WO2004080943A1 - シンナミルアルコール誘導体化合物およびその化合物を有効成分として含有する薬剤 - Google Patents
シンナミルアルコール誘導体化合物およびその化合物を有効成分として含有する薬剤 Download PDFInfo
- Publication number
- WO2004080943A1 WO2004080943A1 PCT/JP2004/003112 JP2004003112W WO2004080943A1 WO 2004080943 A1 WO2004080943 A1 WO 2004080943A1 JP 2004003112 W JP2004003112 W JP 2004003112W WO 2004080943 A1 WO2004080943 A1 WO 2004080943A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- propene
- compound
- acetic acid
- group
- salt
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D277/00—Heterocyclic compounds containing 1,3-thiazole or hydrogenated 1,3-thiazole rings
- C07D277/02—Heterocyclic compounds containing 1,3-thiazole or hydrogenated 1,3-thiazole rings not condensed with other rings
- C07D277/20—Heterocyclic compounds containing 1,3-thiazole or hydrogenated 1,3-thiazole rings not condensed with other rings having two or three double bonds between ring members or between ring members and non-ring members
- C07D277/22—Heterocyclic compounds containing 1,3-thiazole or hydrogenated 1,3-thiazole rings not condensed with other rings having two or three double bonds between ring members or between ring members and non-ring members with only hydrogen atoms, hydrocarbon or substituted hydrocarbon radicals, directly attached to ring carbon atoms
- C07D277/24—Radicals substituted by oxygen atoms
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/185—Acids; Anhydrides, halides or salts thereof, e.g. sulfur acids, imidic, hydrazonic or hydroximic acids
- A61K31/19—Carboxylic acids, e.g. valproic acid
- A61K31/192—Carboxylic acids, e.g. valproic acid having aromatic groups, e.g. sulindac, 2-aryl-propionic acids, ethacrynic acid
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/21—Esters, e.g. nitroglycerine, selenocyanates
- A61K31/215—Esters, e.g. nitroglycerine, selenocyanates of carboxylic acids
- A61K31/22—Esters, e.g. nitroglycerine, selenocyanates of carboxylic acids of acyclic acids, e.g. pravastatin
- A61K31/222—Esters, e.g. nitroglycerine, selenocyanates of carboxylic acids of acyclic acids, e.g. pravastatin with compounds having aromatic groups, e.g. dipivefrine, ibopamine
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/41—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
- A61K31/42—Oxazoles
- A61K31/421—1,3-Oxazoles, e.g. pemoline, trimethadione
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/41—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
- A61K31/4245—Oxadiazoles
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/41—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
- A61K31/425—Thiazoles
- A61K31/426—1,3-Thiazoles
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/41—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
- A61K31/425—Thiazoles
- A61K31/428—Thiazoles condensed with carbocyclic rings
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
- A61K31/44—Non condensed pyridines; Hydrogenated derivatives thereof
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
- A61K31/44—Non condensed pyridines; Hydrogenated derivatives thereof
- A61K31/4409—Non condensed pyridines; Hydrogenated derivatives thereof only substituted in position 4, e.g. isoniazid, iproniazid
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
- A61K31/44—Non condensed pyridines; Hydrogenated derivatives thereof
- A61K31/445—Non condensed piperidines, e.g. piperocaine
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
- A61K31/44—Non condensed pyridines; Hydrogenated derivatives thereof
- A61K31/445—Non condensed piperidines, e.g. piperocaine
- A61K31/4523—Non condensed piperidines, e.g. piperocaine containing further heterocyclic ring systems
- A61K31/454—Non condensed piperidines, e.g. piperocaine containing further heterocyclic ring systems containing a five-membered ring with nitrogen as a ring hetero atom, e.g. pimozide, domperidone
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
- A61K31/44—Non condensed pyridines; Hydrogenated derivatives thereof
- A61K31/445—Non condensed piperidines, e.g. piperocaine
- A61K31/4523—Non condensed piperidines, e.g. piperocaine containing further heterocyclic ring systems
- A61K31/4545—Non condensed piperidines, e.g. piperocaine containing further heterocyclic ring systems containing a six-membered ring with nitrogen as a ring hetero atom, e.g. pipamperone, anabasine
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
- A61K31/496—Non-condensed piperazines containing further heterocyclic rings, e.g. rifampin, thiothixene
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/535—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with at least one nitrogen and one oxygen as the ring hetero atoms, e.g. 1,2-oxazines
- A61K31/5355—Non-condensed oxazines and containing further heterocyclic rings
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/535—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with at least one nitrogen and one oxygen as the ring hetero atoms, e.g. 1,2-oxazines
- A61K31/5375—1,4-Oxazines, e.g. morpholine
- A61K31/5377—1,4-Oxazines, e.g. morpholine not condensed and containing further heterocyclic rings, e.g. timolol
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/54—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with at least one nitrogen and one sulfur as the ring hetero atoms, e.g. sulthiame
- A61K31/541—Non-condensed thiazines containing further heterocyclic rings
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P3/00—Drugs for disorders of the metabolism
- A61P3/04—Anorexiants; Antiobesity agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P3/00—Drugs for disorders of the metabolism
- A61P3/06—Antihyperlipidemics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
- C07C235/00—Carboxylic acid amides, the carbon skeleton of the acid part being further substituted by oxygen atoms
- C07C235/02—Carboxylic acid amides, the carbon skeleton of the acid part being further substituted by oxygen atoms having carbon atoms of carboxamide groups bound to acyclic carbon atoms and singly-bound oxygen atoms bound to the same carbon skeleton
- C07C235/32—Carboxylic acid amides, the carbon skeleton of the acid part being further substituted by oxygen atoms having carbon atoms of carboxamide groups bound to acyclic carbon atoms and singly-bound oxygen atoms bound to the same carbon skeleton the carbon skeleton containing six-membered aromatic rings
- C07C235/34—Carboxylic acid amides, the carbon skeleton of the acid part being further substituted by oxygen atoms having carbon atoms of carboxamide groups bound to acyclic carbon atoms and singly-bound oxygen atoms bound to the same carbon skeleton the carbon skeleton containing six-membered aromatic rings having the nitrogen atoms of the carboxamide groups bound to hydrogen atoms or to acyclic carbon atoms
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
- C07C255/00—Carboxylic acid nitriles
- C07C255/01—Carboxylic acid nitriles having cyano groups bound to acyclic carbon atoms
- C07C255/32—Carboxylic acid nitriles having cyano groups bound to acyclic carbon atoms having cyano groups bound to acyclic carbon atoms of a carbon skeleton containing at least one six-membered aromatic ring
- C07C255/37—Carboxylic acid nitriles having cyano groups bound to acyclic carbon atoms having cyano groups bound to acyclic carbon atoms of a carbon skeleton containing at least one six-membered aromatic ring the carbon skeleton being further substituted by etherified hydroxy groups
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
- C07C311/00—Amides of sulfonic acids, i.e. compounds having singly-bound oxygen atoms of sulfo groups replaced by nitrogen atoms, not being part of nitro or nitroso groups
- C07C311/50—Compounds containing any of the groups, X being a hetero atom, Y being any atom
- C07C311/51—Y being a hydrogen or a carbon atom
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
- C07C323/00—Thiols, sulfides, hydropolysulfides or polysulfides substituted by halogen, oxygen or nitrogen atoms, or by sulfur atoms not being part of thio groups
- C07C323/10—Thiols, sulfides, hydropolysulfides or polysulfides substituted by halogen, oxygen or nitrogen atoms, or by sulfur atoms not being part of thio groups containing thio groups and singly-bound oxygen atoms bound to the same carbon skeleton
- C07C323/18—Thiols, sulfides, hydropolysulfides or polysulfides substituted by halogen, oxygen or nitrogen atoms, or by sulfur atoms not being part of thio groups containing thio groups and singly-bound oxygen atoms bound to the same carbon skeleton having the sulfur atom of at least one of the thio groups bound to a carbon atom of a six-membered aromatic ring of the carbon skeleton
- C07C323/19—Thiols, sulfides, hydropolysulfides or polysulfides substituted by halogen, oxygen or nitrogen atoms, or by sulfur atoms not being part of thio groups containing thio groups and singly-bound oxygen atoms bound to the same carbon skeleton having the sulfur atom of at least one of the thio groups bound to a carbon atom of a six-membered aromatic ring of the carbon skeleton with singly-bound oxygen atoms bound to acyclic carbon atoms of the carbon skeleton
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
- C07C51/00—Preparation of carboxylic acids or their salts, halides or anhydrides
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
- C07C69/00—Esters of carboxylic acids; Esters of carbonic or haloformic acids
- C07C69/66—Esters of carboxylic acids having esterified carboxylic groups bound to acyclic carbon atoms and having any of the groups OH, O—metal, —CHO, keto, ether, acyloxy, groups, groups, or in the acid moiety
- C07C69/73—Esters of carboxylic acids having esterified carboxylic groups bound to acyclic carbon atoms and having any of the groups OH, O—metal, —CHO, keto, ether, acyloxy, groups, groups, or in the acid moiety of unsaturated acids
- C07C69/734—Ethers
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D211/00—Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings
- C07D211/04—Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom
- C07D211/06—Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having no double bonds between ring members or between ring members and non-ring members
- C07D211/08—Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having no double bonds between ring members or between ring members and non-ring members with hydrocarbon or substituted hydrocarbon radicals directly attached to ring carbon atoms
- C07D211/18—Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having no double bonds between ring members or between ring members and non-ring members with hydrocarbon or substituted hydrocarbon radicals directly attached to ring carbon atoms with substituted hydrocarbon radicals attached to ring carbon atoms
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D213/00—Heterocyclic compounds containing six-membered rings, not condensed with other rings, with one nitrogen atom as the only ring hetero atom and three or more double bonds between ring members or between ring members and non-ring members
- C07D213/02—Heterocyclic compounds containing six-membered rings, not condensed with other rings, with one nitrogen atom as the only ring hetero atom and three or more double bonds between ring members or between ring members and non-ring members having three double bonds between ring members or between ring members and non-ring members
- C07D213/04—Heterocyclic compounds containing six-membered rings, not condensed with other rings, with one nitrogen atom as the only ring hetero atom and three or more double bonds between ring members or between ring members and non-ring members having three double bonds between ring members or between ring members and non-ring members having no bond between the ring nitrogen atom and a non-ring member or having only hydrogen or carbon atoms directly attached to the ring nitrogen atom
- C07D213/24—Heterocyclic compounds containing six-membered rings, not condensed with other rings, with one nitrogen atom as the only ring hetero atom and three or more double bonds between ring members or between ring members and non-ring members having three double bonds between ring members or between ring members and non-ring members having no bond between the ring nitrogen atom and a non-ring member or having only hydrogen or carbon atoms directly attached to the ring nitrogen atom with substituted hydrocarbon radicals attached to ring carbon atoms
- C07D213/28—Radicals substituted by singly-bound oxygen or sulphur atoms
- C07D213/30—Oxygen atoms
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D213/00—Heterocyclic compounds containing six-membered rings, not condensed with other rings, with one nitrogen atom as the only ring hetero atom and three or more double bonds between ring members or between ring members and non-ring members
