one or both termini.
- a duplex comprising an antisense strand having the sequence
- RNA strands ofthe duplex can be synthesized by methods disclosed herein or purchased from Dharmacon Research Inc., (Lafayette, CO). Once synthesized, the complementary sfrands are annealed. The single strands are aliquoted and diluted to a concentration of 50 uM. Once diluted, 30 uL of each strand is combined with 15uL of a 5X solution of annealing buffer. The final concentration of said buffer is 100 mM potassium acetate, 30 mM HEPES-KOH pH 7.4, and 2mM magnesium acetate. The final volume is 75 uL. This solution is incubated for 1 minute at 90°C and then centrifuged for 15 seconds.
- the tube is allowed to sit for 1 hour at 37°C at which time the dsRNA duplexes are used in experimentation.
- the final concentration ofthe dsRNA duplex is 20 uM.
- This solution can be stored frozen (- 20°C) and freeze-thawed up to 5 times.
- duplexed antisense oligomeric compounds are evaluated for their ability to modulate a target expression.
- the oligomers or ohgonucleosides are recovered by precipitation out of 1 M NH 4 OAc with >3 volumes of ethanol.
- Synthesized oligomers were analyzed by electrospray mass spectroscopy (molecular weight determination) and by capillary gel electrophoresis and judged to be at least 70% full length material.
- the relative amounts of phosphorothioate and phosphodiester linkages obtained in the synthesis was determined by the ratio of conect molecular weight relative to the -16 amu product (+/-32 +/- 48).
- Oligomers were synthesized via solid phase P(III) phosphoramidite chemistry on an automated synthesizer capable of assembling 96 sequences simultaneously in a 96-well format.
- Phosphodiester internucleotide linkages were afforded by oxidation with aqueous iodine.
- Phosphorothioate internucleotide linkages were generated by sulfurization utilizing 3,H- 1,2 benzodithiole-3-one 1,1 dioxide (Beaucage Reagent) in anhydrous acetonitrile.
- Standard base-protected beta-cyanoethyl-diiso-propyl phosphoramidites were purchased from commercial vendors (e.g.
- Non-standard nucleosides are synthesized as per standard or patented methods. They are utilized as base protected beta-cyanoethyldiisopropyl phosphoramidites.
- Oligomers were cleaved from support and deprotected with concentrated NH OH at elevated temperature (55-60°C) for 12-16 hours and the released product then dried in vacuo. The dried product was then re-suspended in sterile water to afford a master plate from which all analytical and test plate samples are then diluted utilizing robotic pipettors.
- oligomeric compounds on target nucleic acid expression can be tested in any of a variety of cell types provided that the target nucleic acid is present at measurable levels. This can be routinely determined using, for example, PCR or Northern blot analysis. The following cell types are provided for illustrative pu ⁇ oses, but other cell types can be routinely used, provided that the target is expressed in the cell type chosen. This can be readily determined by methods routine in the art, for example Northern blot analysis, ribonuclease protection assays, or RT-PCR. T-24 cells:
- the human transitional cell bladder carcinoma cell line T-24 was obtained from the American Type Culture Collection (ATCC) (Manassas, VA). T-24 cells were routinely cultured in complete McCoy's 5 A basal media (Invitrogen Co ⁇ oration, Carlsbad, CA) supplemented with 10% fetal calf serum (Invitrogen Co ⁇ oration, Carlsbad, CA), penicillin 100 units per mL, and streptomycin 100 micrograms per mL (Invitrogen Co ⁇ oration, Carlsbad, CA). Cells were routinely passaged by trypsinization and dilution when they reached 90% confluence. Cells were seeded into 96-well plates (Falcon-Primaria #353872) at a density of 7000 cells/well for use in RT-PCR analysis.
- cells may be seeded onto 100 mm or other standard tissue culture plates and treated similarly, using appropriate volumes of medium and oligomer.
- A549 cells A549 cells:
- the human lung carcinoma cell line A549 was obtained from the American Type
- A549 cells were routinely cultured in DMEM basal media (Invitrogen Co ⁇ oration, Carlsbad, CA) supplemented with 10% fetal calf serum (Invitrogen Co ⁇ oration, Carlsbad, CA), penicillin 100 units per mL, and streptomycin 100 micrograms per mL (Invitrogen Co ⁇ oration, Carlsbad, CA). Cells were routinely passaged by trypsinization and dilution when they reached 90% confluence.
- NHDF cells are routinely passaged by trypsinization and dilution when they reached 90% confluence.
- NHDFs were routinely maintained in Fibroblast Growth Medium (Clonetics Co ⁇ oration, Walkersville, MD) supplemented as recommended by the supplier. Cells were maintained for up to 10 passages as recommended by the supplier.
- HEK cells were maintained for up to 10 passages as recommended by the supplier.
- HEK Human embryonic keratinocytes
- HEKs were routinely maintained in Keratinocyte Growth Medium (Clonetics Co ⁇ oration, Walkersville, MD) formulated as recommended by the supplier. Cells were routinely maintained for up to 10 passages as recommended by the supplier. Treatment with antisense oligomeric compounds: (
- the concentration of oligomer used varies from cell line to cell line. To determine the optimal oligomer concentration for a particular cell line, the cells are treated with a positive control oligomer at a range of concentrations.
- the positive control oligomer is selected from either ISIS 13920 (TCCGTCATCGCTCCTCAGGG, SEQ TD NO: 4) which is targeted to human H-ras, or ISIS 18078, (GTGCGCGCGAGCCCGAAATC, SEQ ID NO: 5) which is targeted to human Jun-N-terminal kinase-2 (JNK2).
- Both controls are 2'-O- methoxyethyl gapmers (2'-O-methoxyethyls shown in bold) with a phosphorothioate backbone.
- the positive control oligomer is ISIS 15770, ATGCATTCTGCCCCCAAGGA (SEQ ID NO: 6) a 2'-O-methoxyethyl gapmer (2'-O- methoxyefhyls shown in bold) with a phosphorothioate backbone which is targeted to both mouse and rat c-raf.
- the concentration of positive control oligomer that results in 80% inhibition of c-H-ras (for ISIS 13920), JNK2 (for ISIS 18078) or c-raf (for ISIS 15770) mRNA is then utilized as the screening concenfration for new oligomers in subsequent experiments for that cell line. If 80% inhibition is not achieved, the lowest concentration of positive control oligomer that results in 60% inhibition of c-H-ras, JNK2 or c-raf mRNA is then utilized as the oligomer screening concentration in subsequent experiments for that cell line. If 60% inhibition is not achieved, that particular cell line is deemed as unsuitable for oligomer transfection experiments.
- concentrations of antisense oligomers used herein are from 50 nM to 300 nM.
- Modulation of a target expression can be assayed in a variety of ways known in the art.
- a target mRNA levels can be quantitated by, e.g. Northern blot analysis, competitive polymerase chain reaction (PCR), or real-time PCR (RT-PCR). Real-time quantitative PCR is presently preferred.
- RNA analysis can be performed on total cellular RNA or poly(A)+ mRNA.
- the preferred method of RNA analysis ofthe present invention is the use of total cellular RNA as described in other examples herein. Methods of RNA isolation are well known in the art. Northern blot analysis is also routine in the art.
- PCR Real-time quantitative
- ABI PRISMTM 7600, 7700, or 7900 Sequence Detection System available from PE- Applied Biosystems, Foster City, CA and used according to manufacturer's instructions.
- Protein levels of a target can be quantitated in a variety of ways well known in the art, such as immunoprecipitation, Western blot analysis (immunoblotting), enzyme-linked immunosorbent assay (ELISA) or fluorescence-activated cell sorting (FACS).
- Antibodies directed to a target can be identified and obtained from a variety of sources, such as the MSRS catalog of antibodies (Aerie Co ⁇ oration, Birmingham, MI), or can be prepared via conventional monoclonal or polyclonal antibody generation methods well known in the art.
- the oligomeric compounds are further investigated in one or more phenotypic assays, each having measurable endpoints predictive of efficacy in the freatment of a particular disease state or condition.
- Phenotypic assays, kits and reagents for their use are well known to those skilled in the art and are herein used to investigate the role and/or association of a target in health and disease.
- Representative phenotypic assays which can be purchased from any one of several commercial vendors, include those for determining cell viability, cytotoxicity, proliferation or cell survival (Molecular Probes, Eugene, OR; PerkinElmer, Boston, MA), protein-based assays including enzymatic assays (Panvera, LLC, Madison, WI; BD Biosciences, Franklin Lakes, NJ; Oncogene Research Products, San Diego, CA), cell regulation, signal transduction, inflammation, oxidative processes and apoptosis (Assay Designs Inc., Ann Arbor, MI), triglyceride accumulation (Sigma-Aldrich, St. Louis, MO), angiogenesis assays, tube formation assays, cytokine and hormone assays and metabolic assays (Chemicon International Inc., Teme
- cells determined to be appropriate for a particular phenotypic assay are treated with a target inhibitors identified from the in vitro studies as well as control compounds at optimal concenfrations which are determined by the methods described above.
- treated and untreated cells are analyzed by one or more methods specific for the assay to determine phenotypic outcomes and endpoints.
- Phenotypic endpoints include changes in cell mo ⁇ hology over time or treatment dose as well as changes in levels of cellular components such as proteins, lipids, nucleic acids, hormones, saccharides or metals. Measurements of cellular status which include pH, stage ofthe cell cycle, intake or excretion of biological indicators by the cell, are also endpoints of interest.
- Analysis ofthe geneotype ofthe cell is also used as an indicator of the efficacy or potency ofthe target inhibitors.
- Hallmark genes or those genes suspected to be associated with a specific disease state, condition, or phenotype, are measured in both treated and untreated cells.
- the individual subjects ofthe in vivo studies described herein are warm-blooded vertebrate animals, which includes humans.
- the clinical trial is subjected to rigorous controls to ensure that individuals are not unnecessarily put at risk and that they are fully informed about their role in the study.
- Volunteers receive either the a target inhibitor or placebo for eight week period with biological parameters associated with the indicated disease state or condition being measured at the beginning (baseline measurements before any treatment), end (after the final treatment), and at regular intervals during the study period.
- biological parameters associated with the indicated disease state or condition include the levels of nucleic acid molecules encoding a target or a target protein levels in body fluids, tissues or organs compared to pre-treatment levels.
- Other measurements include, but are not limited to, indices ofthe disease state or condition being treated, body weight, blood pressure, serum titers of pharmacologic indicators of disease or toxicity as well as ADME (abso ⁇ tion, distribution, metabolism and excretion) measurements.
- Information recorded for each patient includes age (years), gender, height (cm), family history of disease state or condition (yes/no), motivation rating (some/moderate/great) and number and type of previous treatment regimens for the indicated disease or condition.
- Volunteers taking part in this study are healthy adults (age 18 to 65 years) and roughly an equal number of males and females participate in the study. Volunteers with certain characteristics are equally distributed for placebo and a target inhibitor freatment. In general, the volunteers treated with placebo have little or no response to treatment, whereas the volunteers treated with the target inhibitor show positive trends in their disease state or condition index at the conclusion ofthe study.
- the repetitive pipetting and elution steps may be automated using a QIAGEN
- Bio-Robot 9604 (Qiagen, Inc., Valencia CA). Essentially, after lysing ofthe cells on the culture plate, the plate is transferred to the robot deck where the pipetting, DNase treatment and elution steps are earned out.
- PCR using the ABI PRISMTM 7600, 7700, or 7900 Sequence Detection System (PE-Applied Biosystems, Foster City, CA) according to manufacturer's instructions.
- ABI PRISMTM 7600, 7700, or 7900 Sequence Detection System PE-Applied Biosystems, Foster City, CA
- This is a closed-tube, non-gel-based, fluorescence detection system which allows high-throughput quantitation of polymerase chain reaction (PCR) products in real-time.
- PCR polymerase chain reaction
- products in real-time quantitative PCR are quantitated as they accumulate. This is accomplished by including in the PCR reaction an oligomer probe that anneals specifically between the forward and reverse PCR primers, and contains two fluorescent dyes.
- a reporter dye e.g, FAM or JOE, obtained from either PE-Applied Biosystems, Foster City, CA, Operon Technologies Inc., Alameda, CA or Integrated DNA Technologies Inc., Coralville, LA
- a quencher dye e.g, TAMRA, obtained from either PE-Applied Biosystems, Foster City, CA, Operon Technologies Inc., Alameda, CA or Integrated DNA Technologies Inc., Coralville, LA
- TAMRA obtained from either PE-Applied Biosystems, Foster City, CA, Operon Technologies Inc., Alameda, CA or Integrated DNA Technologies Inc., Coralville, LA
- annealing ofthe probe to the target sequence creates a substrate that can be cleaved by the 5'-exonuclease activity of Taq polymerase.
- cleavage ofthe probe by Taq polymerase releases the reporter dye from the remainder ofthe probe (and hence from the quencher moiety) and a sequence-specific fluorescent signal is generated.
- additional reporter dye molecules are cleaved from their respective probes, and the fluorescence intensity is monitored at regular intervals by laser optics built into the ABI PRISMTM Sequence Detection System.
- primer-probe sets specific to the target gene being measured are evaluated for their ability to be "multiplexed" with a GAPDH amplification reaction. In multiplexing, both the target gene and the internal standard gene GAPDH are amplified concurrently in a single sample. In this analysis, mRNA isolated from untreated cells is serially diluted.
- Each dilution is amplified in the presence of primer-probe sets specific for GAPDH only, target gene only ("single-plexing"), or both (multiplexing).
- primer-probe sets specific for GAPDH only target gene only
- target gene only target gene only
- multiplexing target gene only
- standard curves of GAPDH and target mRNA signal as a function of dilution are generated from both the single-plexed and multiplexed samples. If both the slope and correlation coefficient ofthe GAPDH and target signals generated from the multiplexed samples fall within 10% of their conesponding values generated from the single-plexed samples, the primer-probe set specific for that target is deemed multiplexable.