- C07D213/02—Heterocyclic compounds containing six-membered rings, not condensed with other rings, with one nitrogen atom as the only ring hetero atom and three or more double bonds between ring members or between ring members and non-ring members having three double bonds between ring members or between ring members and non-ring members
- C07D213/04—Heterocyclic compounds containing six-membered rings, not condensed with other rings, with one nitrogen atom as the only ring hetero atom and three or more double bonds between ring members or between ring members and non-ring members having three double bonds between ring members or between ring members and non-ring members having no bond between the ring nitrogen atom and a non-ring member or having only hydrogen or carbon atoms directly attached to the ring nitrogen atom
- C07D213/24—Heterocyclic compounds containing six-membered rings, not condensed with other rings, with one nitrogen atom as the only ring hetero atom and three or more double bonds between ring members or between ring members and non-ring members having three double bonds between ring members or between ring members and non-ring members having no bond between the ring nitrogen atom and a non-ring member or having only hydrogen or carbon atoms directly attached to the ring nitrogen atom with substituted hydrocarbon radicals attached to ring carbon atoms
- C07D213/54—Radicals substituted by carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals
- C07D213/55—Acids; Esters
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D257/00—Heterocyclic compounds containing rings having four nitrogen atoms as the only ring hetero atoms
- C07D257/02—Heterocyclic compounds containing rings having four nitrogen atoms as the only ring hetero atoms not condensed with other rings
- C07D257/04—Five-membered rings
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D263/00—Heterocyclic compounds containing 1,3-oxazole or hydrogenated 1,3-oxazole rings
- C07D263/02—Heterocyclic compounds containing 1,3-oxazole or hydrogenated 1,3-oxazole rings not condensed with other rings
- C07D263/30—Heterocyclic compounds containing 1,3-oxazole or hydrogenated 1,3-oxazole rings not condensed with other rings having two or three double bonds between ring members or between ring members and non-ring members
- C07D263/32—Heterocyclic compounds containing 1,3-oxazole or hydrogenated 1,3-oxazole rings not condensed with other rings having two or three double bonds between ring members or between ring members and non-ring members with only hydrogen atoms, hydrocarbon or substituted hydrocarbon radicals, directly attached to ring carbon atoms
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D271/00—Heterocyclic compounds containing five-membered rings having two nitrogen atoms and one oxygen atom as the only ring hetero atoms
- C07D271/02—Heterocyclic compounds containing five-membered rings having two nitrogen atoms and one oxygen atom as the only ring hetero atoms not condensed with other rings
- C07D271/06—1,2,4-Oxadiazoles; Hydrogenated 1,2,4-oxadiazoles
- C07D271/07—1,2,4-Oxadiazoles; Hydrogenated 1,2,4-oxadiazoles with oxygen, sulfur or nitrogen atoms, directly attached to ring carbon atoms, the nitrogen atoms not forming part of a nitro radical
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D277/00—Heterocyclic compounds containing 1,3-thiazole or hydrogenated 1,3-thiazole rings
- C07D277/02—Heterocyclic compounds containing 1,3-thiazole or hydrogenated 1,3-thiazole rings not condensed with other rings
- C07D277/20—Heterocyclic compounds containing 1,3-thiazole or hydrogenated 1,3-thiazole rings not condensed with other rings having two or three double bonds between ring members or between ring members and non-ring members
- C07D277/22—Heterocyclic compounds containing 1,3-thiazole or hydrogenated 1,3-thiazole rings not condensed with other rings having two or three double bonds between ring members or between ring members and non-ring members with only hydrogen atoms, hydrocarbon or substituted hydrocarbon radicals, directly attached to ring carbon atoms
- C07D277/30—Radicals substituted by carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D277/00—Heterocyclic compounds containing 1,3-thiazole or hydrogenated 1,3-thiazole rings
- C07D277/02—Heterocyclic compounds containing 1,3-thiazole or hydrogenated 1,3-thiazole rings not condensed with other rings
- C07D277/20—Heterocyclic compounds containing 1,3-thiazole or hydrogenated 1,3-thiazole rings not condensed with other rings having two or three double bonds between ring members or between ring members and non-ring members
- C07D277/32—Heterocyclic compounds containing 1,3-thiazole or hydrogenated 1,3-thiazole rings not condensed with other rings having two or three double bonds between ring members or between ring members and non-ring members with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms
- C07D277/38—Nitrogen atoms
- C07D277/42—Amino or imino radicals substituted by hydrocarbon or substituted hydrocarbon radicals
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D277/00—Heterocyclic compounds containing 1,3-thiazole or hydrogenated 1,3-thiazole rings
- C07D277/60—Heterocyclic compounds containing 1,3-thiazole or hydrogenated 1,3-thiazole rings condensed with carbocyclic rings or ring systems
- C07D277/62—Benzothiazoles
- C07D277/64—Benzothiazoles with only hydrocarbon or substituted hydrocarbon radicals attached in position 2
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D285/00—Heterocyclic compounds containing rings having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for by groups C07D275/00 - C07D283/00
- C07D285/01—Five-membered rings
- C07D285/02—Thiadiazoles; Hydrogenated thiadiazoles
- C07D285/04—Thiadiazoles; Hydrogenated thiadiazoles not condensed with other rings
- C07D285/08—1,2,4-Thiadiazoles; Hydrogenated 1,2,4-thiadiazoles
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D291/00—Heterocyclic compounds containing rings having nitrogen, oxygen and sulfur atoms as the only ring hetero atoms
- C07D291/02—Heterocyclic compounds containing rings having nitrogen, oxygen and sulfur atoms as the only ring hetero atoms not condensed with other rings
- C07D291/04—Five-membered rings
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D317/00—Heterocyclic compounds containing five-membered rings having two oxygen atoms as the only ring hetero atoms
- C07D317/08—Heterocyclic compounds containing five-membered rings having two oxygen atoms as the only ring hetero atoms having the hetero atoms in positions 1 and 3
- C07D317/44—Heterocyclic compounds containing five-membered rings having two oxygen atoms as the only ring hetero atoms having the hetero atoms in positions 1 and 3 ortho- or peri-condensed with carbocyclic rings or ring systems
- C07D317/46—Heterocyclic compounds containing five-membered rings having two oxygen atoms as the only ring hetero atoms having the hetero atoms in positions 1 and 3 ortho- or peri-condensed with carbocyclic rings or ring systems condensed with one six-membered ring
- C07D317/48—Methylenedioxybenzenes or hydrogenated methylenedioxybenzenes, unsubstituted on the hetero ring
- C07D317/50—Methylenedioxybenzenes or hydrogenated methylenedioxybenzenes, unsubstituted on the hetero ring with only hydrogen atoms, hydrocarbon or substituted hydrocarbon radicals, directly attached to atoms of the carbocyclic ring
- C07D317/54—Radicals substituted by oxygen atoms
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D333/00—Heterocyclic compounds containing five-membered rings having one sulfur atom as the only ring hetero atom
- C07D333/02—Heterocyclic compounds containing five-membered rings having one sulfur atom as the only ring hetero atom not condensed with other rings
- C07D333/04—Heterocyclic compounds containing five-membered rings having one sulfur atom as the only ring hetero atom not condensed with other rings not substituted on the ring sulphur atom
- C07D333/06—Heterocyclic compounds containing five-membered rings having one sulfur atom as the only ring hetero atom not condensed with other rings not substituted on the ring sulphur atom with only hydrogen atoms, hydrocarbon or substituted hydrocarbon radicals, directly attached to the ring carbon atoms
- C07D333/24—Radicals substituted by carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D413/00—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and oxygen atoms as the only ring hetero atoms
- C07D413/02—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and oxygen atoms as the only ring hetero atoms containing two hetero rings
- C07D413/04—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and oxygen atoms as the only ring hetero atoms containing two hetero rings directly linked by a ring-member-to-ring-member bond
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D413/00—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and oxygen atoms as the only ring hetero atoms
- C07D413/02—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and oxygen atoms as the only ring hetero atoms containing two hetero rings
- C07D413/10—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and oxygen atoms as the only ring hetero atoms containing two hetero rings linked by a carbon chain containing aromatic rings
Definitions
- Cinnamyl alcohol derivative compound and drug containing the compound as active ingredient Cinnamyl alcohol derivative compound and drug containing the compound as active ingredient
- the present invention relates to a cinnamyl alcohol derivative compound.
- PPAR peroxisome proliferator-activated receptor
- Y type is mainly adipose tissue, immune cells
- type a is mainly expressed in adipose tissue, liver, and retina
- type ⁇ is known to be ubiquitously expressed without any tissue specificity
- thiazolidinine derivatives such as pioglitazone hydrochloride and rosiglitazone maleate are known as therapeutic agents for non-insulin-dependent diabetes mellitus (NIDDM), and are hypoglycemic agents used to correct hyperglycemia in diabetic patients. It is. It is also a promising compound as an insulin sensitizer because it is effective in correcting or improving hyperinsulinemia, improving glucose tolerance, and lowering serum lipids.
- PPAR ⁇ One of the intracellular target proteins of these thiazolidine derivatives is PPAR ⁇ , which has been found to increase the transcriptional activity of PPARy (Endocrinology., 137, 4189 (1996); Cell ”83, 803 ( Cell) 83, 813 (1995); J. Biol. Chem., 270, 12953 (1995)).
- PPAR y activators increase the transcriptional activity of PPAR gamma (Agoyusuto) is considered to be promising as a hypoglycemic agent and Z or lipid lowering agents. It is known that PPAR y agonist enhances the expression of PPAR ⁇ protein itself (Genes & Development., 10, 974 (1996)). Drugs that increase their expression are also considered clinically useful.
- the nuclear receptor PPAR gamma is involved in adipocyte differentiation (J. Biol. Chem., 272 , 5 «7 (I 997) and Cell.,, See 8O 3 (I 995)), you can activate this Thiazolidin derivatives are known to promote adipocyte differentiation. Recently, it has been reported in humans that thiazolidine derivatives increase body fat and cause weight gain and obesity (see Lancet, 349, 952 (1997)). Therefore, an antagonist that suppresses PPAR ⁇ activity or a drug that can reduce the expression of PPARy protein itself is considered to be clinically useful. By the way, Science., 22 2100 (19%) states that phosphorylation of PPAR ⁇ can suppress its activity.
- P PAR ⁇ activators Agust
- P PAR ⁇ protein expression regulators that can increase the expression of the protein itself are hypoglycemic and lipid-lowering drugs, as well as diabetes, obesity, metabolic syndrome, It is expected to be useful as a prophylactic and / or therapeutic agent for metabolic disorders such as cholesterolemia and hyperlipoproteinemia, hyperlipidemia, arteriosclerosis, hypertension, cardiovascular disease, bulimia, etc. .
- antagonists that suppress the transcriptional activity of PPAR ⁇ or PPAR ⁇ protein expression regulators that can suppress the expression of the protein itself include hypoglycemic drugs, diabetes, obesity, metabolic disorders such as metabolic syndrome, and hyperlipidemia. Is expected to be useful as a prophylactic and / or therapeutic agent for diseases, arteriosclerosis, hypertension, bulimia, etc.
- fibrate compounds such as clofibrate are known as lipid-lowering drugs, but it has also been found that one of the intracellular target proteins of fibrate compounds is Ro ⁇ ARo! (Nature., 342 , 645 (1990);.. J. Steroid Biochem Molec Biol, 51, 157 (1994);.. Biochemistry, 32, 5598 (I 993) reference). Based on these facts, it is considered that PPARa; a modulator that can activate fibrate compounds has a lipid-lowering effect, and as a preventive and / or therapeutic agent for hyperlipidemia, etc. Expected to be useful.
- W097 / 36579 reported that it has an anti-obesity effect as a biological activity involving PPAR ⁇ .
- activation of P PAR ⁇ increases cholesterol in high-density lipoprotein (HDL) and cholesterol in low-density lipoprotein (LDL) and ultra-low density It has been reported to have lipoprotein (VLDL) cholesterol and even triglyceride lowering effects.
- Diabetes., 46, 348 It has been reported that bezafibrate, one of the triglycerides, improved blood fatty acid composition, hypertension, and insulin resistance.
- PPAR CK regulators that enhance the expression of the agonist ⁇ P PAR ⁇ protein itself that activates PP AR «are useful not only as lipid-lowering drugs and therapeutic agents for hyperlipidemia, but also as HDL cholesterol-elevating agents and LDL. It is expected to reduce cholesterol and Z or VL DL cholesterol, and to suppress and treat the progression of arteriosclerosis and obesity, and to treat and prevent diabetes as a hypoglycemic drug, improve hypertension, reduce the risk factor of metapolic syndrome, It is also promising for the prevention of ischemic heart disease.
- PPARS is sometimes referred to as PPAR] 3, or NUC 1 in humans.
- PPAR a biological activity of P PAR ⁇
- WO96 / 01430 shows that hNUC 1B (a P PAR subtype different from human NUC 1 by 1 amino acid) can suppress the transcriptional activity of human P PAR ⁇ and thyroid hormone receptor. It is shown.
- compounds (agonists) having high affinity for PPAR5 protein and significantly activating PPARS have been found, and further, those compounds have been identified as HDL ( High-density lipoprotein) It was reported that it had a cholesterol-elevating effect.
- HDL High-density lipoprotein
- agonists capable of activating PPARS are expected to have an effect of increasing HDL cholesterol, thereby suppressing the progression of arteriosclerosis and its treatment, and being applied as a lipid-lowering drug or a hypoglycemic drug. It is also thought to be useful for treatment, hypoglycemic drugs, treatment of diabetes, reduction of risk factors for metapolic syndrome, and prevention of ischemic heart disease.
- WO02 / 098840 has the general formula (A)
- the present invention is a.
- I 1 , R 2 , R 3 and R 4 each independently represent a hydrogen atom, a hydrocarbon group which may have a substituent, a halogen atom or a substituent which may have a substituent.
- Ring A and ring B each independently represent a cyclic group which may have a substituent,
- a pharmaceutical composition comprising the compound according to the above 1, a salt thereof, a solvate or an N-oxide or a prodrug thereof,
- the compound, a salt, a solvate or a peroxide thereof described in the above 1) Is a drug that combines those prodrugs with one or more selected from antiobesity drugs, antidiabetic drugs and lipid improving drugs, and 1 5.
- Lipid improving drugs are A CAT inhibitors and MTP inhibitors 14.
- hydrocarbon group in the “optionally substituted hydrocarbon group” represented by R ⁇ R 2 , R 3 and R 4 include, for example, alkyl, alkenyl, and aryl.
- alkyl examples include linear groups such as methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, pentyl, isopentyl, neopentyl, hexyl, heptyl, and octyl groups. Or branched C 1-8 alkyl.
- alkenyl examples include linear or branched C2-8 alkenyl such as ether, propyl, pentyl, pentenyl, hexenyl, heptyl and otathenyl.
- phenols examples include linear or branched C2-8 alkynyls such as ethur, probel, butchur, pentyl, hexyl, heptyl, octyl and the like.
- substituted hydrocarbon group represented by RRR 3 and R 4
- substituent for example, a hydroxyl group, C 1-8 alkoxy, C 2-8 acyl, amino, mono (C l-8 alkyl) amino, di (C1-8 alkyl) amino, Cl-87 siloxy, mercapto, C1-8alkylthio, halogen atom, (C1-8alkyl) sulfur, (C1-8alkyl) )
- One to five groups selected from sulfonylamino, C2-8 acylinoamino, oxo, cyano, nitro, carbamoyl, acidic groups, carbocyclic groups and heterocyclic groups. I can do it.
- C 1-8 alkoxy in the “substituent” includes, for example, methoxy, ethoxy, propoxy, isopropoxy, butoxy, isobutoxy, sec-butoxy, pentyloxy, isopenpentinoleoxy, neopentinoleoxy, Examples thereof include linear or branched C1-8 alkoxy such as xyloxy, heptyloxy, and octyloxy groups.
- Examples of the C 2-8 acyl in the “substituent” include acetyl, propioninole, butylinole, valerinole, hexanoinole, heptanoire, otanoinole and isomers thereof.
- di (C 1-8 alkyl) amino in the “substituent” means an amino group substituted by two independent C 1-8 alkyl groups, for example, dimethylamino, getylamino, dipropylamino, dibutylamino, dibutylamino. Examples thereof include dimethylamino, dihexylamino, diheptylamino, dioctylamino, ethylmethylamino, methylpropylamino, ethylpropylamino, and isomers thereof.
- Examples of the C 1-8 acyloxy in the “substituent” include formyloxy, acetinoleoxy, propioninoleoxy, butylinoleoxy, parerinoleoxy, hexanoyloxy, heptanoyloxy, octanoyloxy and its isomers.
- Examples of the C 1-8 alkylthio in the “substituent” include, for example, methylthio, echinorecio, propinorecho, petitnorecho, pentinorecho, hexinorecho, and Examples include butylthio, octylthio and isomers thereof.
- halogen atom in the “substituent” examples include fluorine, chlorine, bromine and iodine.
- Examples of (C 1-8 anolequinolene) sulfonyl in the “substituent” include, for example, methinoles nolehoninole, echinoles nolehoninole, propinores nolehoninole, butinoles norehoninole, pentinoles norehoninole, Hexinoles rehoninole, heptinoles renoninole, octyl sulfol and isomers thereof, and the like.
- Examples of the (C 1-8 alkyl) sulfuramino in the “substituent” include, for example, methylsulfonylamino, ethylsulfuramino, propinolesnorehonylamino, butylsulfuramino, pentylsulfuramino, pentylsulfuramino, Hexylsulfuramino, heptylsulfonylamino, octyl / resnorlephoninoleamino and isomers thereof and the like.
- the C 2-8 acylamino in the “substituent” includes, for example, acetylamino, propionylamino, butyrylamino, valerinoleamino, hexanoylamino, heptanoylamino, otanoylamino and isomers thereof. .
- the acidic group in the "substituent” includes, for example, carboxy which may be esterified (for carboxy which may be esterified, for example, those used as synthetic intermediates, those which are pharmacologically enjoyable Or those that can be pharmacologically enjoyed for the first time in vivo or those that change to those that can be pharmacologically enjoyed in vivo for the first time, such as alkyl (eg, methyl, ethyl, Propyl, isopropyl, n-butynole, isoptinole, sec-butyl, tert-pentinole, n-pentyl, isopentinole, sec-pentynole, neopentynole, tert-pentynole, etc.
- alkyl eg, methyl, ethyl, Propyl, isopropyl, n-butynole, isoptinole, sec-butyl, tert
- Benzyl optionally having 1 to 3 substituents selected from 6 alkoxy and the like (for example, benzinole, Etrobenzyl, methoxybe Phenyl), nitro and phenyl optionally having 1 to 3 substituents selected from alkoxy having 1 to 6 carbon atoms (eg, phenyl, nitrophenyl, methoxyphenyl, etc.) and the like. Is mentioned. ), Sulfo, -S0 2 NH
- R x (R x represents a hydrogen atom or an optionally substituted hydrocarbon group.), Representing an NHS0 2 R Y (R Y may have a substituent hydrocarbon group. ), the force Rubamoiru, phosphono, phenol, Shiano, -CONHS0 2 R Y (R Y represents various Purensutetsudo acids such as nitrogenous ring residue having a hydrogen atom that can be.) or deprotonated as defined above.
- Prensted acid refers to a substance that gives hydrogen ions to another substance. Examples of the “nitrogen-containing ring residue having a hydrogen atom that can be deprotonated” include, for example,
- the “carbocyclic group” in the “substituent” includes, for example, a C3-15 monocyclic, bicyclic or tricyclic aromatic carbocyclic ring which may be partially or wholly saturated.
- Examples of the C 3 to C 15 monocyclic, bicyclic or tricyclic aromatic carbocyclic ring which may be partially or completely saturated include, for example, cyclopropane, cyclobutane, cyclopentane, cyclohexane, cycloheptane , Cyclooctane, cyclono Nan, Cyclodecane, Cycloundecane, Cyclododecane, Cyclotridodecane, Cyclotetradecane, Cyclopentadecane, Cyclopentene, Cyclohexene,, Heptene, Heptene, Cyclopentene, Cyclopentane, Cyclohexagene, Cycloheptagen, Cyc Kutagen, benzene, pentalene, parahydropentalene, azulene, perhydroazulene, indene, perhydroindene, indane, naphthalene, dihydronaphthalene, t
- a C 3 to C 15 monocyclic, bicyclic or tricyclic aromatic carbocyclic ring which may be partially or entirely saturated, has a spiro-bonded bicyclic carbocyclic ring, and a bridged bicyclic ring
- Formula carbocycles are also included, for example, spiro [4.4] nonane, spiro [4.5] decane, spiro [5.5] pendecane, bicyclo [2.2.1] heptane, bicyclo [2.2.1] ] Hepter-2-ene, Bicyclo [3.1.1] Heptane, Bicyclo [3.1.1] Hepta-2-ene, Bicyclo [2.2.2] Octane, Bicyclo [2.2.2] 2] Octa-2-ene, adamantane, noruadamantane ring and the like.
- heterocyclic group in the “substituent” includes, for example, 1 to 5 heteroatoms selected from an oxygen atom, a nitrogen atom or a sulfur atom, and may be partially or completely saturated 3 And a 15-membered monocyclic, bicyclic or tricyclic aromatic heterocyclic ring.
- Heterocycles include, for example, pyrrole, imidazole, triazole, tetrazonole, pyrazonole, pyridine, pyrazine, pyrimidine, pyridazine, azepine, diazepine, furan, pyran, saixepin, thiophen, thiopyran, cepin, saixazole.
- Examples of the halogen atom represented by R ⁇ R 2 S R 3 and R 4 include fluorine, chlorine, bromine and iodine.
- R ⁇ R 2 , R 3 , R ring A and ring B may have a substituent
- Examples of the “cyclic group” in the “cyclic group” include the carbon ring and the heterocyclic ring in the “substituent” in the above “hydrocarbon group which may have a substituent”.
- the “substituent” in the “cyclic group optionally having substituent (s)” represented by RR 2 , R 3 , R ring A and ring B includes, for example, (1) a substituent (2) hydroxyl group, (3) alkoxy optionally having a substituent, (4) mercapto, (5) alkylthio optionally having a substituent, (6) substitution Amino which may have a group, (7) halogen atom (for example, fluorine, chlorine, bromine, iodine), (8) cyano, (9) jet port, (10) acidic group, (11) A carbocyclic group which may have a substituent; (12) a heterocyclic group which may have a substituent; and the like. 5 may be substituted.