- Other methods of PCR are also known in the art.
- PCR reagents were obtained from Invitrogen Co ⁇ oration, (Carlsbad, CA). RT-PCR reagents were obtained from Invitrogen Co ⁇ oration, (Carlsbad, CA). RT-
- PCR reactions were carried out by adding 20 ⁇ L PCR cocktail (2.5x PCR buffer minus MgCl 2 , 6.6 mM MgCl 2 , 375 ⁇ M each of dATP, dCTP, dCTP and dGTP, 375 nM each of forward primer and reverse primer, 125 nM of probe, 4 Units RNAse inhibitor, 1.25 Units PLATINUM® Taq, 5 Units MuLV reverse franscriptase, and 2.5x ROX dye) to 96-well plates containing 30 ⁇ L total RNA solution (20-200 ng). The RT reaction was carried out by incubation for 30 minutes at 48°C.
- PCR cocktail 2.5x PCR buffer minus MgCl 2 , 6.6 mM MgCl 2 , 375 ⁇ M each of dATP, dCTP, dCTP and dGTP, 375 nM each of forward primer and reverse primer, 125 nM of probe, 4 Units RNAs
- RiboGreenTM working reagent 170 ⁇ L of RiboGreenTM working reagent (RiboGreenTM reagent diluted 1:350 in lOmM Tris-HCl, 1 mM EDTA, pH 7.5) is pipetted into a 96-well plate containing 30 ⁇ L purified, cellular RNA. The plate is read in a CytoFluor 4000 (PE Applied Biosystems) with excitation at 485nm and emission at 530nm.
- CytoFluor 4000 PE Applied Biosystems
- Probes and primers are designed to hybridize to a human a target sequence, using published sequence information.
- RNAZOLTM TEL-TEST "B” Inc., Friendswood, TX. Total RNA was prepared following manufacturer's recommended protocols. Twenty micrograms of total RNA was fractionated by electrophoresis through 1.2% agarose gels containing 1.1% formaldehyde using a MOPS buffer system (AMRESCO, Inc. Solon, OH).
- STRATALINKERTM UV Crosslinker 2400 Sfratagene, Inc, La Jolla, CA
- QUICKHYBTM hybridization solution Sfratagene, La JoUa, CA
- a human a target specific primer probe set is prepared by PCR To normalize for variations in loading and transfer efficiency membranes are stripped and probed for human glyceraldehyde-3-phosphate dehydrogenase (GAPDH) RNA (Clontech, Palo Alto, CA). [00317] Hybridized membranes were visualized and quantitated using a
- oligomeric compounds are designed to target different regions ofthe human target RNA.
- the oligomeric compounds are analyzed for their effect on human target mRNA levels by quantitative real-time PCR as described in other examples herein. Data are averages from three experiments.
- the target regions to which these preferred sequences are complementary are herein referred to as "preferred target segments" and are therefore preferred for targeting by oligomeric compounds of the present invention.
- the sequences represent the reverse complement ofthe preferred antisense oligomeric compounds.
- antisense oligomeric compounds include antisense oligomeric compounds, antisense oligomers, ribozymes, external guide sequence (EGS) oligomers, alternate splicers, primers, probes, and other short oligomeric compounds that hybridize to at least a portion ofthe target nucleic acid.
- GCS external guide sequence
- PAGE gel PAGE gel. Gels are run for 1.5 hours at 150 V, and transferred to membrane for western blotting. Appropriate primary antibody directed to a target is used, with a radiolabeled or fluorescently labeled secondary antibody directed against the primary antibody species. Bands are visualized using a PHOSPHORIMAGERTM (Molecular Dynamics, Sunnyvale CA).
- the antisense (AS) sfrands listed below having SEQ ID NO: 8 were individually duplexed with the sense (S) strand having SEQ ID NO: 7 and the activity was measured to determine the relative positional effect ofthe 5 modifications.
- Underlined nucleosides are 2'-O-methyl modified nucleosides, dT's are deoxy thymidines, all other nucleosides are ribonucleosides and all internucleoside linkages are phosphodiester.
- 5'-end ofthe antisense strand reduced PTEN mRNA levels to from 25 to 35% of untreated control.
- the remaining 2 constructs increased PTEN mRNA levels above untreated control.
- Example 31 Solid block of 2'-O-methyl modified nucleosides in the antisense strand of siRNA's assayed for PTEN mRNA levels against untreated control
- antisense strands listed below having SEQ ID NO: 9 were individually duplexed with the sense strand having SEQ ID NO: 7 and the activity was measured to determine the relative effect of adding either 9 or 14, 2'-O-methyl modified nucleosides at the 3 '-end ofthe resulting siRNA's.
- Underlined nucleosides are 2'-O-methyl modified nucleosides, dT's are deoxy thymidines, all other nucleosides are ribonucleosides and all internucleoside linkages are phosphodiester.
- siRNA having 9, 2'-O-methyl nucleosides reduced PTEN mRNA levels to about 40% of untreated control whereas the construct having 14, 2'-O-methyl nucleosides only reduced PTEN mRNA levels to about 98% of control.
- a series of blockmers were prepared as duplexed siRNA's and also as single strand asRNA's.
- the antisense strands were identical for the siRNA's and the asRNA's.
- Underlined nucleosides are 2'-O-methyl modified nucleosides, all other nucleosides are ribonucleosides and all internucleoside linkages for the AS strands are phosphorothioate and the internucleoside linkages for the S strand are phosphodiester.
- the constructs were assayed for activity for measuring the levels of PTEN mRNA in T24 cells against untreated control levels. All ofthe asRNA's and siRNA's showed activity with the asRNA's having the best activity in each case. A clear dose response was seen for all the siRNA constructs (20, 40, 80 and 150 nm doses). There was a good dose response for the asRNA's for 50, 100 and 200 nm doses. In general the siRNA's were more active in this system at lower doses than the asRNA's and at the 150 mn dose was able to reduce PTEN mRNA levels to from 15 to 40% of untreated confrol. The unmodified siRNA 303912 reduced PTEN mRNA levels to about 19%) ofthe untreated confrol.
- Blunt and overhanging siRNA constructs were prepared having a block of 5, 2'-O- methyl nucleosides at the 3'-terminus.
- Underlined nucleosides are 2'-O-methyl modified nucleosides, all other nucleosides are ribonucleosides and all internucleoside linkages for the AS strands are phosphorothioate and the internucleoside linkages for the S strand are phosphodiester.
- siRNA hemimer constructs were prepared and examined in a PTEN assay.
- the hemimer constructs had 7, 2'-O-methyl nucleosides at the 3 '-end.
- the hemimer was put in the sense strand only, the antisense sfrand only and in both strands to compare the effects.
- Underlined nucleosides are 2'-O-methyl modified nucleosides, all other nucleosides are ribonucleosides and all internucleoside linkages for the AS sfrands are phosphorothioate and the internucleoside linkages for the S strand are phosphodiester.
- siRNA's prepared having 2'-F-methyl modified nucleosides and various structural motifs
- siRNA's prepared having 2'-F and 2'-OMe modified nucleosides [0339] The following antisense sfrands of siRNA's were hybridized to the complementary full phosphodiester sense strand. Where the antisense strand has a TT 3'- terminus the corresponding sense strand also has a 3'-TT (deoxyT's).
- Bolded monomers are 2'-F containing monomers. Underlined monomers are 2'-OMe. Monomers that are not bolded or underlined do not contain a sugar surrogate. Linkages are shown in the parenthesis after the sequence.
Abstract
Description
Claims
Priority Applications (3)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
EP03781746A EP1560839A4 (en) | 2002-11-05 | 2003-11-04 | Chimeric oligomeric compounds and their use in gene modulation |
CA2504720A CA2504720C (en) | 2002-11-05 | 2003-11-04 | Chimeric oligomeric compounds and their use in gene modulation |
AU2003287505A AU2003287505A1 (en) | 2002-11-05 | 2003-11-04 | Chimeric oligomeric compounds and their use in gene modulation |
Applications Claiming Priority (4)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US42376002P | 2002-11-05 | 2002-11-05 | |
US60/423,760 | 2002-11-05 | ||
US50327103P | 2003-09-15 | 2003-09-15 | |
US60/503,271 | 2003-09-15 |
Publications (2)
Publication Number | Publication Date |
---|---|
WO2004044138A2 true WO2004044138A2 (en) | 2004-05-27 |
WO2004044138A3 WO2004044138A3 (en) | 2005-03-24 |
Family
ID=32314502
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/US2003/035074 WO2004044138A2 (en) | 2002-11-05 | 2003-11-04 | Chimeric oligomeric compounds and their use in gene modulation |
Country Status (4)
Country | Link |
---|---|
EP (1) | EP1560839A4 (en) |
AU (1) | AU2003287505A1 (en) |
CA (1) | CA2504720C (en) |
WO (1) | WO2004044138A2 (en) |
Cited By (15)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2004043979A2 (en) | 2002-11-05 | 2004-05-27 | Isis Pharmaceuticals, Inc. | Sugar surrogate-containing oligomeric compounds and compositions for use in gene modulation |
EP1677822A2 (en) * | 2003-09-18 | 2006-07-12 | Isis Pharmaceuticals, Inc. | 4'-thionucleosides and oligomeric compounds |
EP1765415A2 (en) * | 2004-06-03 | 2007-03-28 | Isis Pharmaceuticals, Inc. | Oligomeric compounds that facilitate risc loading |
EP1766052A1 (en) * | 2004-06-03 | 2007-03-28 | Isis Pharmaceuticals, Inc. | Chimeric gapped oligomeric compositions |
EP1765847A2 (en) * | 2004-05-27 | 2007-03-28 | Alnylam Pharmaceuticals Inc. | Nuclease resistant double-stranded ribonucleic acid |
EP1765074A2 (en) * | 2004-06-03 | 2007-03-28 | Isis Pharmaceuticals, Inc. | POSITIONALLY MODIFIED siRNA CONSTRUCTS |
EP2023939A2 (en) * | 2006-05-05 | 2009-02-18 | Isis Pharmaceuticals, Inc. | Compounds and methods for modulating expression of pcsk9 |
JP2009514877A (en) * | 2005-11-04 | 2009-04-09 | エムディーアールエヌエー,インコーポレイテッド | Peptide-Dither substrate RNA conjugates as siRNA delivery vehicles |
JP2010506598A (en) * | 2006-10-18 | 2010-03-04 | エムディーアールエヌエー,インコーポレイテッド | Nicked or gapped nucleic acid molecules and their use |
US7695902B2 (en) | 1996-06-06 | 2010-04-13 | Isis Pharmaceuticals, Inc. | Oligoribonucleotides and ribonucleases for cleaving RNA |
US7812149B2 (en) | 1996-06-06 | 2010-10-12 | Isis Pharmaceuticals, Inc. | 2′-Fluoro substituted oligomeric compounds and compositions for use in gene modulations |
US7884086B2 (en) | 2004-09-08 | 2011-02-08 | Isis Pharmaceuticals, Inc. | Conjugates for use in hepatocyte free uptake assays |
US8129515B2 (en) * | 2006-01-27 | 2012-03-06 | Isis Pharmaceuticals, Inc. | Oligomeric compounds and compositions for the use in modulation of microRNAs |
US8569474B2 (en) | 2004-03-09 | 2013-10-29 | Isis Pharmaceuticals, Inc. | Double stranded constructs comprising one or more short strands hybridized to a longer strand |
US9096636B2 (en) | 1996-06-06 | 2015-08-04 | Isis Pharmaceuticals, Inc. | Chimeric oligomeric compounds and their use in gene modulation |
Citations (199)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US1329502A (en) | 1914-05-26 | 1920-02-03 | First Trust & Savings Company | Ironing-machine |
US3687808A (en) | 1969-08-14 | 1972-08-29 | Univ Leland Stanford Junior | Synthetic polynucleotides |
US4426330A (en) | 1981-07-20 | 1984-01-17 | Lipid Specialties, Inc. | Synthetic phospholipid compounds |
US4469863A (en) | 1980-11-12 | 1984-09-04 | Ts O Paul O P | Nonionic nucleic acid alkyl and aryl phosphonates and processes for manufacture and use thereof |
US4534899A (en) | 1981-07-20 | 1985-08-13 | Lipid Specialties, Inc. | Synthetic phospholipid compounds |
US4587044A (en) | 1983-09-01 | 1986-05-06 | The Johns Hopkins University | Linkage of proteins to nucleic acids |
US4605735A (en) | 1983-02-14 | 1986-08-12 | Wakunaga Seiyaku Kabushiki Kaisha | Oligonucleotide derivatives |
US4667025A (en) | 1982-08-09 | 1987-05-19 | Wakunaga Seiyaku Kabushiki Kaisha | Oligonucleotide derivatives |