- hydrocarbon group in the “hydrocarbon group optionally having substituent (s)” as the substituent (1) include, for example, alkyl, alkenyl, and alkynyl (where alkyl, alkenyl, and alkynyl are as defined above.
- the substituent of the hydrocarbon group may be a hydroxyl group, an amino, a carboxyl which may be esterified (a carboxyl which may be esterified has the same meaning as described above), a nitro, a mono- or Di-C 1-6 alkylamino (for example, methylamino, ethylamino, propylamino, dimethylamino, acetylamino, etc.), C1-6 alkoxy group (for example, methoxy, ethoxy, propoxy, hexoxy, etc.), C1-6 Examples thereof include an alkylcarbonyloxy group (eg, acetoxy, ethylcarboeroxy, etc.), a halogen atom (eg, fluorine, chlorine, bromine, iodine), and the like. Up to four may be substituted.
- alkylthio group in (5) “alkylthio optionally having substituent (s)” as a substituent examples include, for example, methylthio, ethylthio, propylthio, isopropinolethio, ptinolechio, isoptinolethio, sec-pinorethio, pentylthio And linear or branched C 1-8 alkylthio groups such as isopentylthio, neopentylthio, hexylthio, heptylthio and otatylthio groups.
- the substituent of the alkylthio group has the same meaning as the substituent in the aforementioned “hydrocarbon group which may have a substituent”.
- Examples of the substituent in (6) “amino which may have a substituent” as the substituent include alkyl (for example, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutynole, sec-butyl, linear or branched C1-4 alkyl groups such as tert-butinole group, etc., aryl groups (for example, phenyl, 4-methylphenyl, etc.), aralkyl (for example, benzyl, phenethyl, etc.), and acyl Groups (Cl-6 alkanols (eg, formyl, acetyl, propanol, bivaloyl, etc.), aryl carbonyls (eg, benzoyl, etc.), etc.), alkoxycarbonyls (eg, t-butoxycarpoel, etc.), aralkyl Xycarbonyl (for example, benz
- two amino group substituents are joined together and substituted with a cyclic amino (eg, aziridine, azetidine, pyrrolidine, piperidine, lower alkyl (eg, methyl, ethyl, propyl, butyl, etc.)). Pyridine, azepane, morpholine, etc.).
- the (10) “acid group” as a substituent is the same as the substituent in the “optionally substituted hydrocarbon group” represented by I 1 , RR 3 , R ⁇ ring A and ring B described above. Represents the same meaning as "acidic group”.
- heterocyclic group represented by the aforementioned RRR 3 , R 4 , ring A and ring B Has the same meaning as the “heterocyclic group” represented by the substituent in the “cyclic group optionally having”.
- substituents for the carbocyclic group and the heterocyclic group include a hydrocarbon group which may have a substituent, a hydroxyl group, an alkoxy group which may have a substituent, a mercapto group and a group which has a substituent.
- These optional substituents may be substituted at 1 to 4 substitutable positions.
- optionally substituted hydrocarbon group has the same meaning as “optionally substituted hydrocarbon group” represented by RR 2 , R 3 and R 4. .
- the “optionally substituted hydrocarbon group” represented by R x and R Y has the same meaning as the aforementioned “optionally substituted hydrocarbon group” represented by RRR 3 and R 4 .
- the carbon ring represented by ring A is preferably a monocyclic or bicyclic C 5-10 aromatic group which may have a substituent and may be partially or wholly saturated. It is a carbocyclic ring, more preferably an optionally substituted C 5-10 monocyclic aromatic carbocyclic ring, and even more preferably an optionally substituted benzene.
- the heterocyclic ring represented by ring A preferably has a substituent, contains 1 to 3 heteroatoms selected from an oxygen atom, a nitrogen atom or a sulfur atom, part or all thereof
- a 5- to 10-membered monocyclic or bicyclic complex ring which may be saturated, and more preferably an optionally substituted 1,3-oxazole, 1,3-thiazole, They are piperidine, pyridine, 1,3-benzothiazole and 1,3-benzodioxole.
- the substituent of ring A is a hydrocarbon group, a halogen atom, trihalomethylene, trihalomethyloxy, trihalomethylthio, an optionally substituted carbon ring, or an optionally substituted heterocyclic ring. And more preferably a fluorine atom, trifluoromethyl, trifluoromethyloxy, trifluoromethylthio, phenyl which may have a substituent, pyridyl, morpholino, thiomorpholino, piperidino and piperazino. .
- Ring B is preferably a monocyclic or bicyclic aromatic carbocyclic ring having 5 to 10 carbon atoms which may have a substituent, may be partially or wholly saturated, and is more preferably substituted. It is a C 5-10 monocyclic aromatic carbocyclic ring which may have a group, and more preferably benzene which may have a substituent.
- the substituent of ring B is preferably a halogen atom, a hydroxyl group, an alkoxy which may have a substituent, a carbon ring which may have a substituent, or a heterocyclic ring which may have a substituent. It is one or two substituents arbitrarily selected, and more preferably a carbon ring which may have a substituent, or a heterocyclic ring which may have a substituent.
- carbocycle of the “carbocycle optionally having substituent (s)” which is a substituent of ring B, preferably a carbocyclic ring which may have a substituent or is partially or wholly saturated
- heterocycle of the "heterocycle optionally having substituent (s)" which is a substituent of ring B is preferably a nitrogen atom, an oxygen atom and a sulfur atom which may have a substituent.
- the “substituent” in the “carbocycle optionally having substituent (s)” and the “heterocycle optionally having substituent (s)” which are the substituents of ring B preferably have a substituent. 1 to 3 substituents selected from alkyl which may be substituted, alkoxy which may have a substituent, and a halogen atom or an acidic group, more preferably having an acidic group and a substituent.
- “alkyl optionally having substituent (s)” is preferably methyl, ethyl or propyl substituted with an acidic group, and more preferably methyl substituted with an acidic group.
- the preferred acidic groups are optionally carboxy which may be esterified, at least one of the substituents preferably have the c ring B is a carboxy as good force Rupokishi be esterified is preferably
- r represents an integer of 1 to 6, and Q represents an acidic group.
- r is preferably an integer of 1 to 4, more preferably 1 or 2. It is an integer, particularly preferably 1.
- Q is preferably carboxy which may be esterified, and more preferably carboxy.
- n and n are 1 and n is 1, or m is 0 and n is 1, and more preferably m is 1 and n is 1.
- the compounds of the present invention are all preferred, but particularly preferred compounds are those of the general formula (I-A)
- G represents a substituent of a ring
- y represents 0 or an integer of 1 to 4
- T represents a substituent of a ring B which is a ⁇ cyclic group which may have a substituent ''.
- U represents a substituent of ring A
- V represents 0 or an integer of 1 to 5
- w represents 0 or an integer of 1 to 4, and other symbols are as described above.
- Is preferably located at the 3-position in the benzene ring to which it is attached.
- alkyl, alkenyl, alkynyl, alkoxy, alkylthio, alkylene, alkenylene, alkynylene include straight and branched ones.
- isomers in double bonds, rings and condensed rings (E, Z, cis, trans) isomers due to the presence of asymmetric carbon (R, S, ⁇ , configuration, enantiomer, diastereomer), optical rotation Optically active form (D, L, d, 1 form), polar form (high polar form, low polar form) by chromatographic separation, equilibrium compound, rotamer, mixture of any ratio of these, racemic All mixtures are included in the present invention.
- the symbols .... indicate that they are connected to the other side of the paper (that is, the ⁇ -configuration), and ⁇ indicates the front of the paper, as is apparent to those skilled in the art. (Ie, 3 configurations), ⁇ indicates ⁇ configuration, / 3 configuration or a mixture thereof, and ⁇ indicates
- the mixture is a mixture of the arrangement and any ratio of the arrangement.
- salts of the compounds represented by formula (I) are Is included.
- Pharmaceutically acceptable salts are preferably non-toxic and water-soluble. Suitable salts include, for example, salts of alkali metals (such as potassium, sodium, and lithium), salts of alkaline earth metals (such as calcium and magnesium), and ammonium salts (such as tetramethylammonium salt and tetrabutylammonium salt).
- Organic amines triethylamine, methylamine, dimethylamine, cyclopentinoleamine, penzinoleamine, phenethyl / reamine, piperidine, monoethanolamine, diethanolamine, tris (hydroxymethyl) methylamine, lysine, argyun, N-methyl-1D— Glucamine, etc.
- acid adduct salts inorganic acid salts (hydrochloride, hydrobromide, hydroiodide, sulfate, phosphate, nitrate, etc.)
- organic acid salts acetate, trifluoromethane
- the N-oxide refers to a compound represented by the general formula (I) in which a nitrogen atom is oxidized.
- the compound of the present invention can be converted into an N-oxide form by any method.
- the salts and N-oxides of the compound of the present invention also include solvates and solvates of the above-mentioned alkali (earth) metal salts, ammonium salts, organic amine salts and acid adduct salts of the compounds of the present invention.
- the solvate is non-toxic and water-soluble. Suitable solvates include, for example, solvates such as water and alcohol-based solvents (such as ethanol).
- the compound of the present invention is converted into a pharmacologically acceptable salt by a known method.
- the prodrug of the compound represented by the general formula (I) refers to a compound which is converted into the compound represented by the general formula (I) by a reaction with an enzyme, gastric acid, or the like in a living body.
- a prodrug of the compound represented by the general formula (I) when the compound represented by the general formula (I) has an amino group, (E.g., the amino group of the compound represented by the general formula (I) is converted to an eicosanoyl group, an alanyl group, a pentylaminocarbonyl group, a (5-methyl-2-oxo group) (1, 1,3-dioxolen-141-yl) methoxycarbonylation, tetrahydrofuranylation, pyrrolidylmethylation, viva-methyloxymethylation, acetooxymethylation, tert-butylated compounds, etc.);
- General formula (I) When the compound represented by has a hydroxyl group, a compound in which
- the prodrug of the compound represented by the general formula (I) may be either a hydrate or a non-hydrate.
- the PPAR regulator refers to all of the PPARo; type, ⁇ -type, ⁇ -type, ⁇ + ⁇ -type, + ⁇ -type, 1 / + 3-type and 0! + / + 0-type Include.
- a preferred control mode of the present invention is a PPAR S-type regulator or a PPAR ⁇ + CK-type regulator.
- the PPAR controlling agent of the present invention also includes a PPAR agonist and a PPAR antagonist.
- a PPAR agonist Preferably, it is a PPAR agonist, and more Preferably, it is a PPAR ⁇ type agonist or a PPAR ⁇ + ⁇ type agonist.
- the compound of the present invention represented by the general formula (I) can be prepared by a known method, for example, Comprehensive Organic Transformations: A Guide to Functional Group Preoarations N second clothes (by Richard CLarock, John Wiley & Sons Inc, 1999) can be produced by appropriately improving the methods described above, for example, by combining the methods shown below or the methods shown in the examples.
- the starting compound may be used as a salt, such as those described as the pharmaceutically acceptable salt of the above-mentioned general formula (I) can be used.
- R 5 represents a leaving group (e.g., a halogen atom (eg, fluorine, chlorine, bromine, iodine), a mesyloxy group, a tosinoleoxy group, etc.), and ring A and ring A have the same meanings as ring A.
- a leaving group e.g., a halogen atom (eg, fluorine, chlorine, bromine, iodine), a mesyloxy group, a tosinoleoxy group, etc.
- ring A and ring A have the same meanings as ring A.
- the carboxy group, hydroxyl group, amino group and mercapto group contained in the group represented by A ′ are protected if necessary, and the other symbols have the same meanings as described above.
- ⁇ a compound represented by the general formula ( ⁇ )
- ring B ′ has the same meaning as ring B, but the carboxy, hydroxyl, amino, and mercapto groups contained in the group represented by ring B ′ are protected when necessary.
- Reacting the compound represented by Further, the compound can be produced by subjecting the protective group to a deprotection reaction, if necessary.
- the above reaction is known, and examples thereof include organic solvents (tetrohydrofuran (THF), dimethyl ether, methylene chloride, chloroform, carbon tetrachloride, pentane, hexane, benzene, toluene, N, N-dimethylhonolem) Bases (sodium hydride, potassium carbonate, potassium phosphate, triethylamine, pyridine, iodide) in amide (DMF), dimethyl sulfoxide (DMSO), hexamethylphosphamide (HMP A), acetate, etc. 0 to: L at 00 ° C in the presence of sodium, cesium carbonate, etc.
- organic solvents tetrohydrofuran (THF), dimethyl ether, methylene chloride, chloroform, carbon tetrachloride, pentane, hexane, benzene, toluene, N, N-dimethylhono
- the deprotection reaction of the protecting group can be performed by the following method.
- Deprotection reactions of protecting groups for carboxy, hydroxyl, amino or mercapto groups are well known and include, for example, (1) alkaline hydrolysis, (2) deprotection under acidic conditions, (3) Deprotection reaction by hydrogenolysis, (4) deprotection reaction of silyl group, (5) deprotection reaction using metal, (6) deprotection reaction using metal complex, and the like.
- the deprotection reaction by alkali hydrolysis is performed, for example, in an organic solvent (methanol, THF, dioxane, etc.), alkali metal hydroxide (sodium hydroxide, potassium hydroxide, lithium hydroxide, etc.), alkaline earth Using a hydroxide of a class of metals (such as barium hydroxide or calcium hydroxide) or a carbonate (sodium carbonate or carbonated carbonate) or an aqueous solution thereof or a mixture thereof, at a temperature of 0 to 40 ° C. It is.
- an organic solvent methanol, THF, dioxane, etc.
- alkali metal hydroxide sodium hydroxide, potassium hydroxide, lithium hydroxide, etc.
- alkaline earth Using a hydroxide of a class of metals (such as barium hydroxide or calcium hydroxide) or a carbonate (sodium carbonate or carbonated carbonate) or an aqueous solution thereof or a mixture
- the deprotection reaction under acid conditions is carried out, for example, by using an organic solvent (acetic acid, trifluoroacetic acid, methanesulfonic acid, p-tosylic acid) in an organic solvent (dichloromethane, chloroform, dioxane, ethyl acetate, vasole, etc.).
- organic solvent acetic acid, trifluoroacetic acid, methanesulfonic acid, p-tosylic acid
- organic solvent dichloromethane, chloroform, dioxane, ethyl acetate, vasole, etc.
- inorganic acid hydroochloric acid, sulfuric acid, etc.
- a mixture thereof hydroogen bromide, acetic acid, etc.
- Deprotection reactions by hydrogenolysis include, for example, solvents (such as ethers (THF, dioxane, dimethoxyethane (DME), and ethenoleether)), phenolic compounds (such as methanol and ethanol), and benzene.
- solvents such as ethers (THF, dioxane, dimethoxyethane (DME), and ethenoleether)
- phenolic compounds such as methanol and ethanol
- benzene such as benzene.
- the deprotection reaction of the silyl group is carried out, for example, by using tetrabutylammonium fluoride in an organic solvent miscible with water (THF, acetonitrile, etc.) at 0 to 40 ° C. Done at temperature.
- THF tetrabutylammonium fluoride
- acetonitrile acetonitrile
- the deprotection reaction using a metal is performed, for example, in an acidic solvent (acetic acid, a buffer solution of ⁇ 4.2 to 7.2 or a mixture thereof and an organic solvent such as tetrahydrofuran) in the presence of powdered zinc. It is carried out at a temperature of 0 to 40 ° C while applying ultrasonic waves if necessary.
- an acidic solvent acetic acid, a buffer solution of ⁇ 4.2 to 7.2 or a mixture thereof and an organic solvent such as tetrahydrofuran
- the deprotection reaction using a metal complex can be performed, for example, using a trapping reagent (hydrogen) in an organic solvent (such as dichloromethane, DMF, THF, ethyl acetate, acetonitrile, dioxane, or ethanol), water, or a mixed solvent thereof.
- a trapping reagent such as dichloromethane, DMF, THF, ethyl acetate, acetonitrile, dioxane, or ethanol
- water or a mixed solvent thereof.
- Bisalt chloride bis ((totririfueeninyllufofossuffin)) papararadidium ((IIII)), papararadidium acetate (( ⁇ )), The reaction is carried out at a temperature of 0 to 40 ° C. using tris chloride (trifu ⁇ phosphine) rhodium (I) or the like.
- a deprotection reaction can be performed by the method described in Example J or TW Greene, Protective Groups in Organic Synthesis, Wiley, New York, 1999.
- the intended compound of the present invention can be easily produced by properly using these deprotection reactions.
- Examples of the protecting group for the carboxy group include a methyl group, an ethyl group, an aryl group, a t-butyl group, a trichloroethyl group, a benzyl (Bn) group, and a phenacyl group.
- hydroxyl-protecting group examples include a methyl group, a trityl group, a methoxymethyl (MOM) group, a 1-ethoxyshethyl (EE) group, a methoxyethoxymethyl (MEM) group, and a 2-tetrahydroxyvinylinole (THP) group.
- MOM methoxymethyl
- EE 1-ethoxyshethyl
- MEM methoxyethoxymethyl
- TPP 2-tetrahydroxyvinylinole
- Trimethinoresilinole TMS
- TES triethylsilyl
- TDMS t-butyldimethylsilyl
- TDPS t-butyldiphenylsilyl
- acetyl Ac
- bivaloyl benzoyl Group, benzyl (Bn) group, p-methoxybenzyl group, aryloxycarbyl (A1 oc) group, 2,2,2-trichloromouth ethoxycanoleponinole (Tr oc) group, etc. No.
- Examples of the protecting group for the amino group include benzyloxycarbonyl group, t-butoxycarbonyl group, aryloxycarbonyl (A1 oc) group, 1-methylen-1- (4-biphenyl) ethoxycarbonyl. (B poc) group, trifluoroacetyl group, 9-fluorenylmethoxycarbonyl group, benzinole (Bn) group, p-methoxybenzyl group, benzyloxymethyl (BOM) group, 2- (trimethylsilyl) ethoxymethinole (SEM) group And the like.
- Examples of mercapto protecting groups include benzyl, methoxybenzyl, methoxymethyl (MOM), 2-tetrahydroviranyl (THP), Examples include a phenylmethyl group and an acetyl (A c) group.
- the protecting group for a carboxy group, a hydroxyl group, an amino group or a mercapto group is not particularly limited as long as it is a group which can be easily and selectively eliminated, in addition to the above.
- those described in W. reene, Protective Groups m Organic Synthesis, Wiley, New York, 1999 are used.
- the deprotection reaction of the protecting group can be performed in the same manner as described above.
- the above-mentioned reduction reactions include, for example, solvents (such as ethers (THF, dioxane, DME, and getyl ether)), alcohols (such as methanol and ethanol), benzenes (such as benzene and toluene), and ketones.
- solvents such as ethers (THF, dioxane, DME, and getyl ether)
- alcohols such as methanol and ethanol
- benzenes such as benzene and toluene
- ketones Acetone, methyl ethyl ketone, etc.), nitrile type (acetonitrile, etc.), amide type (DMF, etc.), water, ethyl acetate, acetic acid or a mixed solvent of two or more of them, catalyst (palladium-carbon, palladium)
- the reaction is carried out at a temperature of 0 to 200 ° C. in the presence of black, palladium hydro
- the compounds represented by formulas (n), (m) and (IV) are known compounds or can be produced according to known methods or the methods described in Examples.
- 2- (5-methyl-2-phenylenediazole-4-isle) ethanol is described in J. Med. Chem "35, 1853-1864.
- the reaction product is purified by conventional purification means, for example, distillation under normal pressure or reduced pressure, high performance liquid chromatography using silylation gel or magnesium silicate, thin layer chromatography, or color chromatography. It can be purified by a method such as column chromatography or washing and recrystallization. Purification may be performed for each reaction, or may be performed after several reactions are completed.
- conventional purification means for example, distillation under normal pressure or reduced pressure, high performance liquid chromatography using silylation gel or magnesium silicate, thin layer chromatography, or color chromatography. It can be purified by a method such as column chromatography or washing and recrystallization. Purification may be performed for each reaction, or may be performed after several reactions are completed.
- Examples of pharmacological tests other than those described in Examples, particularly in vivo measurement experiments using animals, include the following methods.
- the blood glucose and blood lipid lowering effects of the compound of the present invention can be measured by the following methods.
- mice After receiving male KKAy / Ta Jcl mice (5 mice per group) at the age of 8 weeks, approximately in individual cages
- Pre-breed for one week During the pre-breeding period, feed the solid feed and tap water freely from the water bottle. Next, during the 33rd period, switch to powdered feed and acclimatize the animals, and start the experiment. On the day of the experiment (day 0), the body weight is measured, blood is collected from the tail vein using a microcapillary, and the blood glucose level is measured. Groups are divided by stratified randomization using blood glucose as an index, and 5 animals are assigned per group.
- the body weight was measured in the morning, and fed with a feed containing 0.03% (w / w), 0.01% (w / w), 0.003% (w / w), or powdered feed of the compound of the present invention for the next 6 days.
- Body weight and food consumption are measured on the 4th and 7th morning of administration, and the dose is converted from the average food consumption.
- Blood is collected from the tail vein 6B after the start of administration, and the blood glucose level and plasma triglyceride (TG) level are measured (saturated blood glucose, TG level).
- the amount of food intake was not significant between the control group (powder feed only) and the compound group of the present invention (powder feed containing 0.03% or 0.01% or 0.003% of the compound), and was calculated from the average intake amount.
- the dose is about 4 Omg / kg / day in the feed group containing 0.03%.
- the effect of lowering blood glucose, blood insulin, NEFA or plasma TG levels during satiation in KKAy / Ta mice can be used as a preventive or therapeutic agent for diabetes, hyperlipidemia, arteriosclerosis, etc. It suggests gender. Also, this action It is derived from the activation of P PAR y in vivo. On the other hand, it is suggested that the increase in liver weight and the expression level of hepatic double enzyme reflect the activation of PPAR ⁇ in vivo.
- mice Male Zucker fa / fa rats (strain name: Crj- [ZUC] -fa / fa) and normal control lean rats (strain name: Crj- [ZUC] -lean) at 8 weeks of age and purchased in individual cages Preliminary rearing for about 2 weeks. During the pre-breeding period, the animals are allowed to freely take solid feed and tap water from the automatic water supply device. Simultaneous administration using an oral probe is started 5 days before the start of administration, and the experiment is started. During this time, general condition observations are made, and animals at 10 weeks of age, in which no abnormalities were observed, are used for the test.