US4762779A (en) | 1985-06-13 | 1988-08-09 | Amgen Inc. | Compositions and methods for functionalizing nucleic acids |
US4824941A (en) | 1983-03-10 | 1989-04-25 | Julian Gordon | Specific antibody to the native form of 2'5'-oligonucleotides, the method of preparation and the use as reagents in immunoassays or for binding 2'5'-oligonucleotides in biological systems |
US4828979A (en) | 1984-11-08 | 1989-05-09 | Life Technologies, Inc. | Nucleotide analogs for nucleic acid labeling and detection |
US4835263A (en) | 1983-01-27 | 1989-05-30 | Centre National De La Recherche Scientifique | Novel compounds containing an oligonucleotide sequence bonded to an intercalating agent, a process for their synthesis and their use |
US4845205A (en) | 1985-01-08 | 1989-07-04 | Institut Pasteur | 2,N6 -disubstituted and 2,N6 -trisubstituted adenosine-3'-phosphoramidites |
US4876335A (en) | 1986-06-30 | 1989-10-24 | Wakunaga Seiyaku Kabushiki Kaisha | Poly-labelled oligonucleotide derivative |
US4904582A (en) | 1987-06-11 | 1990-02-27 | Synthetic Genetics | Novel amphiphilic nucleic acid conjugates |
US4948882A (en) | 1983-02-22 | 1990-08-14 | Syngene, Inc. | Single-stranded labelled oligonucleotides, reactive monomers and methods of synthesis |
US4958013A (en) | 1989-06-06 | 1990-09-18 | Northwestern University | Cholesteryl modified oligonucleotides |
US4981957A (en) | 1984-07-19 | 1991-01-01 | Centre National De La Recherche Scientifique | Oligonucleotides with modified phosphate and modified carbohydrate moieties at the respective chain termini |
US5013556A (en) | 1989-10-20 | 1991-05-07 | Liposome Technology, Inc. | Liposomes with enhanced circulation time |
US5013830A (en) | 1986-09-08 | 1991-05-07 | Ajinomoto Co., Inc. | Compounds for the cleavage at a specific position of RNA, oligomers employed for the formation of said compounds, and starting materials for the synthesis of said oligomers |
US5023243A (en) | 1981-10-23 | 1991-06-11 | Molecular Biosystems, Inc. | Oligonucleotide therapeutic agent and method of making same |
US5034506A (en) | 1985-03-15 | 1991-07-23 | Anti-Gene Development Group | Uncharged morpholino-based polymers having achiral intersubunit linkages |
US5082830A (en) | 1988-02-26 | 1992-01-21 | Enzo Biochem, Inc. | End labeled nucleotide probe |
US5109124A (en) | 1988-06-01 | 1992-04-28 | Biogen, Inc. | Nucleic acid probe linked to a label having a terminal cysteine |
US5108921A (en) | 1989-04-03 | 1992-04-28 | Purdue Research Foundation | Method for enhanced transmembrane transport of exogenous molecules |
US5112963A (en) | 1987-11-12 | 1992-05-12 | Max-Planck-Gesellschaft Zur Foerderung Der Wissenschaften E.V. | Modified oligonucleotides |
US5118802A (en) | 1983-12-20 | 1992-06-02 | California Institute Of Technology | DNA-reporter conjugates linked via the 2' or 5'-primary amino group of the 5'-terminal nucleoside |
US5118800A (en) | 1983-12-20 | 1992-06-02 | California Institute Of Technology | Oligonucleotides possessing a primary amino group in the terminal nucleotide |
US5130302A (en) | 1989-12-20 | 1992-07-14 | Boron Bilogicals, Inc. | Boronated nucleoside, nucleotide and oligonucleotide compounds, compositions and methods for using same |
US5134066A (en) | 1989-08-29 | 1992-07-28 | Monsanto Company | Improved probes using nucleosides containing 3-dezauracil analogs |
US5138045A (en) | 1990-07-27 | 1992-08-11 | Isis Pharmaceuticals | Polyamine conjugated oligonucleotides |
US5149797A (en) | 1990-02-15 | 1992-09-22 | The Worcester Foundation For Experimental Biology | Method of site-specific alteration of rna and production of encoded polypeptides |
US5166315A (en) | 1989-12-20 | 1992-11-24 | Anti-Gene Development Group | Sequence-specific binding polymers for duplex nucleic acids |
US5175273A (en) | 1988-07-01 | 1992-12-29 | Genentech, Inc. | Nucleic acid intercalating agents |
US5177198A (en) | 1989-11-30 | 1993-01-05 | University Of N.C. At Chapel Hill | Process for preparing oligoribonucleoside and oligodeoxyribonucleoside boranophosphates |
US5185444A (en) | 1985-03-15 | 1993-02-09 | Anti-Gene Deveopment Group | Uncharged morpolino-based polymers having phosphorous containing chiral intersubunit linkages |
US5214136A (en) | 1990-02-20 | 1993-05-25 | Gilead Sciences, Inc. | Anthraquinone-derivatives oligonucleotides |
US5214134A (en) | 1990-09-12 | 1993-05-25 | Sterling Winthrop Inc. | Process of linking nucleosides with a siloxane bridge |
US5216141A (en) | 1988-06-06 | 1993-06-01 | Benner Steven A | Oligonucleotide analogs containing sulfur linkages |
US5218105A (en) | 1990-07-27 | 1993-06-08 | Isis Pharmaceuticals | Polyamine conjugated oligonucleotides |
US5220007A (en) | 1990-02-15 | 1993-06-15 | The Worcester Foundation For Experimental Biology | Method of site-specific alteration of RNA and production of encoded polypeptides |
US5223618A (en) | 1990-08-13 | 1993-06-29 | Isis Pharmaceuticals, Inc. | 4'-desmethyl nucleoside analog compounds |
US5227170A (en) | 1989-06-22 | 1993-07-13 | Vestar, Inc. | Encapsulation process |
US5235033A (en) | 1985-03-15 | 1993-08-10 | Anti-Gene Development Group | Alpha-morpholino ribonucleoside derivatives and polymers thereof |
US5245022A (en) | 1990-08-03 | 1993-09-14 | Sterling Drug, Inc. | Exonuclease resistant terminally substituted oligonucleotides |
US5254469A (en) | 1989-09-12 | 1993-10-19 | Eastman Kodak Company | Oligonucleotide-enzyme conjugate that can be used as a probe in hybridization assays and polymerase chain reaction procedures |
US5256775A (en) | 1989-06-05 | 1993-10-26 | Gilead Sciences, Inc. | Exonuclease-resistant oligonucleotides |
US5258506A (en) | 1984-10-16 | 1993-11-02 | Chiron Corporation | Photolabile reagents for incorporation into oligonucleotide chains |
US5262536A (en) | 1988-09-15 | 1993-11-16 | E. I. Du Pont De Nemours And Company | Reagents for the preparation of 5'-tagged oligonucleotides |
US5264562A (en) | 1989-10-24 | 1993-11-23 | Gilead Sciences, Inc. | Oligonucleotide analogs with novel linkages |
US5264221A (en) | 1991-05-23 | 1993-11-23 | Mitsubishi Kasei Corporation | Drug-containing protein-bonded liposome |
US5264564A (en) | 1989-10-24 | 1993-11-23 | Gilead Sciences | Oligonucleotide analogs with novel linkages |
WO1993024510A1 (en) | 1992-05-25 | 1993-12-09 | Centre National De La Recherche Scientifique (Cnrs) | Phosphotriester-type biologically active compounds |
US5272250A (en) | 1992-07-10 | 1993-12-21 | Spielvogel Bernard F | Boronated phosphoramidate compounds |
WO1994002499A1 (en) | 1992-07-27 | 1994-02-03 | Hybridon, Inc. | Oligonucleotide alkylphosphonothioates |
US5292873A (en) | 1989-11-29 | 1994-03-08 | The Research Foundation Of State University Of New York | Nucleic acids labeled with naphthoquinone probe |
US5317098A (en) | 1986-03-17 | 1994-05-31 | Hiroaki Shizuya | Non-radioisotope tagging of fragments |
US5319080A (en) | 1991-10-17 | 1994-06-07 | Ciba-Geigy Corporation | Bicyclic nucleosides, oligonucleotides, process for their preparation and intermediates |
WO1994017093A1 (en) | 1993-01-25 | 1994-08-04 | Hybridon, Inc. | Oligonucleotide alkylphosphonates and alkylphosphonothioates |
US5354844A (en) | 1989-03-16 | 1994-10-11 | Boehringer Ingelheim International Gmbh | Protein-polycation conjugates |
US5356633A (en) | 1989-10-20 | 1994-10-18 | Liposome Technology, Inc. | Method of treatment of inflamed tissues |
US5359044A (en) | 1991-12-13 | 1994-10-25 | Isis Pharmaceuticals | Cyclobutyl oligonucleotide surrogates |
US5367066A (en) | 1984-10-16 | 1994-11-22 | Chiron Corporation | Oligonucleotides with selectably cleavable and/or abasic sites |
WO1994026764A1 (en) | 1993-05-12 | 1994-11-24 | Centre National De La Recherche Scientifique (Cnrs) | Triester phosphorothioate oligonucleotides and method of preparation |
US5371241A (en) | 1991-07-19 | 1994-12-06 | Pharmacia P-L Biochemicals Inc. | Fluorescein labelled phosphoramidites |
US5378825A (en) | 1990-07-27 | 1995-01-03 | Isis Pharmaceuticals, Inc. | Backbone modified oligonucleotide analogs |
US5386023A (en) | 1990-07-27 | 1995-01-31 | Isis Pharmaceuticals | Backbone modified oligonucleotide analogs and preparation thereof through reductive coupling |
US5391723A (en) | 1989-05-31 | 1995-02-21 | Neorx Corporation | Oligonucleotide conjugates |
US5395619A (en) | 1993-03-03 | 1995-03-07 | Liposome Technology, Inc. | Lipid-polymer conjugates and liposomes |
US5403711A (en) | 1987-11-30 | 1995-04-04 | University Of Iowa Research Foundation | Nucleic acid hybridization and amplification method for detection of specific sequences in which a complementary labeled nucleic acid probe is cleaved |
US5405938A (en) | 1989-12-20 | 1995-04-11 | Anti-Gene Development Group | Sequence-specific binding polymers for duplex nucleic acids |
US5414077A (en) | 1990-02-20 | 1995-05-09 | Gilead Sciences | Non-nucleoside linkers for convenient attachment of labels to oligonucleotides using standard synthetic methods |
US5417978A (en) | 1993-07-29 | 1995-05-23 | Board Of Regents, The University Of Texas System | Liposomal antisense methyl phosphonate oligonucleotides and methods for their preparation and use |
US5432272A (en) | 1990-10-09 | 1995-07-11 | Benner; Steven A. | Method for incorporating into a DNA or RNA oligonucleotide using nucleotides bearing heterocyclic bases |
US5434257A (en) | 1992-06-01 | 1995-07-18 | Gilead Sciences, Inc. | Binding compentent oligomers containing unsaturated 3',5' and 2',5' linkages |
US5446137A (en) | 1993-12-09 | 1995-08-29 | Syntex (U.S.A.) Inc. | Oligonucleotides containing 4'-substituted nucleotides |
US5451463A (en) | 1989-08-28 | 1995-09-19 | Clontech Laboratories, Inc. | Non-nucleoside 1,3-diol reagents for labeling synthetic oligonucleotides |
US5457187A (en) | 1993-12-08 | 1995-10-10 | Board Of Regents University Of Nebraska | Oligonucleotides containing 5-fluorouracil |
US5459255A (en) | 1990-01-11 | 1995-10-17 | Isis Pharmaceuticals, Inc. | N-2 substituted purines |
US5459127A (en) | 1990-04-19 | 1995-10-17 | Vical, Inc. | Cationic lipids for intracellular delivery of biologically active molecules |
US5462854A (en) | 1993-04-19 | 1995-10-31 | Beckman Instruments, Inc. | Inverse linkage oligonucleotides for chemical and enzymatic processes |
US5466677A (en) | 1993-03-06 | 1995-11-14 | Ciba-Geigy Corporation | Dinucleoside phosphinates and their pharmaceutical compositions |
US5466786A (en) | 1989-10-24 | 1995-11-14 | Gilead Sciences | 2'modified nucleoside and nucleotide compounds |
US5470967A (en) | 1990-04-10 | 1995-11-28 | The Dupont Merck Pharmaceutical Company | Oligonucleotide analogs with sulfamate linkages |
US5469854A (en) | 1989-12-22 | 1995-11-28 | Imarx Pharmaceutical Corp. | Methods of preparing gas-filled liposomes |
US5476925A (en) | 1993-02-01 | 1995-12-19 | Northwestern University | Oligodeoxyribonucleotides including 3'-aminonucleoside-phosphoramidate linkages and terminal 3'-amino groups |
US5484908A (en) | 1991-11-26 | 1996-01-16 | Gilead Sciences, Inc. | Oligonucleotides containing 5-propynyl pyrimidines |
US5486603A (en) | 1990-01-08 | 1996-01-23 | Gilead Sciences, Inc. | Oligonucleotide having enhanced binding affinity |
US5489677A (en) | 1990-07-27 | 1996-02-06 | Isis Pharmaceuticals, Inc. | Oligonucleoside linkages containing adjacent oxygen and nitrogen atoms |
US5491133A (en) | 1987-11-30 | 1996-02-13 | University Of Iowa Research Foundation | Methods for blocking the expression of specifically targeted genes |
US5502177A (en) | 1993-09-17 | 1996-03-26 | Gilead Sciences, Inc. | Pyrimidine derivatives for labeled binding partners |
US5508270A (en) | 1993-03-06 | 1996-04-16 | Ciba-Geigy Corporation | Nucleoside phosphinate compounds and compositions |