- Body weight is measured in the morning of the day of the experiment, blood is collected from the tail vein using a microcapillary, and blood glucose, free fatty acid (NEFA), TG, and HbAlc concentrations are measured. Among them, five animals per group are assigned by the stratified randomization method using the HbAlc value and body weight as indices. In addition, arbitrarily replace the average value of other parameters so that no bias occurs.
- the body weight is measured in the morning, and the compound of the present invention is administered by oral gavage using an oral probe for 13 consecutive days based on the body weight.
- the vehicle 0.5% MC, is administered.
- Food consumption is measured in the morning on days 1, 4, 7, 10, and 13 of administration, and the average food consumption is calculated.
- blood is collected from the tail vein using a microcapillary, and the blood sugar levels “NEFA” TG and HbAlc are measured.
- an oral glucose tolerance test is performed on the 14th day from the start of administration to evaluate the effect of improving glucose tolerance.
- OGTT should be fasted the day before (day 13 after administration), and blood collection should be performed on the next day (day 14 after administration), and then orally administered a 40% glucose solution at a dose of 2 g / SmLZkg. 60 minutes and 120 minutes after glucose loading, blood is collected from the tail vein using a microcapillary, and the blood glucose level is measured.
- Rats are weighed in the morning on the 16th day of administration, and rats are bled from the abdominal vena cava under anesthesia with ethenore, and blood glucose, blood insulin, NEFA, TG, and GOT and GPT are measured using commercially available kits . Also, extract J-Kura and measure its wet weight.
- the toxicity of the compound of the present invention represented by the general formula (I) is extremely low, and is sufficiently safe for use as a medicament.
- the compound of the present invention represented by the general formula (I) or a salt thereof has a PPAR controlling action, and is a hypoglycemic drug, a lipid-lowering drug, diabetes, obesity, metabolic syndrome, hypercholesterolemia, Prophylactic and / or therapeutic agents for metabolic disorders such as proteinemia, hyperlipidemia, arteriosclerosis, hypertension, cardiovascular disease, bulimia, ischemic heart disease, HDL cholesterol-elevating drugs, LDL cholesterol And / or VLD L cholesterol are expected to be applied as a drug for reducing cholesterol and a risk factor reducing drug for diabetes and metapolitic syndrome.
- the compound represented by the general formula (I) or a salt thereof is particularly useful in P PAR ⁇ ago. It is useful as an HD L cholesterol-elevating drug, suppresses arteriosclerosis progression, is effective as a therapeutic drug, a hypolipidemic or hypoglycemic drug, a therapeutic agent for hyperlipidemia, or a therapeutic agent for diabetes It is considered to be useful for reducing the risk of metabolic syndrome and preventing ischemic heart disease.
- the compound may be administered as a concomitant drug in combination with other drugs to reduce the side effects of the compound.
- the concomitant drug of the compound represented by the general formula (I) or a salt thereof and another drug may be administered in the form of a combination drug in which both components are combined in one preparation, or may be prepared as separate preparations. It may be in the form of administration.
- the administration in the form of separate preparations includes simultaneous administration and administration with a time difference.
- the administration by the time difference may be performed by administering the compound represented by the general formula (I) or a salt thereof first and then administering another drug, or administering the other drug first and then administering the general formula (I)
- the compound represented by I) or a salt thereof may be administered later, and the respective administration methods may be the same or different.
- MTP Meromal Triglyceride Transfer Protein
- MTP may be used as another drug for capturing and / or enhancing the lipid-lowering effect of the compound represented by the general formula (I) or a salt thereof, ie, a lipid-improving agent.
- Inhibitors EiMG-A o-reductase inhibitors, squalene synthetase inhibitors, fibrate-based preparations (fibric acid derivatives), ACAT (acyl CoA: cholesterol O-acylase) Transferase) inhibitor, 5-lipoxygenase inhibitor, cholesterol absorption inhibitor, bile acid absorption inhibitor, ileal Na + Z bile acid transporter (BBAT) inhibitor, LDL receptor activity Chemicals / expression enhancers, lipase inhibitors, propcol preparations, nicotinic acid preparations, and other anti-hypercholesterolemia therapeutic agents.
- ACAT acyl CoA: cholesterol O-acylase
- Transferase 5-lipoxygenase inhibitor
- cholesterol absorption inhibitor cholesterol absorption inhibitor
- bile acid absorption inhibitor ileal Na + Z bile acid transporter (BBAT) inhibitor
- LDL receptor activity Chemicals / expression enhancers, lipase inhibitors, propcol preparations, nicotinic
- HMG-CoA reductase inhibitors include atorvastatin, fluvastatin, lonostatin, pitavastatin, pra / statin, rospa'statin, simpastatin and the like.
- ACAT inhibitors include F-12511, F-1394, CI-1011, melinamide and the like. Examples of squalene synthetase inhibitors include TAK-475.
- fibrate-based preparations include gemfibu-mouth gil, clofibrate, bezafibrate, and fenofibrate.
- ACAT inhibitors include C 1-10 11, FCE 27677, RP 73163 and the like.
- Cholesterol absorption inhibitors include SCH48461, etc.
- Bile acid absorption inhibitors include cholestyramine, colesevelam, etc.
- Lipase inhibitors include orlistat, etc.
- Preferred concomitant agents are HMG-CoA reductase inhibitors, cholesterol absorption inhibitors, bile acid absorption inhibitors, and lipase inhibitors.
- drugs for treating diabetes include, for example, sulfonylurea hypoglycemic drugs, biguanide drugs, ⁇ -dalcosidase inhibitors, fast-acting insulin secretagogues, and insulin drugs.
- DP dipeptidyl peptidase 4 inhibitor
- 3 3 adrenergic receptor agonist 3 3 adrenergic receptor agonist
- PPAR PPAR agonist
- Examples of the sulfonylurea hypoglycemic agent include acetohexamide, dalibenclamide, daliclazide, glicloviramide, chlorpropamide, tolazamide, tolptamide, glimepiride and the like.
- Examples of biguanide-based preparations include pformin hydrochloride and metformin hydrochloride.
- ⁇ -Darcosidase inhibitors include acarbose, voglibose and the like.
- Examples of fast-acting insulin secretagogues include nateglinide, repaglinide and the like.
- DP4 inhibitors include NVP-DPP728A and the like.
- j3 3 adrenergic receptor agonists include AJ-96677, BMS-2101285, CP-3331679, KUL-1248, LY-362884, L-1750335 , CP-3331648 and the like.
- PP AR agonists include tesa glitazar (AZ-242), muraglitaza monole (BMS-298 58 5), TAK-555, LY—5 1 0 9 29, ONO—5 1 29, netoglitazone (isaglitazone) ), GW-50 15 16, LY-46 5 608, GW-5 90 735, RO-205-2 349, GW-40 9 544, pioglitazone hydrochloride, rosiglitazone maleate and the like.
- anti-obesity agents examples include, for example, appetite suppressants, lipase inhibitors, 3 adrenoreceptors Body agonist, serotonin norevine It may be used in combination with furin 'dopamine reuptake inhibitor.
- appetite suppressants include leptin, mazindol, amphetamine, methamphetamine and the like.
- knee lipase inhibitors include saristrist and the like.
- the beta 3 Adorenarin receptor agonists AJ- 9677, BMS- 2102 85, CP- 33 1679, UL- 1 248 LY- 362884, L- 750335 s CP- 33 1648 , and the like.
- Serotonin / norepine / nephrine / dopamine reuptake inhibitors include ciptramine and the like.
- the weight ratio of the compound represented by the general formula (I) or a salt thereof to another drug is not particularly limited.
- Other drugs may be administered in any combination of two or more.
- drugs that capture and / or enhance the prophylactic and Z or therapeutic effects of the compound represented by the general formula (I) or a salt thereof include those that have been found to date based on the mechanism described above. Not only that, but also those that will be discovered in the future.
- the compound of the present invention represented by the general formula (I) or a salt thereof, or the combination of the compound represented by the general formula (I) or a salt thereof and another drug for the above-mentioned purpose it is usually systemic or topical. It is administered orally or parenterally. Dosage varies depending on age, body weight, symptoms, therapeutic effect, administration method, treatment time, etc. Usually, per adult, once per day, in the range of lmg to 1000 mg once or several times a day Per parenteral dose, or 13 to several times parenterally in a dose of lmg to 10 Omg per dose per adult, or continuous intravenous dose in the range of 1 to 24 hours per day You.
- the compound of the present invention represented by the general formula (I) or a salt thereof, or the general formula (I) When administering a concomitant drug of a compound represented by or a salt thereof and another drug, a solid preparation for oral administration, a liquid preparation for internal use, an injection for parenteral administration, an external preparation, Used as suppositories, eye drops, inhalants and the like.
- Solid preparations for oral administration include tablets, pills, capsules, powders, granules and the like.
- Capsules include hard capsules and soft capsules.
- one or more active substances may be used as they are or as excipients (ratatose, mannitol, glucose, microcrystalline cellulose, starch, etc.), binders (hydroxypropylcellulose, Mix with rivier pyrrolidone, magnesium metasilicate aluminate, etc.), disintegrant (calcium fiber glycolate, etc.), lubricant (magnesium stearate, etc.), stabilizer, solubilizer (glutamic acid, aspartic acid, etc.) It is formulated and used according to the usual method.
- a coating agent such as sucrose, gelatin, hydroxypropinoresenolylose, hydroxypropinolemethinoresenolyl phthalate
- a coating agent such as sucrose, gelatin, hydroxypropinoresenolylose, hydroxypropinolemethinoresenolyl phthalate
- capsules of absorbable materials such as gelatin.
- Liquid preparations for oral administration include pharmaceutically acceptable solutions, suspensions, emulsions, syrups, elixirs and the like.
- one or more active substances are dissolved, suspended, or emulsified in a commonly used diluent (such as purified water, ethanol, or a mixture thereof).
- the liquid preparation may contain a wetting agent, a suspending agent, an emulsifying agent, a sweetening agent, a flavoring agent, a fragrance, a preservative, a buffering agent and the like.
- the dosage form for external use includes, for example, ointments, gels, creams, compresses, patches, luments, sprays, inhalants, sprays, aerosols, and eye drops Agents, nasal drops and the like. These can be one or more It contains the above active substances and is produced by known methods or commonly used formulations.
- the ointment is manufactured by a known or commonly used formulation. For example, it is manufactured by grinding or melting one or more active substances in a base.
- the softening base is selected from those known or commonly used. For example, higher fatty acids or higher fatty acid esters (adipic acid, myristic acid, palmitic acid, stearic acid, oleic acid, adipic acid ester, myristate esterol, panolemitic acid ester / ester, stearic acid esterol, oleic acid ester, etc.
- Waxes be wax, spermaceti, ceresin, etc.
- surfactants polyoxyethylene alkyl ether phosphate ester, etc.
- higher alcohols cetanol, stearyl alcohol, cetostearyl alcohol, etc.