US5510475A (en) | 1990-11-08 | 1996-04-23 | Hybridon, Inc. | Oligonucleotide multiple reporter precursors |
US5512295A (en) | 1994-11-10 | 1996-04-30 | The Board Of Trustees Of The Leland Stanford Junior University | Synthetic liposomes for enhanced uptake and delivery |
US5512439A (en) | 1988-11-21 | 1996-04-30 | Dynal As | Oligonucleotide-linked magnetic particles and uses thereof |
US5512667A (en) | 1990-08-28 | 1996-04-30 | Reed; Michael W. | Trifunctional intermediates for preparing 3'-tailed oligonucleotides |
US5514785A (en) | 1990-05-11 | 1996-05-07 | Becton Dickinson And Company | Solid supports for nucleic acid hybridization assays |
US5519134A (en) | 1994-01-11 | 1996-05-21 | Isis Pharmaceuticals, Inc. | Pyrrolidine-containing monomers and oligomers |
US5521291A (en) | 1991-09-30 | 1996-05-28 | Boehringer Ingelheim International, Gmbh | Conjugates for introducing nucleic acid into higher eucaryotic cells |
US5525711A (en) | 1994-05-18 | 1996-06-11 | The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services | Pteridine nucleotide analogs as fluorescent DNA probes |
US5525465A (en) | 1987-10-28 | 1996-06-11 | Howard Florey Institute Of Experimental Physiology And Medicine | Oligonucleotide-polyamide conjugates and methods of production and applications of the same |
US5527528A (en) | 1989-10-20 | 1996-06-18 | Sequus Pharmaceuticals, Inc. | Solid-tumor treatment method |
US5534259A (en) | 1993-07-08 | 1996-07-09 | Liposome Technology, Inc. | Polymer compound and coated particle composition |
US5539082A (en) | 1993-04-26 | 1996-07-23 | Nielsen; Peter E. | Peptide nucleic acids |
US5541307A (en) | 1990-07-27 | 1996-07-30 | Isis Pharmaceuticals, Inc. | Backbone modified oligonucleotide analogs and solid phase synthesis thereof |
US5543152A (en) | 1994-06-20 | 1996-08-06 | Inex Pharmaceuticals Corporation | Sphingosomes for enhanced drug delivery |
US5543158A (en) | 1993-07-23 | 1996-08-06 | Massachusetts Institute Of Technology | Biodegradable injectable nanoparticles |
US5545730A (en) | 1984-10-16 | 1996-08-13 | Chiron Corporation | Multifunctional nucleic acid monomer |
US5547932A (en) | 1991-09-30 | 1996-08-20 | Boehringer Ingelheim International Gmbh | Composition for introducing nucleic acid complexes into higher eucaryotic cells |
US5552540A (en) | 1987-06-24 | 1996-09-03 | Howard Florey Institute Of Experimental Physiology And Medicine | Nucleoside derivatives |
US5556948A (en) | 1993-01-22 | 1996-09-17 | Mitsubishi Chemical Corporation | Phospholipid derivatized with PEG bifunctional linker and liposome containing it |
US5561225A (en) | 1990-09-19 | 1996-10-01 | Southern Research Institute | Polynucleotide analogs containing sulfonate and sulfonamide internucleoside linkages |
US5565552A (en) | 1992-01-21 | 1996-10-15 | Pharmacyclics, Inc. | Method of expanded porphyrin-oligonucleotide conjugate synthesis |
US5565350A (en) | 1993-12-09 | 1996-10-15 | Thomas Jefferson University | Compounds and methods for site directed mutations in eukaryotic cells |
US5567811A (en) | 1990-05-03 | 1996-10-22 | Amersham International Plc | Phosphoramidite derivatives, their preparation and the use thereof in the incorporation of reporter groups on synthetic oligonucleotides |
US5574142A (en) | 1992-12-15 | 1996-11-12 | Microprobe Corporation | Peptide linkers for improved oligonucleotide delivery |
US5576427A (en) | 1993-03-30 | 1996-11-19 | Sterling Winthrop, Inc. | Acyclic nucleoside analogs and oligonucleotide sequences containing them |
US5578718A (en) | 1990-01-11 | 1996-11-26 | Isis Pharmaceuticals, Inc. | Thiol-derivatized nucleosides |
US5580731A (en) | 1994-08-25 | 1996-12-03 | Chiron Corporation | N-4 modified pyrimidine deoxynucleotides and oligonucleotide probes synthesized therewith |
US5580575A (en) | 1989-12-22 | 1996-12-03 | Imarx Pharmaceutical Corp. | Therapeutic drug delivery systems |
US5583020A (en) | 1992-11-24 | 1996-12-10 | Ribozyme Pharmaceuticals, Inc. | Permeability enhancers for negatively charged polynucleotides |
US5585481A (en) | 1987-09-21 | 1996-12-17 | Gen-Probe Incorporated | Linking reagents for nucleotide probes |
US5587371A (en) | 1992-01-21 | 1996-12-24 | Pharmacyclics, Inc. | Texaphyrin-oligonucleotide conjugates |
US5591721A (en) | 1994-10-25 | 1997-01-07 | Hybridon, Inc. | Method of down-regulating gene expression |
US5591722A (en) | 1989-09-15 | 1997-01-07 | Southern Research Institute | 2'-deoxy-4'-thioribonucleosides and their antiviral activity |
US5594121A (en) | 1991-11-07 | 1997-01-14 | Gilead Sciences, Inc. | Enhanced triple-helix and double-helix formation with oligomers containing modified purines |
US5595756A (en) | 1993-12-22 | 1997-01-21 | Inex Pharmaceuticals Corporation | Liposomal compositions for enhanced retention of bioactive agents |
US5595726A (en) | 1992-01-21 | 1997-01-21 | Pharmacyclics, Inc. | Chromophore probe for detection of nucleic acid |
US5596091A (en) | 1994-03-18 | 1997-01-21 | The Regents Of The University Of California | Antisense oligonucleotides comprising 5-aminoalkyl pyrimidine nucleotides |
US5596086A (en) | 1990-09-20 | 1997-01-21 | Gilead Sciences, Inc. | Modified internucleoside linkages having one nitrogen and two carbon atoms |
US5597909A (en) | 1994-08-25 | 1997-01-28 | Chiron Corporation | Polynucleotide reagents containing modified deoxyribose moieties, and associated methods of synthesis and use |
US5597696A (en) | 1994-07-18 | 1997-01-28 | Becton Dickinson And Company | Covalent cyanine dye oligonucleotide conjugates |
US5599928A (en) | 1994-02-15 | 1997-02-04 | Pharmacyclics, Inc. | Texaphyrin compounds having improved functionalization |
US5602240A (en) | 1990-07-27 | 1997-02-11 | Ciba Geigy Ag. | Backbone modified oligonucleotide analogs |
US5608046A (en) | 1990-07-27 | 1997-03-04 | Isis Pharmaceuticals, Inc. | Conjugated 4'-desmethyl nucleoside analog compounds |
US5610289A (en) | 1990-07-27 | 1997-03-11 | Isis Pharmaceuticals, Inc. | Backbone modified oligonucleotide analogues |
US5610300A (en) | 1992-07-01 | 1997-03-11 | Ciba-Geigy Corporation | Carbocyclic nucleosides containing bicyclic rings, oligonucleotides therefrom, process for their preparation, their use and intermediates |
US5614617A (en) | 1990-07-27 | 1997-03-25 | Isis Pharmaceuticals, Inc. | Nuclease resistant, pyrimidine modified oligonucleotides that detect and modulate gene expression |
US5614621A (en) | 1993-07-29 | 1997-03-25 | Isis Pharmaceuticals, Inc. | Process for preparing oligonucleotides using silyl-containing diamino phosphorous reagents |
US5618704A (en) | 1990-07-27 | 1997-04-08 | Isis Pharmacueticals, Inc. | Backbone-modified oligonucleotide analogs and preparation thereof through radical coupling |
US5623070A (en) | 1990-07-27 | 1997-04-22 | Isis Pharmaceuticals, Inc. | Heteroatomic oligonucleoside linkages |
US5623065A (en) | 1990-08-13 | 1997-04-22 | Isis Pharmaceuticals, Inc. | Gapped 2' modified oligonucleotides |
US5625050A (en) | 1994-03-31 | 1997-04-29 | Amgen Inc. | Modified oligonucleotides and intermediates useful in nucleic acid therapeutics |
US5627053A (en) | 1994-03-29 | 1997-05-06 | Ribozyme Pharmaceuticals, Inc. | 2'deoxy-2'-alkylnucleotide containing nucleic acid |
US5633360A (en) | 1992-04-14 | 1997-05-27 | Gilead Sciences, Inc. | Oligonucleotide analogs capable of passive cell membrane permeation |
US5639873A (en) | 1992-02-05 | 1997-06-17 | Centre National De La Recherche Scientifique (Cnrs) | Oligothionucleotides |
US5646269A (en) | 1994-04-28 | 1997-07-08 | Gilead Sciences, Inc. | Method for oligonucleotide analog synthesis |
US5645985A (en) | 1991-11-26 | 1997-07-08 | Gilead Sciences, Inc. | Enhanced triple-helix and double-helix formation with oligomers containing modified pyrimidines |
US5646265A (en) | 1990-01-11 | 1997-07-08 | Isis Pharmceuticals, Inc. | Process for the preparation of 2'-O-alkyl purine phosphoramidites |
US5652356A (en) | 1995-08-17 | 1997-07-29 | Hybridon, Inc. | Inverted chimeric and hybrid oligonucleotides |
US5652355A (en) | 1992-07-23 | 1997-07-29 | Worcester Foundation For Experimental Biology | Hybrid oligonucleotide phosphorothioates |
US5658873A (en) | 1993-04-10 | 1997-08-19 | Degussa Aktiengesellschaft | Coated sodium percarbonate particles, a process for their production and detergent, cleaning and bleaching compositions containing them |
US5663312A (en) | 1993-03-31 | 1997-09-02 | Sanofi | Oligonucleotide dimers with amide linkages replacing phosphodiester linkages |
US5670633A (en) | 1990-01-11 | 1997-09-23 | Isis Pharmaceuticals, Inc. | Sugar modified oligonucleotides that detect and modulate gene expression |
US5677437A (en) | 1990-07-27 | 1997-10-14 | Isis Pharmaceuticals, Inc. | Heteroatomic oligonucleoside linkages |
US5677439A (en) | 1990-08-03 | 1997-10-14 | Sanofi | Oligonucleotide analogues containing phosphate diester linkage substitutes, compositions thereof, and precursor dinucleotide analogues |
US5681941A (en) | 1990-01-11 | 1997-10-28 | Isis Pharmaceuticals, Inc. | Substituted purines and oligonucleotide cross-linking |
US5688941A (en) | 1990-07-27 | 1997-11-18 | Isis Pharmaceuticals, Inc. | Methods of making conjugated 4' desmethyl nucleoside analog compounds |
US5700922A (en) | 1991-12-24 | 1997-12-23 | Isis Pharmaceuticals, Inc. | PNA-DNA-PNA chimeric macromolecules |
US5714331A (en) | 1991-05-24 | 1998-02-03 | Buchardt, Deceased; Ole | Peptide nucleic acids having enhanced binding affinity, sequence specificity and solubility |
US5719262A (en) | 1993-11-22 | 1998-02-17 | Buchardt, Deceased; Ole | Peptide nucleic acids having amino acid side chains |
US5750692A (en) | 1990-01-11 | 1998-05-12 | Isis Pharmaceuticals, Inc. | Synthesis of 3-deazapurines |
US5750669A (en) | 1990-07-02 | 1998-05-12 | Hoechst Aktiengesellschaft | Oligonucleotide analogs with terminal 3'-3' or 5'-5' internucleotide linkages |
US5760209A (en) | 1997-03-03 | 1998-06-02 | Isis Pharmaceuticals, Inc. | Protecting group for synthesizing oligonucleotide analogs |
US5792747A (en) | 1995-01-24 | 1998-08-11 | The Administrators Of The Tulane Educational Fund | Highly potent agonists of growth hormone releasing hormone |
US5792608A (en) | 1991-12-12 | 1998-08-11 | Gilead Sciences, Inc. | Nuclease stable and binding competent oligomers and methods for their use |
US5830653A (en) | 1991-11-26 | 1998-11-03 | Gilead Sciences, Inc. | Methods of using oligomers containing modified pyrimidines |
US5837852A (en) | 1993-10-14 | 1998-11-17 | Bristol-Myers Squibb Company | Capped nucleic acid oligomers that inhibit cap-dependent transcription of the influenza virus endonuclease |
US5874553A (en) | 1995-03-13 | 1999-02-23 | Hoechst Aktiengesellschaft | Phosphonomonoester nucleic acids, process for their preparation, and their use |
US5898031A (en) | 1996-06-06 | 1999-04-27 | Isis Pharmaceuticals, Inc. | Oligoribonucleotides for cleaving RNA |
WO1999032619A1 (en) | 1997-12-23 | 1999-07-01 | The Carnegie Institution Of Washington | Genetic inhibition by double-stranded rna |
US6007992A (en) | 1997-11-10 | 1999-12-28 | Gilead Sciences, Inc. | Pyrimidine derivatives for labeled binding partners |
US6020475A (en) | 1998-02-10 | 2000-02-01 | Isis Pharmeuticals, Inc. | Process for the synthesis of oligomeric compounds |
US6028183A (en) | 1997-11-07 | 2000-02-22 | Gilead Sciences, Inc. | Pyrimidine derivatives and oligonucleotides containing same |
US6043070A (en) | 1997-08-29 | 2000-03-28 | The Perkin-Elmer Corporation | Phosphoramidate-phosphodiester oligonucleotide chimera as primers |
US6048974A (en) | 1993-07-02 | 2000-04-11 | Lynx Therapeutics, Inc. | Oligonucleotide clamps having diagnostic and therapeutic applications |
US6051699A (en) | 1995-11-17 | 2000-04-18 | Isis Pharmaceuticals, Inc. | Process for the synthesis of oligomeric compounds |