- hydrocarbons hydrocarbons (hydrophilic petrolatum, white petrolatum, purified lanolin, liquid paraffin, etc.), glycols (ethylene glycol, diethylene glycol cornole, propylene glycol cornole, polyethylene glycol cornole, macrogol, etc.), vegetable oils ( Castor oil, olive oil, sesame oil, turpentine oil, etc., animal oils (mink oil, egg yolk oil, squalane, squalene, etc.), water, absorption enhancer, anti-rash agent used alone or as a mixture of two or more . In addition, it may contain humectants, preservatives, stabilizers, antioxidants, flavors and the like.
- the genole agent is produced by a known or commonly used formulation. For example, it is produced by melting one or more active substances in a base.
- the gel base is selected from known or commonly used ones. For example, lower alcohols (ethanol, isopropyl alcohol, etc.), gelling agents (carboxymethyl / resenololose, hydroxyxetinoresenorelose, hydroxypropinoresenolose, ethylcellulose, etc.), neutralization Agents (triethanolamine, diisopropanolamine, etc.), surfactants (polyethylene glycol monostearate) ), Gums, water, absorption enhancers, and rash preventives alone or as a mixture of two or more.
- preservatives, antioxidants, flavoring agents and the like may be included.
- the cream is produced by a known or commonly used formulation. For example, it is produced by melting or emulsifying one or more active substances in a base.
- the cream base is selected from known or commonly used ones. For example, higher fatty acid esters, lower alcohols, hydrocarbons, polyhydric alcohols (propylene glycol, 1,3-butylene glycol, etc.), higher alcohols (2-hexyldecanol, cetanol, etc.), emulsifiers (polyoxyethylene) Lenalkyl ethers, fatty acid esters, etc.), water, absorption promoters, and rash inhibitors are used alone or in combination of two or more. Further, they may contain preservatives, antioxidants, flavoring agents and the like.
- the poultice is produced by a known or commonly used formulation. For example, it is produced by melting one or more active substances in a base material, spreading the mixture on a support as a kneaded product, and producing the mixture.
- the compress base is selected from known or commonly used ones. For example, thickeners (polyacrylic acid, polybutylpyrrolidone, gum arabic, starch, gelatin, methinoresenololose, etc.), wetting agents (urea, glycerin, propylene glycol, etc.), fillers (kaolin, zinc oxide, , Calcium, magnesium, etc.), water, a solubilizer, a tackifier, and a rash inhibitor alone or as a mixture of two or more. In addition, preservatives, antioxidants, flavoring agents and the like may be included.
- the patch is produced by a known or commonly used formulation. For example, it is produced by melting one or more active substances in a base material, and spreading and coating on a support.
- the base for the patch is selected from those known or commonly used. For example, one selected from a polymer base, oils and fats, higher fatty acids, tackifiers, and rash preventive agents may be used alone or in combination of two or more.
- Additives, antioxidants, flavoring agents and the like may be used alone or in combination of two or more.
- the liniment is manufactured by a known or commonly used formulation.
- one or more active substances may be dissolved or suspended in water, alcohol (ethanol, polyethylene glycol, etc.), higher fatty acid, glycerin, soap, emulsifier, suspending agent, etc., alone or in combination. It is manufactured by turbidity or emulsification. Further, they may contain preservatives, antioxidants, flavoring agents and the like.
- Propellants, inhalants, and sprays may be used in addition to commonly used diluents, buffers to provide isotonicity with stabilizers such as sodium bisulfite, e.g., sodium chloride, sodium taenate or citrate. May be contained. Methods for producing sprays are described in detail, for example, in U.S. Pat. Nos. 2,868,691 and 3,095,355.
- Injections for parenteral administration include solutions, suspensions, emulsions, and solid injections that are used by dissolving or suspending in a solvent for use. Injectables are used by dissolving, suspending or emulsifying one or more active substances in a solvent.
- the solvent for example, distilled water for injection, physiological saline, vegetable oil, propylene glycol, polyethylene glycol, alcohols such as ethanol and the like, and combinations thereof are used.
- this injection contains a stabilizer, a solubilizing agent (daltamic acid, aspartic acid, polysorbate 80 (registered trademark), etc.), a suspending agent, an emulsifier, a soothing agent, a buffer, a preservative, and the like. Is also good. These are manufactured and prepared by sterilization or aseptic procedures in the final step. In addition, a sterile solid preparation, for example, a lyophilized product, can be produced and then used after dissolving in sterile or sterile distilled water for injection or other solvents before use.
- Inhalants for parenteral administration include aerosols, powders for inhalation, and solutions for inhalation, and the solutions for inhalation are dissolved or suspended in water or other appropriate medium before use. It may be in a form.
- inhalants are manufactured according to a known method.
- preservatives benzalkonium chloride, paraben, etc.
- coloring agents for example, coloring agents, buffering agents (sodium phosphate, sodium acetate, etc.), tonicity agents (sodium chloride, concentrated glycerin, etc.)
- buffering agents sodium phosphate, sodium acetate, etc.
- tonicity agents sodium chloride, concentrated glycerin, etc.
- a thickening agent such as a cariboxybul polymer
- an absorption enhancer as needed.
- lubricants stearic acid and its salts, etc.
- binders starch, dextrin, etc.
- excipients lactose, cellulose, etc.
- coloring agents preservatives (benzalcoium chloride, paraben) Etc.) and absorption promoters are appropriately selected and prepared as necessary.
- a nebulizer (atomizer, nebulizer) is usually used to administer inhaled liquids, and a powdered inhaler is usually used to administer inhaled powders.
- compositions for parenteral administration include one or more active substances, including suppositories for rectal administration and pessaries for vaginal administration, formulated in a conventional manner. .
- the solvent in the kakkou indicated by TLC at the point of separation by chromatography indicates the elution solvent or developing solvent used, and the ratio indicates the volume ratio.
- the solvent in kakkoko shown in the NMR section indicates the solvent used for the measurement.
- the compounds used in the present specification are generally a computer program for naming according to the rules of IUPAC, ACD / Name (registered trademark, manufactured by Advanced Chemistry Development Inc.) or ACD ZName batch (registered trademark, Advanced Chemistry Development Inc.) or IUPAC nomenclature Reference Example 1: 1-promo 3- (methoxymethoxy) benzene
- a saturated aqueous ammonium chloride solution (15 OmL) was added to the reaction mixture, and the mixture was stirred for 1 hour while the temperature was raised from 110 ° C to 10 ° C.
- Water was added to the reaction mixture, which was extracted with ethyl acetate. The extract was washed successively with 1N hydrochloric acid, water and saturated saline, dried and concentrated.
- the solid obtained by column purification of the obtained residue was combined with the crystal obtained above to give the title compound (12 g) having the following physical data.
- Example 3 (3,1- ⁇ [(2E) —3-Feuniru 2-propene-1 1-yl] oxy ⁇ bipheninole-3-inole) Acetic acid
- Example 3 (33): (3 ′- ⁇ [5- (trifluoromethyl) -1,3-benzothiazole-1--2-yl] methoxy ⁇ biphenyl-13-yl) acetic acid
- Example 3 [4-chloro-3,-( ⁇ (2E) -13- [4- (tri Fluorometino)) Fuel] — 2—Propene 1—Inole) Oxy) Bifeneru 3—Ill] Acetic acid
- Example 3 [2-Chloro-6-methyl-1-,-( ⁇ (2E) —3 -— [4- (trifluoromethyl) phenyl] —2-propene-1-yl ⁇ oxo) bifueru 3-yl] acetic acid
- Example 3 [6-Fluoro-3 '— ( ⁇ (2E) —3— [4- (trifluoromethyl) phenyl] -1-2-propene-1-yl ⁇ -biphenyl) biru 2-ru 3-yl Acetic acid
- Example 4 Using the compound produced in Reference Example 4 or the corresponding alcohol derivative in place of the compound, and (2E) —3-biphen-nor-1--4-yl-2-propen-1-ol, the corresponding alcohol derivative was used instead of Example 4 ⁇ Subject to the same operation as in Example 5, and if necessary, conversion to the corresponding salt by a known method to obtain the compound of the present invention shown below.
- the following NMR data of the compound of the present invention described characteristic peaks.
- Example 6 (10): (3,1- ⁇ 2- [5-Methyl-2- (4-methylbiperazine-1-yl) -1-3,3-thiazole-14-inole] ethoxy ⁇ bifeninole_2-yl) Acetic acid TLC: R f 0.35 (cloth form: methanol 5: 1);
- Trimethyltin azide (227 mg) was added to a toluene (3.5 mL) solution of the compound (350 mg) produced in Example 10, and the mixture was stirred under reflux for 21 hours.
- Methanol (9 mL) and 2 N hydrochloric acid (6 mL) were added to the reaction mixture, and the mixture was stirred for 20 minutes.
- Water was added to the reaction mixture, which was extracted with ethyl acetate. Organic layer The extract was washed successively with IN hydrochloric acid, water and saturated saline, dried and concentrated. The residue was washed with a mixed solvent of hexane and ethyl acetate to obtain the compound of the present invention (207 mg) having the following physical data.
- Example 12 N- (Methylsulfonyl) -1-2- [3,1-( ⁇ (2E) -3- [4-1- (trifluoromethyl) phenol]]-2-propene-1-inole ⁇ oxo Biphenyl-1-3-yl] acetamide
- Example 14 3 — ⁇ [3 ′ — ( ⁇ (2E) —3— [4— (trifluoromethyl) phenyl] -12-propene-1-yl ⁇ oxy) biphenyl-1--3-yl] methyl ⁇ — 1, 2, 4 oxazine diazo 5 (4H) thione
- the entire procedure was based on basic genetic engineering techniques and utilized techniques commonly used in yeast One-Hybrid or Two-Hybrid systems.
- the measurement method of the present invention is an improvement of measurement accuracy and measurement sensitivity for evaluating the compound of the present invention as described below.
- TK thymidine kinase
- SEQ ID NO: 1 Enhancer sequence obtained by repeating the G a 14 protein response element 5'-T (CGACGGAGTACTGTCCTCCG) X 4 AGCT-3 'Chimeric receptor obtained by fusing the ligand binding region of nuclear receptor human P PARCK, y or ⁇ to the carboxyl terminus of the DNA binding region of yeast Ga14 protein.
- a vector for expressing the protein was prepared as follows. That is, PicaGene Basic Vector 2 (trade name, Toyo Ink Co., Catalog No. 309-04821) was used as a basic expression vector, and the structural gene was replaced with that of the chimeric receptor protein while leaving the promoter's enhancer region intact.
- DNA encoding the human PPARo! Or / and ⁇ ligand-binding domain is fused downstream of the DNA encoding the amino acid sequence from the 1st to the 147th amino acid sequence of the DNA binding region of the Ga14 protein so that the frame matches.
- a nuclear translocation signal derived from SV40 T-antigen, Ala Pro Lys LysLysArgLysValGly (SEQ ID NO: 1) was placed at the amino terminus of the ligand binding region of human PPAR, ⁇ or ⁇ .
- the hemagglutene pitope of Inforerenenza, Tyr Pro Tyr Asp Val Pro Asp Tyr Ala was used as the epitope tag sequence for detection of the expressed protein.
- the DNA sequence was such that the stop codons were arranged in order.
- Human PPARS ligand binding region Ser 139 -Tyr 441 (Corresponding to Ser ⁇ -Tyr 506 in human PPARy 1 and human PPARy 2 and have exactly the same nucleotide sequence.).
- Ser 139 -Tyr 441 Corresponding to Ser ⁇ -Tyr 506 in human PPARy 1 and human PPARy 2 and have exactly the same nucleotide sequence.