US6060456A (en) | 1993-11-16 | 2000-05-09 | Genta Incorporated | Chimeric oligonucleoside compounds |
WO2000044914A1 (en) | 1999-01-28 | 2000-08-03 | Medical College Of Georgia Research Institute, Inc. | Composition and method for in vivo and in vitro attenuation of gene expression using double stranded rna |
WO2000044895A1 (en) | 1999-01-30 | 2000-08-03 | Roland Kreutzer | Method and medicament for inhibiting the expression of a defined gene |
WO2000049035A1 (en) | 1999-02-19 | 2000-08-24 | The General Hospital Corporation | Gene silencing |
US6117657A (en) | 1993-09-02 | 2000-09-12 | Ribozyme Pharmaceuticals, Inc. | Non-nucleotide containing enzymatic nucleic acid |
US6121437A (en) | 1999-03-16 | 2000-09-19 | Isis Pharmaceuticals, Inc. | Phosphate and thiophosphate protecting groups |
US6121434A (en) | 1995-01-31 | 2000-09-19 | Aventis Pharma Deutschland Gmbh | G cap-stabilized oligonucleotides |
WO2000063364A2 (en) | 1999-04-21 | 2000-10-26 | American Home Products Corporation | Methods and compositions for inhibiting the function of polynucleotide sequences |
US6147200A (en) | 1999-08-19 | 2000-11-14 | Isis Pharmaceuticals, Inc. | 2'-O-acetamido modified monomers and oligomers |
US6169177B1 (en) | 1998-11-06 | 2001-01-02 | Isis Pharmaceuticals, Inc. | Processes for the synthesis of oligomeric compounds |
WO2001029058A1 (en) | 1999-10-15 | 2001-04-26 | University Of Massachusetts | Rna interference pathway genes as tools for targeted genetic interference |
WO2001036646A1 (en) | 1999-11-19 | 2001-05-25 | Cancer Research Ventures Limited | Inhibiting gene expression with dsrna |
WO2001036641A2 (en) | 1999-11-02 | 2001-05-25 | Chiron Corporation | DOUBLE-STRANDED RNA RECEPTOR (dsRNA-R) AND METHODS RELATING THERETO |
US6287860B1 (en) | 2000-01-20 | 2001-09-11 | Isis Pharmaceuticals, Inc. | Antisense inhibition of MEKK2 expression |
WO2001075164A2 (en) | 2000-03-30 | 2001-10-11 | Whitehead Institute For Biomedical Research | Rna sequence-specific mediators of rna interference |
US6326478B1 (en) | 1998-07-08 | 2001-12-04 | Isis Pharmaceuticals, Inc. | Process for the synthesis of oligomeric compounds |
WO2002036743A2 (en) | 2000-10-30 | 2002-05-10 | Isis Pharmaceuticals, Inc. | Antisense modulation of calreticulin expression |
US6465628B1 (en) | 1999-02-04 | 2002-10-15 | Isis Pharmaceuticals, Inc. | Process for the synthesis of oligomeric compounds |
US7182202B2 (en) | 2005-05-31 | 2007-02-27 | Franz Grimme Landmaschinenfabrik Gmbh & Co. Kg | Conveying device for bulk material |
US9209196B2 (en) | 2011-11-30 | 2015-12-08 | Sharp Kabushiki Kaisha | Memory circuit, method of driving the same, nonvolatile storage device using the same, and liquid crystal display device |
US9917895B2 (en) | 2014-05-22 | 2018-03-13 | Lg Electronics Inc. | Information providing system and method thereof |
US10867398B2 (en) | 2017-11-21 | 2020-12-15 | Reliance Core Consulting LLC | Methods, systems, apparatuses and devices for facilitating motion analysis in an environment |
Family Cites Families (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20030206887A1 (en) * | 1992-05-14 | 2003-11-06 | David Morrissey | RNA interference mediated inhibition of hepatitis B virus (HBV) using short interfering nucleic acid (siNA) |
US20070026394A1 (en) * | 2000-02-11 | 2007-02-01 | Lawrence Blatt | Modulation of gene expression associated with inflammation proliferation and neurite outgrowth using nucleic acid based technologies |
-
2003
- 2003-11-04 WO PCT/US2003/035074 patent/WO2004044138A2/en not_active Application Discontinuation
- 2003-11-04 AU AU2003287505A patent/AU2003287505A1/en not_active Abandoned
- 2003-11-04 CA CA2504720A patent/CA2504720C/en not_active Expired - Fee Related
- 2003-11-04 EP EP03781746A patent/EP1560839A4/en not_active Withdrawn
Patent Citations (222)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US1329502A (en) | 1914-05-26 | 1920-02-03 | First Trust & Savings Company | Ironing-machine |
US3687808A (en) | 1969-08-14 | 1972-08-29 | Univ Leland Stanford Junior | Synthetic polynucleotides |
US4469863A (en) | 1980-11-12 | 1984-09-04 | Ts O Paul O P | Nonionic nucleic acid alkyl and aryl phosphonates and processes for manufacture and use thereof |
US4426330A (en) | 1981-07-20 | 1984-01-17 | Lipid Specialties, Inc. | Synthetic phospholipid compounds |
US4534899A (en) | 1981-07-20 | 1985-08-13 | Lipid Specialties, Inc. | Synthetic phospholipid compounds |
US5023243A (en) | 1981-10-23 | 1991-06-11 | Molecular Biosystems, Inc. | Oligonucleotide therapeutic agent and method of making same |
US4789737A (en) | 1982-08-09 | 1988-12-06 | Wakunaga Seiyaku Kabushiki Kaisha | Oligonucleotide derivatives and production thereof |
US4667025A (en) | 1982-08-09 | 1987-05-19 | Wakunaga Seiyaku Kabushiki Kaisha | Oligonucleotide derivatives |
US4835263A (en) | 1983-01-27 | 1989-05-30 | Centre National De La Recherche Scientifique | Novel compounds containing an oligonucleotide sequence bonded to an intercalating agent, a process for their synthesis and their use |
US4605735A (en) | 1983-02-14 | 1986-08-12 | Wakunaga Seiyaku Kabushiki Kaisha | Oligonucleotide derivatives |
US4948882A (en) | 1983-02-22 | 1990-08-14 | Syngene, Inc. | Single-stranded labelled oligonucleotides, reactive monomers and methods of synthesis |
US5541313A (en) | 1983-02-22 | 1996-07-30 | Molecular Biosystems, Inc. | Single-stranded labelled oligonucleotides of preselected sequence |
US4824941A (en) | 1983-03-10 | 1989-04-25 | Julian Gordon | Specific antibody to the native form of 2'5'-oligonucleotides, the method of preparation and the use as reagents in immunoassays or for binding 2'5'-oligonucleotides in biological systems |
US4587044A (en) | 1983-09-01 | 1986-05-06 | The Johns Hopkins University | Linkage of proteins to nucleic acids |
US5118802A (en) | 1983-12-20 | 1992-06-02 | California Institute Of Technology | DNA-reporter conjugates linked via the 2' or 5'-primary amino group of the 5'-terminal nucleoside |
US5118800A (en) | 1983-12-20 | 1992-06-02 | California Institute Of Technology | Oligonucleotides possessing a primary amino group in the terminal nucleotide |
US4981957A (en) | 1984-07-19 | 1991-01-01 | Centre National De La Recherche Scientifique | Oligonucleotides with modified phosphate and modified carbohydrate moieties at the respective chain termini |
US5545730A (en) | 1984-10-16 | 1996-08-13 | Chiron Corporation | Multifunctional nucleic acid monomer |
US5367066A (en) | 1984-10-16 | 1994-11-22 | Chiron Corporation | Oligonucleotides with selectably cleavable and/or abasic sites |
US5552538A (en) | 1984-10-16 | 1996-09-03 | Chiron Corporation | Oligonucleotides with cleavable sites |
US5578717A (en) | 1984-10-16 | 1996-11-26 | Chiron Corporation | Nucleotides for introducing selectably cleavable and/or abasic sites into oligonucleotides |
US5258506A (en) | 1984-10-16 | 1993-11-02 | Chiron Corporation | Photolabile reagents for incorporation into oligonucleotide chains |
US4828979A (en) | 1984-11-08 | 1989-05-09 | Life Technologies, Inc. | Nucleotide analogs for nucleic acid labeling and detection |
US4845205A (en) | 1985-01-08 | 1989-07-04 | Institut Pasteur | 2,N6 -disubstituted and 2,N6 -trisubstituted adenosine-3'-phosphoramidites |
US5034506A (en) | 1985-03-15 | 1991-07-23 | Anti-Gene Development Group | Uncharged morpholino-based polymers having achiral intersubunit linkages |
US5185444A (en) | 1985-03-15 | 1993-02-09 | Anti-Gene Deveopment Group | Uncharged morpolino-based polymers having phosphorous containing chiral intersubunit linkages |
US5235033A (en) | 1985-03-15 | 1993-08-10 | Anti-Gene Development Group | Alpha-morpholino ribonucleoside derivatives and polymers thereof |
US4762779A (en) | 1985-06-13 | 1988-08-09 | Amgen Inc. | Compositions and methods for functionalizing nucleic acids |
US5317098A (en) | 1986-03-17 | 1994-05-31 | Hiroaki Shizuya | Non-radioisotope tagging of fragments |
US4876335A (en) | 1986-06-30 | 1989-10-24 | Wakunaga Seiyaku Kabushiki Kaisha | Poly-labelled oligonucleotide derivative |
US5013830A (en) | 1986-09-08 | 1991-05-07 | Ajinomoto Co., Inc. | Compounds for the cleavage at a specific position of RNA, oligomers employed for the formation of said compounds, and starting materials for the synthesis of said oligomers |
US4904582A (en) | 1987-06-11 | 1990-02-27 | Synthetic Genetics | Novel amphiphilic nucleic acid conjugates |
US5552540A (en) | 1987-06-24 | 1996-09-03 | Howard Florey Institute Of Experimental Physiology And Medicine | Nucleoside derivatives |
US5585481A (en) | 1987-09-21 | 1996-12-17 | Gen-Probe Incorporated | Linking reagents for nucleotide probes |
US5525465A (en) | 1987-10-28 | 1996-06-11 | Howard Florey Institute Of Experimental Physiology And Medicine | Oligonucleotide-polyamide conjugates and methods of production and applications of the same |
US5112963A (en) | 1987-11-12 | 1992-05-12 | Max-Planck-Gesellschaft Zur Foerderung Der Wissenschaften E.V. | Modified oligonucleotides |
US5403711A (en) | 1987-11-30 | 1995-04-04 | University Of Iowa Research Foundation | Nucleic acid hybridization and amplification method for detection of specific sequences in which a complementary labeled nucleic acid probe is cleaved |
US5491133A (en) | 1987-11-30 | 1996-02-13 | University Of Iowa Research Foundation | Methods for blocking the expression of specifically targeted genes |
US5082830A (en) | 1988-02-26 | 1992-01-21 | Enzo Biochem, Inc. | End labeled nucleotide probe |
US5109124A (en) | 1988-06-01 | 1992-04-28 | Biogen, Inc. | Nucleic acid probe linked to a label having a terminal cysteine |
US5216141A (en) | 1988-06-06 | 1993-06-01 | Benner Steven A | Oligonucleotide analogs containing sulfur linkages |
US5175273A (en) | 1988-07-01 | 1992-12-29 | Genentech, Inc. | Nucleic acid intercalating agents |
US5262536A (en) | 1988-09-15 | 1993-11-16 | E. I. Du Pont De Nemours And Company | Reagents for the preparation of 5'-tagged oligonucleotides |
US5512439A (en) | 1988-11-21 | 1996-04-30 | Dynal As | Oligonucleotide-linked magnetic particles and uses thereof |
US5599923A (en) | 1989-03-06 | 1997-02-04 | Board Of Regents, University Of Tx | Texaphyrin metal complexes having improved functionalization |
US5354844A (en) | 1989-03-16 | 1994-10-11 | Boehringer Ingelheim International Gmbh | Protein-polycation conjugates |
US5108921A (en) | 1989-04-03 | 1992-04-28 | Purdue Research Foundation | Method for enhanced transmembrane transport of exogenous molecules |
US5416016A (en) | 1989-04-03 | 1995-05-16 | Purdue Research Foundation | Method for enhancing transmembrane transport of exogenous molecules |
US5391723A (en) | 1989-05-31 | 1995-02-21 | Neorx Corporation | Oligonucleotide conjugates |
US5256775A (en) | 1989-06-05 | 1993-10-26 | Gilead Sciences, Inc. | Exonuclease-resistant oligonucleotides |
US4958013A (en) | 1989-06-06 | 1990-09-18 | Northwestern University | Cholesteryl modified oligonucleotides |
US5416203A (en) | 1989-06-06 | 1995-05-16 | Northwestern University | Steroid modified oligonucleotides |
US5227170A (en) | 1989-06-22 | 1993-07-13 | Vestar, Inc. | Encapsulation process |
US5451463A (en) | 1989-08-28 | 1995-09-19 | Clontech Laboratories, Inc. | Non-nucleoside 1,3-diol reagents for labeling synthetic oligonucleotides |
US5134066A (en) | 1989-08-29 | 1992-07-28 | Monsanto Company | Improved probes using nucleosides containing 3-dezauracil analogs |
US5254469A (en) | 1989-09-12 | 1993-10-19 | Eastman Kodak Company | Oligonucleotide-enzyme conjugate that can be used as a probe in hybridization assays and polymerase chain reaction procedures |
US5591722A (en) | 1989-09-15 | 1997-01-07 | Southern Research Institute | 2'-deoxy-4'-thioribonucleosides and their antiviral activity |
US5527528A (en) | 1989-10-20 | 1996-06-18 | Sequus Pharmaceuticals, Inc. | Solid-tumor treatment method |
US5356633A (en) | 1989-10-20 | 1994-10-18 | Liposome Technology, Inc. | Method of treatment of inflamed tissues |
US5013556A (en) | 1989-10-20 | 1991-05-07 | Liposome Technology, Inc. | Liposomes with enhanced circulation time |
US5213804A (en) | 1989-10-20 | 1993-05-25 | Liposome Technology, Inc. | Solid tumor treatment method and composition |
US5466786A (en) | 1989-10-24 | 1995-11-14 | Gilead Sciences | 2'modified nucleoside and nucleotide compounds |
US5264562A (en) | 1989-10-24 | 1993-11-23 | Gilead Sciences, Inc. | Oligonucleotide analogs with novel linkages |
US5466786B1 (en) | 1989-10-24 | 1998-04-07 | Gilead Sciences | 2' Modified nucleoside and nucleotide compounds |
US5264564A (en) | 1989-10-24 | 1993-11-23 | Gilead Sciences | Oligonucleotide analogs with novel linkages |
US5292873A (en) | 1989-11-29 | 1994-03-08 | The Research Foundation Of State University Of New York | Nucleic acids labeled with naphthoquinone probe |
US5177198A (en) | 1989-11-30 | 1993-01-05 | University Of N.C. At Chapel Hill | Process for preparing oligoribonucleoside and oligodeoxyribonucleoside boranophosphates |
US5130302A (en) | 1989-12-20 | 1992-07-14 | Boron Bilogicals, Inc. | Boronated nucleoside, nucleotide and oligonucleotide compounds, compositions and methods for using same |
US5166315A (en) | 1989-12-20 | 1992-11-24 | Anti-Gene Development Group | Sequence-specific binding polymers for duplex nucleic acids |
US5405938A (en) | 1989-12-20 | 1995-04-11 | Anti-Gene Development Group | Sequence-specific binding polymers for duplex nucleic acids |
US5580575A (en) | 1989-12-22 | 1996-12-03 | Imarx Pharmaceutical Corp. | Therapeutic drug delivery systems |
US5469854A (en) | 1989-12-22 | 1995-11-28 | Imarx Pharmaceutical Corp. | Methods of preparing gas-filled liposomes |
US5486603A (en) | 1990-01-08 | 1996-01-23 | Gilead Sciences, Inc. | Oligonucleotide having enhanced binding affinity |
US5670633A (en) | 1990-01-11 | 1997-09-23 | Isis Pharmaceuticals, Inc. | Sugar modified oligonucleotides that detect and modulate gene expression |
US5681941A (en) | 1990-01-11 | 1997-10-28 | Isis Pharmaceuticals, Inc. | Substituted purines and oligonucleotide cross-linking |
US5459255A (en) | 1990-01-11 | 1995-10-17 | Isis Pharmaceuticals, Inc. | N-2 substituted purines |
US5750692A (en) | 1990-01-11 | 1998-05-12 | Isis Pharmaceuticals, Inc. | Synthesis of 3-deazapurines |
US5578718A (en) | 1990-01-11 | 1996-11-26 | Isis Pharmaceuticals, Inc. | Thiol-derivatized nucleosides |
US5646265A (en) | 1990-01-11 | 1997-07-08 | Isis Pharmceuticals, Inc. | Process for the preparation of 2'-O-alkyl purine phosphoramidites |
US5587469A (en) | 1990-01-11 | 1996-12-24 | Isis Pharmaceuticals, Inc. | Oligonucleotides containing N-2 substituted purines |
US5366878A (en) | 1990-02-15 | 1994-11-22 | The Worcester Foundation For Experimental Biology | Method of site-specific alteration of RNA and production of encoded polypeptides |
US5220007A (en) | 1990-02-15 | 1993-06-15 | The Worcester Foundation For Experimental Biology | Method of site-specific alteration of RNA and production of encoded polypeptides |
US5149797A (en) | 1990-02-15 | 1992-09-22 | The Worcester Foundation For Experimental Biology | Method of site-specific alteration of rna and production of encoded polypeptides |
US5214136A (en) | 1990-02-20 | 1993-05-25 | Gilead Sciences, Inc. | Anthraquinone-derivatives oligonucleotides |
US5414077A (en) | 1990-02-20 | 1995-05-09 | Gilead Sciences | Non-nucleoside linkers for convenient attachment of labels to oligonucleotides using standard synthetic methods |
US5470967A (en) | 1990-04-10 | 1995-11-28 | The Dupont Merck Pharmaceutical Company | Oligonucleotide analogs with sulfamate linkages |
US5459127A (en) | 1990-04-19 | 1995-10-17 | Vical, Inc. | Cationic lipids for intracellular delivery of biologically active molecules |
US5567811A (en) | 1990-05-03 | 1996-10-22 | Amersham International Plc | Phosphoramidite derivatives, their preparation and the use thereof in the incorporation of reporter groups on synthetic oligonucleotides |
US5514785A (en) | 1990-05-11 | 1996-05-07 | Becton Dickinson And Company | Solid supports for nucleic acid hybridization assays |
US5750669A (en) | 1990-07-02 | 1998-05-12 | Hoechst Aktiengesellschaft | Oligonucleotide analogs with terminal 3'-3' or 5'-5' internucleotide linkages |
US5610289A (en) | 1990-07-27 | 1997-03-11 | Isis Pharmaceuticals, Inc. | Backbone modified oligonucleotide analogues |
US5614617A (en) | 1990-07-27 | 1997-03-25 | Isis Pharmaceuticals, Inc. | Nuclease resistant, pyrimidine modified oligonucleotides that detect and modulate gene expression |
US5608046A (en) | 1990-07-27 | 1997-03-04 | Isis Pharmaceuticals, Inc. | Conjugated 4'-desmethyl nucleoside analog compounds |
US5602240A (en) | 1990-07-27 | 1997-02-11 | Ciba Geigy Ag. | Backbone modified oligonucleotide analogs |
US5489677A (en) | 1990-07-27 | 1996-02-06 | Isis Pharmaceuticals, Inc. | Oligonucleoside linkages containing adjacent oxygen and nitrogen atoms |
US5688941A (en) | 1990-07-27 | 1997-11-18 | Isis Pharmaceuticals, Inc. | Methods of making conjugated 4' desmethyl nucleoside analog compounds |
US5218105A (en) | 1990-07-27 | 1993-06-08 | Isis Pharmaceuticals | Polyamine conjugated oligonucleotides |
US5677437A (en) | 1990-07-27 | 1997-10-14 | Isis Pharmaceuticals, Inc. | Heteroatomic oligonucleoside linkages |
US5378825A (en) | 1990-07-27 | 1995-01-03 | Isis Pharmaceuticals, Inc. | Backbone modified oligonucleotide analogs |
US5541307A (en) | 1990-07-27 | 1996-07-30 | Isis Pharmaceuticals, Inc. | Backbone modified oligonucleotide analogs and solid phase synthesis thereof |
US5623070A (en) | 1990-07-27 | 1997-04-22 | Isis Pharmaceuticals, Inc. | Heteroatomic oligonucleoside linkages |
US5618704A (en) | 1990-07-27 | 1997-04-08 | Isis Pharmacueticals, Inc. | Backbone-modified oligonucleotide analogs and preparation thereof through radical coupling |
US5138045A (en) | 1990-07-27 | 1992-08-11 | Isis Pharmaceuticals | Polyamine conjugated oligonucleotides |
US5386023A (en) | 1990-07-27 | 1995-01-31 | Isis Pharmaceuticals | Backbone modified oligonucleotide analogs and preparation thereof through reductive coupling |
US5567810A (en) | 1990-08-03 | 1996-10-22 | Sterling Drug, Inc. | Nuclease resistant compounds |
US5677439A (en) | 1990-08-03 | 1997-10-14 | Sanofi | Oligonucleotide analogues containing phosphate diester linkage substitutes, compositions thereof, and precursor dinucleotide analogues |
US5245022A (en) | 1990-08-03 | 1993-09-14 | Sterling Drug, Inc. | Exonuclease resistant terminally substituted oligonucleotides |
US5623065A (en) | 1990-08-13 | 1997-04-22 | Isis Pharmaceuticals, Inc. | Gapped 2' modified oligonucleotides |
US5223618A (en) | 1990-08-13 | 1993-06-29 | Isis Pharmaceuticals, Inc. | 4'-desmethyl nucleoside analog compounds |
US5512667A (en) | 1990-08-28 | 1996-04-30 | Reed; Michael W. | Trifunctional intermediates for preparing 3'-tailed oligonucleotides |
US5214134A (en) | 1990-09-12 | 1993-05-25 | Sterling Winthrop Inc. | Process of linking nucleosides with a siloxane bridge |
US5561225A (en) | 1990-09-19 | 1996-10-01 | Southern Research Institute | Polynucleotide analogs containing sulfonate and sulfonamide internucleoside linkages |
US5596086A (en) | 1990-09-20 | 1997-01-21 | Gilead Sciences, Inc. | Modified internucleoside linkages having one nitrogen and two carbon atoms |
US5432272A (en) | 1990-10-09 | 1995-07-11 | Benner; Steven A. | Method for incorporating into a DNA or RNA oligonucleotide using nucleotides bearing heterocyclic bases |
US5510475A (en) | 1990-11-08 | 1996-04-23 | Hybridon, Inc. | Oligonucleotide multiple reporter precursors |
US5264221A (en) | 1991-05-23 | 1993-11-23 | Mitsubishi Kasei Corporation | Drug-containing protein-bonded liposome |
US5714331A (en) | 1991-05-24 | 1998-02-03 | Buchardt, Deceased; Ole | Peptide nucleic acids having enhanced binding affinity, sequence specificity and solubility |
US5371241A (en) | 1991-07-19 | 1994-12-06 | Pharmacia P-L Biochemicals Inc. | Fluorescein labelled phosphoramidites |
US5547932A (en) | 1991-09-30 | 1996-08-20 | Boehringer Ingelheim International Gmbh | Composition for introducing nucleic acid complexes into higher eucaryotic cells |
US5521291A (en) | 1991-09-30 | 1996-05-28 | Boehringer Ingelheim International, Gmbh | Conjugates for introducing nucleic acid into higher eucaryotic cells |
US5393878A (en) | 1991-10-17 | 1995-02-28 | Ciba-Geigy Corporation | Bicyclic nucleosides, oligonucleotides, process for their preparation and intermediates |
US5319080A (en) | 1991-10-17 | 1994-06-07 | Ciba-Geigy Corporation | Bicyclic nucleosides, oligonucleotides, process for their preparation and intermediates |
US5594121A (en) | 1991-11-07 | 1997-01-14 | Gilead Sciences, Inc. | Enhanced triple-helix and double-helix formation with oligomers containing modified purines |
US5645985A (en) | 1991-11-26 | 1997-07-08 | Gilead Sciences, Inc. | Enhanced triple-helix and double-helix formation with oligomers containing modified pyrimidines |
US5830653A (en) | 1991-11-26 | 1998-11-03 | Gilead Sciences, Inc. | Methods of using oligomers containing modified pyrimidines |
US5484908A (en) | 1991-11-26 | 1996-01-16 | Gilead Sciences, Inc. | Oligonucleotides containing 5-propynyl pyrimidines |
US5792608A (en) | 1991-12-12 | 1998-08-11 | Gilead Sciences, Inc. | Nuclease stable and binding competent oligomers and methods for their use |
US5359044A (en) | 1991-12-13 | 1994-10-25 | Isis Pharmaceuticals | Cyclobutyl oligonucleotide surrogates |
US5700922A (en) | 1991-12-24 | 1997-12-23 | Isis Pharmaceuticals, Inc. | PNA-DNA-PNA chimeric macromolecules |
US5587371A (en) | 1992-01-21 | 1996-12-24 | Pharmacyclics, Inc. | Texaphyrin-oligonucleotide conjugates |
US5565552A (en) | 1992-01-21 | 1996-10-15 | Pharmacyclics, Inc. | Method of expanded porphyrin-oligonucleotide conjugate synthesis |
US5595726A (en) | 1992-01-21 | 1997-01-21 | Pharmacyclics, Inc. | Chromophore probe for detection of nucleic acid |
US5639873A (en) | 1992-02-05 | 1997-06-17 | Centre National De La Recherche Scientifique (Cnrs) | Oligothionucleotides |
US5633360A (en) | 1992-04-14 | 1997-05-27 | Gilead Sciences, Inc. | Oligonucleotide analogs capable of passive cell membrane permeation |
WO1993024510A1 (en) | 1992-05-25 | 1993-12-09 | Centre National De La Recherche Scientifique (Cnrs) | Phosphotriester-type biologically active compounds |
US5434257A (en) | 1992-06-01 | 1995-07-18 | Gilead Sciences, Inc. | Binding compentent oligomers containing unsaturated 3',5' and 2',5' linkages |
US5610300A (en) | 1992-07-01 | 1997-03-11 | Ciba-Geigy Corporation | Carbocyclic nucleosides containing bicyclic rings, oligonucleotides therefrom, process for their preparation, their use and intermediates |
US5700920A (en) | 1992-07-01 | 1997-12-23 | Novartis Corporation | Carbocyclic nucleosides containing bicyclic rings, oligonucleotides therefrom, process for their preparation, their use and intermediates |
US5272250A (en) | 1992-07-10 | 1993-12-21 | Spielvogel Bernard F | Boronated phosphoramidate compounds |
US5652355A (en) | 1992-07-23 | 1997-07-29 | Worcester Foundation For Experimental Biology | Hybrid oligonucleotide phosphorothioates |
WO1994002499A1 (en) | 1992-07-27 | 1994-02-03 | Hybridon, Inc. | Oligonucleotide alkylphosphonothioates |
US5583020A (en) | 1992-11-24 | 1996-12-10 | Ribozyme Pharmaceuticals, Inc. | Permeability enhancers for negatively charged polynucleotides |
US5574142A (en) | 1992-12-15 | 1996-11-12 | Microprobe Corporation | Peptide linkers for improved oligonucleotide delivery |
US5556948A (en) | 1993-01-22 | 1996-09-17 | Mitsubishi Chemical Corporation | Phospholipid derivatized with PEG bifunctional linker and liposome containing it |
WO1994017093A1 (en) | 1993-01-25 | 1994-08-04 | Hybridon, Inc. | Oligonucleotide alkylphosphonates and alkylphosphonothioates |
US5476925A (en) | 1993-02-01 | 1995-12-19 | Northwestern University | Oligodeoxyribonucleotides including 3'-aminonucleoside-phosphoramidate linkages and terminal 3'-amino groups |
US5395619A (en) | 1993-03-03 | 1995-03-07 | Liposome Technology, Inc. | Lipid-polymer conjugates and liposomes |
US5508270A (en) | 1993-03-06 | 1996-04-16 | Ciba-Geigy Corporation | Nucleoside phosphinate compounds and compositions |
US5466677A (en) | 1993-03-06 | 1995-11-14 | Ciba-Geigy Corporation | Dinucleoside phosphinates and their pharmaceutical compositions |
US5576427A (en) | 1993-03-30 | 1996-11-19 | Sterling Winthrop, Inc. | Acyclic nucleoside analogs and oligonucleotide sequences containing them |
US5663312A (en) | 1993-03-31 | 1997-09-02 | Sanofi | Oligonucleotide dimers with amide linkages replacing phosphodiester linkages |
US5658873A (en) | 1993-04-10 | 1997-08-19 | Degussa Aktiengesellschaft | Coated sodium percarbonate particles, a process for their production and detergent, cleaning and bleaching compositions containing them |
US5462854A (en) | 1993-04-19 | 1995-10-31 | Beckman Instruments, Inc. | Inverse linkage oligonucleotides for chemical and enzymatic processes |
US5539082A (en) | 1993-04-26 | 1996-07-23 | Nielsen; Peter E. | Peptide nucleic acids |
US5770713A (en) | 1993-05-12 | 1998-06-23 | Centre National De La Recherche Scientifique | Phosphorothioate triester oligonucleotides and method of preparation |
WO1994026764A1 (en) | 1993-05-12 | 1994-11-24 | Centre National De La Recherche Scientifique (Cnrs) | Triester phosphorothioate oligonucleotides and method of preparation |
US6048974A (en) | 1993-07-02 | 2000-04-11 | Lynx Therapeutics, Inc. | Oligonucleotide clamps having diagnostic and therapeutic applications |
US5534259A (en) | 1993-07-08 | 1996-07-09 | Liposome Technology, Inc. | Polymer compound and coated particle composition |
US5543158A (en) | 1993-07-23 | 1996-08-06 | Massachusetts Institute Of Technology | Biodegradable injectable nanoparticles |
US5417978A (en) | 1993-07-29 | 1995-05-23 | Board Of Regents, The University Of Texas System | Liposomal antisense methyl phosphonate oligonucleotides and methods for their preparation and use |
US5614621A (en) | 1993-07-29 | 1997-03-25 | Isis Pharmaceuticals, Inc. | Process for preparing oligonucleotides using silyl-containing diamino phosphorous reagents |
US6117657A (en) | 1993-09-02 | 2000-09-12 | Ribozyme Pharmaceuticals, Inc. | Non-nucleotide containing enzymatic nucleic acid |
US5763588A (en) | 1993-09-17 | 1998-06-09 | Gilead Sciences, Inc. | Pyrimidine derivatives for labeled binding partners |
US5502177A (en) | 1993-09-17 | 1996-03-26 | Gilead Sciences, Inc. | Pyrimidine derivatives for labeled binding partners |
US6005096A (en) | 1993-09-17 | 1999-12-21 | Gilead Sciences, Inc. | Pyrimidine derivatives |
US5837852A (en) | 1993-10-14 | 1998-11-17 | Bristol-Myers Squibb Company | Capped nucleic acid oligomers that inhibit cap-dependent transcription of the influenza virus endonuclease |
US6262036B1 (en) | 1993-11-16 | 2001-07-17 | Genta Incorporated | Method for inhibiting RNA translation using chimeric oligonucleoside compounds |
US6060456A (en) | 1993-11-16 | 2000-05-09 | Genta Incorporated | Chimeric oligonucleoside compounds |
US5719262A (en) | 1993-11-22 | 1998-02-17 | Buchardt, Deceased; Ole | Peptide nucleic acids having amino acid side chains |
US5457187A (en) | 1993-12-08 | 1995-10-10 | Board Of Regents University Of Nebraska | Oligonucleotides containing 5-fluorouracil |
US5446137B1 (en) | 1993-12-09 | 1998-10-06 | Behringwerke Ag | Oligonucleotides containing 4'-substituted nucleotides |
US5565350A (en) | 1993-12-09 | 1996-10-15 | Thomas Jefferson University | Compounds and methods for site directed mutations in eukaryotic cells |
US5446137A (en) | 1993-12-09 | 1995-08-29 | Syntex (U.S.A.) Inc. | Oligonucleotides containing 4'-substituted nucleotides |
US5595756A (en) | 1993-12-22 | 1997-01-21 | Inex Pharmaceuticals Corporation | Liposomal compositions for enhanced retention of bioactive agents |
US5519134A (en) | 1994-01-11 | 1996-05-21 | Isis Pharmaceuticals, Inc. | Pyrrolidine-containing monomers and oligomers |
US5599928A (en) | 1994-02-15 | 1997-02-04 | Pharmacyclics, Inc. | Texaphyrin compounds having improved functionalization |
US5596091A (en) | 1994-03-18 | 1997-01-21 | The Regents Of The University Of California | Antisense oligonucleotides comprising 5-aminoalkyl pyrimidine nucleotides |
US5627053A (en) | 1994-03-29 | 1997-05-06 | Ribozyme Pharmaceuticals, Inc. | 2'deoxy-2'-alkylnucleotide containing nucleic acid |
US5625050A (en) | 1994-03-31 | 1997-04-29 | Amgen Inc. | Modified oligonucleotides and intermediates useful in nucleic acid therapeutics |
US5646269A (en) | 1994-04-28 | 1997-07-08 | Gilead Sciences, Inc. | Method for oligonucleotide analog synthesis |
US5525711A (en) | 1994-05-18 | 1996-06-11 | The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services | Pteridine nucleotide analogs as fluorescent DNA probes |
US5543152A (en) | 1994-06-20 | 1996-08-06 | Inex Pharmaceuticals Corporation | Sphingosomes for enhanced drug delivery |
US5597696A (en) | 1994-07-18 | 1997-01-28 | Becton Dickinson And Company | Covalent cyanine dye oligonucleotide conjugates |
US5597909A (en) | 1994-08-25 | 1997-01-28 | Chiron Corporation | Polynucleotide reagents containing modified deoxyribose moieties, and associated methods of synthesis and use |
US5591584A (en) | 1994-08-25 | 1997-01-07 | Chiron Corporation | N-4 modified pyrimidine deoxynucleotides and oligonucleotide probes synthesized therewith |
US5580731A (en) | 1994-08-25 | 1996-12-03 | Chiron Corporation | N-4 modified pyrimidine deoxynucleotides and oligonucleotide probes synthesized therewith |
US5591721A (en) | 1994-10-25 | 1997-01-07 | Hybridon, Inc. | Method of down-regulating gene expression |
US5512295A (en) | 1994-11-10 | 1996-04-30 | The Board Of Trustees Of The Leland Stanford Junior University | Synthetic liposomes for enhanced uptake and delivery |
US5792747A (en) | 1995-01-24 | 1998-08-11 | The Administrators Of The Tulane Educational Fund | Highly potent agonists of growth hormone releasing hormone |
US6121434A (en) | 1995-01-31 | 2000-09-19 | Aventis Pharma Deutschland Gmbh | G cap-stabilized oligonucleotides |
US5874553A (en) | 1995-03-13 | 1999-02-23 | Hoechst Aktiengesellschaft | Phosphonomonoester nucleic acids, process for their preparation, and their use |
US6127346A (en) | 1995-03-13 | 2000-10-03 | Hoechst Aktiengesellschaft | Phosphonomonoester nucleic acids process for their preparation and their use |
US5652356A (en) | 1995-08-17 | 1997-07-29 | Hybridon, Inc. | Inverted chimeric and hybrid oligonucleotides |
US6051699A (en) | 1995-11-17 | 2000-04-18 | Isis Pharmaceuticals, Inc. | Process for the synthesis of oligomeric compounds |
US5898031A (en) | 1996-06-06 | 1999-04-27 | Isis Pharmaceuticals, Inc. | Oligoribonucleotides for cleaving RNA |
US6107094A (en) | 1996-06-06 | 2000-08-22 | Isis Pharmaceuticals, Inc. | Oligoribonucleotides and ribonucleases for cleaving RNA |
US5760209A (en) | 1997-03-03 | 1998-06-02 | Isis Pharmaceuticals, Inc. | Protecting group for synthesizing oligonucleotide analogs |
US6043070A (en) | 1997-08-29 | 2000-03-28 | The Perkin-Elmer Corporation | Phosphoramidate-phosphodiester oligonucleotide chimera as primers |
US6028183A (en) | 1997-11-07 | 2000-02-22 | Gilead Sciences, Inc. | Pyrimidine derivatives and oligonucleotides containing same |
US6007992A (en) | 1997-11-10 | 1999-12-28 | Gilead Sciences, Inc. | Pyrimidine derivatives for labeled binding partners |
WO1999032619A1 (en) | 1997-12-23 | 1999-07-01 | The Carnegie Institution Of Washington | Genetic inhibition by double-stranded rna |
US6020475A (en) | 1998-02-10 | 2000-02-01 | Isis Pharmeuticals, Inc. | Process for the synthesis of oligomeric compounds |
US6326478B1 (en) | 1998-07-08 | 2001-12-04 | Isis Pharmaceuticals, Inc. | Process for the synthesis of oligomeric compounds |
US6169177B1 (en) | 1998-11-06 | 2001-01-02 | Isis Pharmaceuticals, Inc. | Processes for the synthesis of oligomeric compounds |
WO2000044914A1 (en) | 1999-01-28 | 2000-08-03 | Medical College Of Georgia Research Institute, Inc. | Composition and method for in vivo and in vitro attenuation of gene expression using double stranded rna |
WO2000044895A1 (en) | 1999-01-30 | 2000-08-03 | Roland Kreutzer | Method and medicament for inhibiting the expression of a defined gene |
US6465628B1 (en) | 1999-02-04 | 2002-10-15 | Isis Pharmaceuticals, Inc. | Process for the synthesis of oligomeric compounds |
WO2000049035A1 (en) | 1999-02-19 | 2000-08-24 | The General Hospital Corporation | Gene silencing |
US6121437A (en) | 1999-03-16 | 2000-09-19 | Isis Pharmaceuticals, Inc. | Phosphate and thiophosphate protecting groups |
WO2000063364A2 (en) | 1999-04-21 | 2000-10-26 | American Home Products Corporation | Methods and compositions for inhibiting the function of polynucleotide sequences |
US6147200A (en) | 1999-08-19 | 2000-11-14 | Isis Pharmaceuticals, Inc. | 2'-O-acetamido modified monomers and oligomers |
WO2001029058A1 (en) | 1999-10-15 | 2001-04-26 | University Of Massachusetts | Rna interference pathway genes as tools for targeted genetic interference |
WO2001036641A2 (en) | 1999-11-02 | 2001-05-25 | Chiron Corporation | DOUBLE-STRANDED RNA RECEPTOR (dsRNA-R) AND METHODS RELATING THERETO |
WO2001036646A1 (en) | 1999-11-19 | 2001-05-25 | Cancer Research Ventures Limited | Inhibiting gene expression with dsrna |
US6287860B1 (en) | 2000-01-20 | 2001-09-11 | Isis Pharmaceuticals, Inc. | Antisense inhibition of MEKK2 expression |
WO2001075164A2 (en) | 2000-03-30 | 2001-10-11 | Whitehead Institute For Biomedical Research | Rna sequence-specific mediators of rna interference |
WO2002036743A2 (en) | 2000-10-30 | 2002-05-10 | Isis Pharmaceuticals, Inc. | Antisense modulation of calreticulin expression |
US6426220B1 (en) | 2000-10-30 | 2002-07-30 | Isis Pharmaceuticals, Inc. | Antisense modulation of calreticulin expression |
US7182202B2 (en) | 2005-05-31 | 2007-02-27 | Franz Grimme Landmaschinenfabrik Gmbh & Co. Kg | Conveying device for bulk material |
US9209196B2 (en) | 2011-11-30 | 2015-12-08 | Sharp Kabushiki Kaisha | Memory circuit, method of driving the same, nonvolatile storage device using the same, and liquid crystal display device |
US9917895B2 (en) | 2014-05-22 | 2018-03-13 | Lg Electronics Inc. | Information providing system and method thereof |
US10867398B2 (en) | 2017-11-21 | 2020-12-15 | Reliance Core Consulting LLC | Methods, systems, apparatuses and devices for facilitating motion analysis in an environment |
Non-Patent Citations (44)
Title |
---|
"Antisense Research and Applications", 1993, CRC PRESS, pages: 276 - 278 |
"The Concise Encyclopedia Of Polymer Science And Engineering", 1990, JOHN WILEY & SONS, pages: 858 - 859 |
AMARZGUIOUI ET AL., NUCLEIC ACIDS RESEARCH, vol. 31, 2003, pages 589 - 595 |
BEAUCAGE, S. L.; CARUTHERS, M. H., TETRAHEDRON LETT., vol. 22, 1981, pages 1859 - 1862 |
BOUTLA ET AL., CURR. BIOL., vol. 11, 2001, pages 1776 - 1780 |
CARMELL ET AL., GENES AND DEVELOPMENT, vol. 16, 2002, pages 2733 - 2742 |
CROOKE ET AL., J. PHARMACOL. EXP. THER., vol. 277, 1996, pages 923 - 937 |
CZAUDERNA ET AL., NUCLEIC ACIDS RESEARCH, vol. 31, 2003, pages 2705 - 2716 |
DAHL, B. J. ET AL., ACTA CHEM. SCAND, vol. 44, 1990, pages 639 - 641 |
ENGLISCH ET AL., ANGEWANDTE CHEMIE, INTERNATIONAL EDITION, vol. 30, 1991, pages 613 |
FLANAGAN ET AL., NAT. BIOTECHNOL., vol. 17, no. 1, 1999, pages 48 - 52 |
FLANAGAN, W. M.; WOLF, J.J.; OLSON, P.; GRANT, D.; LIN, K.-Y.; WAGNER, R. W.; MATTEUCCI, M., PROC. NATL. ACAD. SCI. USA, vol. 96, 1999, pages 3513 - 3518 |
GRIFFIN, B. E. ET AL., TETRAHEDRON, vol. 23, 1967, pages 2301 - 2313 |
GRIFFIN, B. E. ET AL., TETRAHEDRON, vol. 23, 1967, pages 2315 - 2331 |
KABANOV ET AL., FEBS LETT., vol. 259, 1990, pages 327 - 330 |
KURCHAVOV ET AL., NUCLEOSIDES AND NUCLEOTIDES, vol. 16, 1997, pages 1837 - 1846 |
LETSINGER ET AL., PROC. NATL. ACAD. SCI. USA, vol. 86, 1989, pages 6553 - 6556 |
LIN ET AL., J. AM. CHEM. SOC., vol. 120, 1998, pages 8531 |
LIN, K.-Y.; JONES, R. J.; MATTEUCCI, M., J. AM. CHEM. SOC., vol. 117, 1995, pages 3873 - 3874 |
LIN, K.-Y.; MATTEUCCI, M., J. AM. CHEM. SOC., vol. 120, 1998, pages 8531 - 8532 |
LIN, K-Y; MATTEUCCI, M., J. AM. CHEM. SOC., vol. 120, 1998, pages 8531 - 8532 |
MANOHARAN ET AL., ANN. N.Y. ACAD. SCI., vol. 660, 1992, pages 306 - 309 |
MANOHARAN ET AL., BIOORG. MED. CHEM. LET., vol. 3, 1993, pages 2765 - 2770 |
MANOHARAN ET AL., BIOORG. MED. CHEM. LET., vol. 4, 1994, pages 1053 - 1060 |
MANOHARAN ET AL., NUCLEOSIDES & NUCLEOTIDES, vol. 14, 1995, pages 969 - 973 |
MANOHARAN ET AL., TETRAHEDRON LETT., vol. 36, 1995, pages 3651 - 3654 |
MARTIN ET AL., HELV. CHIM. ACTA, vol. 78, 1995, pages 486 - 504 |
MARTINEZ ET AL., CELL, vol. 110, 2002, pages 563 - 574 |
MATTEUCCI, M. D.; CARUTHERS, M. H., J. AM. CHEM. SOC., vol. 103, 1981, pages 3185 - 3191 |
MELLITZER ET AL., MEHANISMS OF DEVELOPMENT, vol. 118, 2002, pages 57 - 63 |
MISHRA ET AL., BIOCHIM. BIOPHYS. ACTA, vol. 1264, 1995, pages 229 - 237 |
NIELSEN ET AL., SCIENCE, vol. 254, 1991, pages 1497 - 1500 |
OBERHAUSER ET AL., NUCL. ACIDS RES., vol. 20, 1992, pages 533 - 538 |
REDDY, M. P. ET AL., TETRAHEDROM LETT., vol. 25, 1994, pages 4311 - 4314 |
SAISON- BEHMOARAS ET AL., EMBO J., vol. 10, 1991, pages 1111 - 1118 |
SANGHVI, Y.S.: "Antisense Research and Applications, pages", 1993, CRC PRESS, pages: 289 - 302 |
SCARINGE, S. A. ET AL., J. AM. CHEM. SOC., vol. 120, 1998, pages 11820 - 11821 |
SCARINGE, S. A., PH.D. THESIS, 1996 |
SCHWARZ ET AL., MOLECULAR CELL, vol. 10, 2002, pages 537 - 548 |
See also references of EP1560839A4 |
SHEA ET AL., NUCL. ACIDS RES., vol. 18, 1990, pages 3777 - 3783 |
SVINARCHUK ET AL., BIOCHIMIE, vol. 75, 1993, pages 49 - 54 |
WANG, J.; LIN, K.-Y.; MATTEUCCI, M., TETRAHEDRON LETT., vol. 39, 1998, pages 8385 - 8388 |
WINCOTT, F. ET AL., NUCLEIC ACIDS RES., vol. 23, 1995, pages 2677 - 2684 |
Cited By (41)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US9096636B2 (en) | 1996-06-06 | 2015-08-04 | Isis Pharmaceuticals, Inc. | Chimeric oligomeric compounds and their use in gene modulation |
US7695902B2 (en) | 1996-06-06 | 2010-04-13 | Isis Pharmaceuticals, Inc. | Oligoribonucleotides and ribonucleases for cleaving RNA |
US7812149B2 (en) | 1996-06-06 | 2010-10-12 | Isis Pharmaceuticals, Inc. | 2′-Fluoro substituted oligomeric compounds and compositions for use in gene modulations |
EP1578765A4 (en) * | 2002-11-05 | 2008-04-23 | Isis Pharmaceuticals Inc | Sugar surrogate-containing oligomeric compounds and compositions for use in gene modulation |
EP1578765A2 (en) * | 2002-11-05 | 2005-09-28 | Isis Pharmaceuticals, Inc. | Sugar surrogate-containing oligomeric compounds and compositions for use in gene modulation |
WO2004043979A2 (en) | 2002-11-05 | 2004-05-27 | Isis Pharmaceuticals, Inc. | Sugar surrogate-containing oligomeric compounds and compositions for use in gene modulation |
US8604183B2 (en) | 2002-11-05 | 2013-12-10 | Isis Pharmaceuticals, Inc. | Compositions comprising alternating 2′-modified nucleosides for use in gene modulation |
EP1677822A2 (en) * | 2003-09-18 | 2006-07-12 | Isis Pharmaceuticals, Inc. | 4'-thionucleosides and oligomeric compounds |
EP1677822A4 (en) * | 2003-09-18 | 2009-08-19 | Isis Pharmaceuticals Inc | 4'-thionucleosides and oligomeric compounds |
AU2009222605B2 (en) * | 2003-09-18 | 2010-12-09 | Isis Pharmaceuticals, Inc. | 4'-Thionucleosides and oligomeric compounds |
US8569474B2 (en) | 2004-03-09 | 2013-10-29 | Isis Pharmaceuticals, Inc. | Double stranded constructs comprising one or more short strands hybridized to a longer strand |
US8334373B2 (en) | 2004-05-27 | 2012-12-18 | Alnylam Pharmaceuticals, Inc. | Nuclease resistant double-stranded ribonucleic acid |
EP1765847A4 (en) * | 2004-05-27 | 2010-10-20 | Alnylam Pharmaceuticals Inc | Nuclease resistant double-stranded ribonucleic acid |
US7928217B2 (en) | 2004-05-27 | 2011-04-19 | Alnylam Pharmaceuticals, Inc. | Nuclease resistant double-stranded ribonucleic acid |
EP1765847A2 (en) * | 2004-05-27 | 2007-03-28 | Alnylam Pharmaceuticals Inc. | Nuclease resistant double-stranded ribonucleic acid |
US8993746B2 (en) | 2004-05-27 | 2015-03-31 | Alnylam Pharmaceuticals, Inc. | Nuclease resistant double-stranded ribonucleic acid |
EP1765415A4 (en) * | 2004-06-03 | 2010-03-24 | Isis Pharmaceuticals Inc | Oligomeric compounds that facilitate risc loading |
EP1766052A1 (en) * | 2004-06-03 | 2007-03-28 | Isis Pharmaceuticals, Inc. | Chimeric gapped oligomeric compositions |
EP1766052A4 (en) * | 2004-06-03 | 2009-12-16 | Isis Pharmaceuticals Inc | Chimeric gapped oligomeric compositions |
EP1765415A2 (en) * | 2004-06-03 | 2007-03-28 | Isis Pharmaceuticals, Inc. | Oligomeric compounds that facilitate risc loading |
EP1765074A4 (en) * | 2004-06-03 | 2009-08-12 | Isis Pharmaceuticals Inc | POSITIONALLY MODIFIED siRNA CONSTRUCTS |
EP1766071A2 (en) * | 2004-06-03 | 2007-03-28 | Isis Pharmaceuticals, Inc. | Double strand compositions comprising differentially modified strands for use in gene modulation |
JP2008501694A (en) * | 2004-06-03 | 2008-01-24 | アイシス ファーマシューティカルズ、インク. | Double-stranded composition having individually modified strands for use in gene regulation |
AU2004320622B2 (en) * | 2004-06-03 | 2012-06-14 | Isis Pharmaceuticals, Inc. | Chimeric gapped oligomeric compositions |
JP2008501335A (en) * | 2004-06-03 | 2008-01-24 | アイシス ファーマシューティカルズ、インク. | Chimeric gapped oligomer composition |
US8394947B2 (en) | 2004-06-03 | 2013-03-12 | Isis Pharmaceuticals, Inc. | Positionally modified siRNA constructs |
JP2008501693A (en) * | 2004-06-03 | 2008-01-24 | アイシス ファーマシューティカルズ、インク. | Double-stranded composition with individually regulated strands for use in gene regulation |
AU2005252662B2 (en) * | 2004-06-03 | 2011-08-18 | Isis Pharmaceuticals, Inc. | Double strand compositions comprising differentially modified strands for use in gene modulation |
EP1765074A2 (en) * | 2004-06-03 | 2007-03-28 | Isis Pharmaceuticals, Inc. | POSITIONALLY MODIFIED siRNA CONSTRUCTS |
EP1766071A4 (en) * | 2004-06-03 | 2009-11-11 | Isis Pharmaceuticals Inc | Double strand compositions comprising differentially modified strands for use in gene modulation |
US7884086B2 (en) | 2004-09-08 | 2011-02-08 | Isis Pharmaceuticals, Inc. | Conjugates for use in hepatocyte free uptake assays |
JP2009514877A (en) * | 2005-11-04 | 2009-04-09 | エムディーアールエヌエー,インコーポレイテッド | Peptide-Dither substrate RNA conjugates as siRNA delivery vehicles |
US8129515B2 (en) * | 2006-01-27 | 2012-03-06 | Isis Pharmaceuticals, Inc. | Oligomeric compounds and compositions for the use in modulation of microRNAs |
US20120115228A1 (en) * | 2006-01-27 | 2012-05-10 | Isis Pharmaceuticals, Inc. | Oligomeric compounds and compositions for the use in modulation of micrornas |
US9127272B2 (en) * | 2006-01-27 | 2015-09-08 | Isis Pharmaceuticals, Inc. | Oligomeric compounds and compositions for the use in modulation of target nucleic acids |
US8143230B2 (en) | 2006-05-05 | 2012-03-27 | Isis Pharmaceuticals, Inc. | Compounds and methods for modulating expression of PCSK9 |
EP2397551A1 (en) * | 2006-05-05 | 2011-12-21 | Isis Pharmaceuticals, Inc. | Compounds and methods for modulating expression of PCSK9 |
EP2023939A2 (en) * | 2006-05-05 | 2009-02-18 | Isis Pharmaceuticals, Inc. | Compounds and methods for modulating expression of pcsk9 |
EP2023939A4 (en) * | 2006-05-05 | 2009-04-29 | Isis Pharmaceuticals Inc | Compounds and methods for modulating expression of pcsk9 |
JP2010506598A (en) * | 2006-10-18 | 2010-03-04 | エムディーアールエヌエー,インコーポレイテッド | Nicked or gapped nucleic acid molecules and their use |
JP2016019523A (en) * | 2006-10-18 | 2016-02-04 | マリーナ バイオテック,インコーポレイテッド | Nicked or gapped nucleic acid molecules and uses thereof |
Also Published As
Publication number | Publication date |
---|---|
WO2004044138A3 (en) | 2005-03-24 |
AU2003287505A1 (en) | 2004-06-03 |
CA2504720C (en) | 2013-12-24 |
EP1560839A4 (en) | 2008-04-23 |
EP1560839A2 (en) | 2005-08-10 |
CA2504720A1 (en) | 2004-05-27 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
EP1765074B1 (en) | POSITIONALLY MODIFIED siRNA CONSTRUCTS | |
US7919612B2 (en) | 2′-substituted oligomeric compounds and compositions for use in gene modulations | |
AU2003290596B2 (en) | Sugar surrogate-containing oligomeric compounds and compositions for use in gene modulation | |
US9096636B2 (en) | Chimeric oligomeric compounds and their use in gene modulation | |
US20040161844A1 (en) | Sugar and backbone-surrogate-containing oligomeric compounds and compositions for use in gene modulation | |
WO2004043977A2 (en) | 2’-fluoro substituted oligomeric compounds and compositions for use in gene modulations | |
US20040147022A1 (en) | 2'-methoxy substituted oligomeric compounds and compositions for use in gene modulations | |
US20050032067A1 (en) | Non-phosphorous-linked oligomeric compounds and their use in gene modulation | |
CA2504720C (en) | Chimeric oligomeric compounds and their use in gene modulation | |
US20040171031A1 (en) | Sugar surrogate-containing oligomeric compounds and compositions for use in gene modulation | |
US20040171032A1 (en) | Non-phosphorous-linked oligomeric compounds and their use in gene modulation | |
WO2004044134A2 (en) | Phosphorous-linked oligomeric compounds and their use in gene modulation | |
AU2004320622A1 (en) | Chimeric gapped oligomeric compositions | |
US20200276222A1 (en) | 2'-methoxy substituted oligomeric compounds and compositions for use in gene modulations | |
WO2004044131A2 (en) | Cross-linked oligomeric compounds and their use in gene modulation | |
US20050032068A1 (en) | Sugar and backbone-surrogate-containing oligomeric compounds and compositions for use in gene modulation | |
US7812149B2 (en) | 2′-Fluoro substituted oligomeric compounds and compositions for use in gene modulations | |
US20050053976A1 (en) | Chimeric oligomeric compounds and their use in gene modulation | |
US20040254358A1 (en) | Phosphorous-linked oligomeric compounds and their use in gene modulation | |
AU2011203091B2 (en) | Chimeric oligomeric compounds and their use in gene modulation |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A2 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): BW GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
WWE | Wipo information: entry into national phase |
Ref document number: 2504720 Country of ref document: CA |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2003287505 Country of ref document: AU |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2003781746 Country of ref document: EP |
|
DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
WWP | Wipo information: published in national office |
Ref document number: 2003781746 Country of ref document: EP |
|
NENP | Non-entry into the national phase |
Ref country code: JP |
|
WWW | Wipo information: withdrawn in national office |
Country of ref document: JP |