- a DNA encoding only the amino acid sequence from the 1st to 147th amino acid sequence of the DNA binding region of the Ga14 protein lacking the PPAR ligand binding region was used.
- the expression vector to have was also adjusted.
- Luciferase using human PPAR, ⁇ or ⁇ CV-1 cells used as host cells were cultured according to a conventional method. That is, fetal calf serum (GffiCO BRL, Power Tag No. 26140-061) was added to Dulbecco's Modified Eagle Medium (DMEM) to a final concentration of 10 ° / 0 , and a final concentration of 5 OU / m1 was added. The cells were cultured in a medium supplemented with penicillin G and 50 ⁇ g / ml of streptomycin sulfate at 37 ° C. in 5% carbon dioxide gas.
- DMEM Dulbecco's Modified Eagle Medium
- the cells were dispersed by trypsinization and replated on a 96-well plate at a cell density of 8000 cells / 100 1 DMEM- 10% dialyzed serum Zwe11.
- 100/1 of a DMEM-10% dialysis serum solution of the compound of the present invention containing twice the assay concentration was added.
- the cells were cultured at 37 ° C for 42 hours to lyse the cells, and the luciferase activity was measured according to a conventional method.
- the relative activity of the compound of the present invention was measured with the luciferase activity value when only a solvent containing no compound was added as 1.0.
- the compound of the present invention showed excellent agonistic activity, especially for P PAR ⁇ .
- the rats were divided into groups and weighed (Friday 0) in the morning (9:00 to 11:00), the rats were weighed under fasting conditions, then blood was collected from the tail vein, and various parameters in plasma were measured. The concentration was measured. The measurement items were low density lipoprotein (LDL), high density lipoprotein (HDL), neutral lipid (triglyceride (TG) value), free fatty acid (NEFA), and total cholesterol (TC) value.
- the animals were divided into groups based on HDL concentration, and 5 animals were assigned per group.
- the day after grouping (1) The body weight was measured in the morning, and the compound was administered by oral gavage once daily for 6 consecutive days, The loading of Sterono charges was continued. The compound was orally administered after dissolving the compound of the present invention in a 0.5% aqueous solution of methylcellulose (MC).
- MC methylcellulose
- Food consumption was measured on the 1st, 4th, and morning of the day following the end of the last treatment, and the average food consumption was calculated. Blood was collected from the tail vein the day after the final administration, and blood lipids (TG, HDL, LDL, NEFA, TC values) after administration of the compound of the present invention were measured. In addition, no significant difference was observed in the food intake between the control group (only 0.5% MC was administered) and the group administered with the compound of the present invention.
- the compound of the present invention increased HDL and decreased LDL depending on the dose, and thus is useful as a therapeutic agent for hyperlipidemia.
- the animals are pre-bred for 14 days, weighed 2 weeks and 1 week before the start of the test, and blood is collected from the saphenous vein of the hind limb, and hematology (red blood cell count, hematocrit, hemoglobin, platelets) Number ⁇ Measurement of leukocyte count) and blood chemistry (GOT, GPT S- anorecaliphosphatase, total protein, urine nitrogen, tareatinin, creatine kinase, total bilirubin, blood sugar, total cholesterol, HDL, ⁇ 01 ⁇ ⁇ (Measurement of chobicho 0) was carried out. The calorie was observed and the general condition was observed. Individuals that grew well during the acclimatization and pre-breeding period were selected and used. In addition, the daily consumption of all animals was measured daily, including the preparatory breeding period.
- Each animal was divided into groups by the stratified randomization method based on the body weight on the end of the acclimation period, and three animals were assigned to each group.
- Body weight was measured in the morning on days 1, 3, 7, 10, and 14 of the administration, and the compound of the present invention was administered based on the newest body weight.
- Diluent Alternatively, a medicinal solution containing the compound of the present invention 3 to 10 Omg / kgZday was intranasally administered once a day using a nutritional catheter and a syringe for 14 consecutive times. After the start of administration, blood is collected on days 1, 7, and 14 before administration of the present compound, and the hematological and blood chemistry tests described above are performed. I confirmed that it had no effect.
- saphenous vein or forearm vein of hind limb Blood samples were collected from blood and measured for blood glucose, total cholesterol, HDL, LDL and TG.
- the compound of the present invention showed an effect of lowering the fasting plasma TG value, TC value and LDL value. Furthermore, it has an inhibitory effect on TG elevation after dietary supplementation, and is therefore useful as a therapeutic agent for hyperlipidemia.
Description
Claims
Priority Applications (3)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
EP04719139A EP1604971A4 (en) | 2003-03-11 | 2004-03-10 | PROCESS FOR ADDING ACTIVE CHARCOAL IN WATER PURIFICATION AND WATER PURIFICATION METHOD |
JP2005503546A JPWO2004080943A1 (ja) | 2003-03-11 | 2004-03-10 | シンナミルアルコール誘導体化合物およびその化合物を有効成分として含有する薬剤 |
US10/548,474 US20070105959A1 (en) | 2003-03-11 | 2004-03-10 | Cynnamyl alcohol derivative compounds and drugs containing the compounds as active ingredient |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
JP2003-65681 | 2003-03-11 | ||
JP2003065681 | 2003-03-11 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2004080943A1 true WO2004080943A1 (ja) | 2004-09-23 |
Family
ID=32984506
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/JP2004/003112 WO2004080943A1 (ja) | 2003-03-11 | 2004-03-10 | シンナミルアルコール誘導体化合物およびその化合物を有効成分として含有する薬剤 |
Country Status (4)
Country | Link |
---|---|
US (1) | US20070105959A1 (ja) |
EP (1) | EP1604971A4 (ja) |
JP (1) | JPWO2004080943A1 (ja) |
WO (1) | WO2004080943A1 (ja) |
Cited By (11)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2007003581A1 (en) | 2005-06-30 | 2007-01-11 | Novo Nordisk A/S | Phenoxy acetic acids as ppar delta activators |
WO2007039177A2 (en) | 2005-09-29 | 2007-04-12 | Sanofi-Aventis | Phenyl- and pyridinyl- 1, 2 , 4 - oxadiazolone derivatives, processes for their preparation and their use as pharmaceuticals |
US7851493B2 (en) | 2005-09-29 | 2010-12-14 | Sanofi-Aventis | Phenyl-1,2,4-oxadiazolone derivatives with phenyl group, processes for their preparation and their use as pharmaceuticals |
US7943613B2 (en) | 2005-12-22 | 2011-05-17 | High Point Pharmaceuticals, Llc | Compounds, their preparation and use |
US7943612B2 (en) | 2006-03-09 | 2011-05-17 | High Point Pharmaceuticals, Llc | Compounds that modulate PPAR activity, their preparation and use |
US7968723B2 (en) | 2004-05-05 | 2011-06-28 | High Point Pharmaceuticals, Llc | Compounds, their preparation and use |
US8053598B2 (en) | 2004-05-05 | 2011-11-08 | High Point Pharmaceuticals, Llc | Compounds, their preparation and use |
KR101104773B1 (ko) * | 2009-06-24 | 2012-01-12 | 동국대학교 경주캠퍼스 산학협력단 | 신남알코올을 함유하는 고혈압 예방 및 치료용 조성물 |
US10456406B2 (en) | 2013-09-09 | 2019-10-29 | Vtv Therapeutics Llc | Use of a PPAR-δ agonist for reducing loss of muscle strength, muscle mass, or type I muscle fibers in an immobilized limb |
US10457679B2 (en) | 2015-09-17 | 2019-10-29 | Astrazeneca Ab | Imidazo[4,5-c]quinolin-2-one compounds and their use in treating cancer |
US11931365B2 (en) | 2022-01-25 | 2024-03-19 | Reneo Pharmaceuticals, Inc. | Use of PPAR-delta agonists in the treatment of disease |
Families Citing this family (9)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2006004030A1 (ja) * | 2004-07-02 | 2006-01-12 | Sankyo Company, Limited | 組織因子産生抑制剤 |
RU2007115900A (ru) | 2004-10-27 | 2008-11-10 | Дайити Санкио Компани, Лимитед (Jp) | Производные бензола, имеющие 2 или более заместителей |
EP1939189A4 (en) * | 2005-08-26 | 2013-03-13 | Shionogi & Co | DERIVATIVE HAVING AGONIST ACTIVITY AGAINST PPAR |
EA019879B1 (ru) * | 2005-12-29 | 2014-07-30 | Лексикон Фармасьютикалз, Инк. | Полициклические производные аминокислот, содержащая их фармацевтическая композиция и способ лечения, использующий эти производные |
AU2007265966B2 (en) | 2006-06-27 | 2012-05-17 | Takeda Pharmaceutical Company Limited | Fused cyclic compounds |
UA99270C2 (en) | 2006-12-12 | 2012-08-10 | Лексикон Фармасьютикалз, Инк. | 4-phenyl-6-(2,2,2-trifluoro-1-phenylethoxy)pyrimidine-based compounds and methods of their use |
EP1932843A1 (en) | 2006-12-14 | 2008-06-18 | sanofi-aventis | Sulfonyl-phenyl-2H-(1,2,4) oxadiazole-5-one derivatives, processes for their preparation and their use as pharmaceuticals |
TW201731506A (zh) * | 2016-01-19 | 2017-09-16 | 第一三共股份有限公司 | 糖尿病治療劑之倂用 |
KR101901491B1 (ko) * | 2016-08-25 | 2018-09-21 | 호서대학교 산학협력단 | 밤꽃으로부터 추출된 앱솔루트 또는 신나밀 알코올을 포함하는 항비만 조성물 |
Citations (9)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1995027692A1 (en) * | 1994-04-08 | 1995-10-19 | Smithkline Beecham Corporation | Subtituted biphenyl tnf inhibitors |
WO1998004508A1 (en) * | 1996-07-31 | 1998-02-05 | Shionogi & Co., Ltd. | NOVEL p-TERPHENYL COMPOUNDS |
WO2000037433A1 (en) * | 1998-12-18 | 2000-06-29 | Abbott Laboratories | Inhibitors of matrix metalloproteinases |
WO2001016120A1 (en) * | 1999-08-27 | 2001-03-08 | Eli Lilly And Company | Biaryl-oxa(thia)zole derivatives and their use as ppars modulators |
US6204293B1 (en) * | 1995-11-06 | 2001-03-20 | University Of Pittsburgh | Inhibitors of protein isoprenyl transferases |
US6288261B1 (en) * | 1998-12-18 | 2001-09-11 | Abbott Laboratories | Inhibitors of matrix metalloproteinases |
WO2002098840A1 (fr) * | 2001-06-04 | 2002-12-12 | Eisai Co., Ltd. | Derive de l'acide carboxylique et medicament comprenant un sel ou un ester dudit derive |
WO2004011446A1 (en) * | 2002-07-26 | 2004-02-05 | Bayer Pharmaceuticals Corporation | Indane, dihydrobenzofuran, and tetrahydronaphthalene carboxylic acid derivatives and their use as antidiabetics |
WO2004022551A1 (ja) * | 2002-09-06 | 2004-03-18 | Takeda Pharmaceutical Company Limited | フランまたはチオフェン誘導体およびその医薬用途 |
-
2004
- 2004-03-10 US US10/548,474 patent/US20070105959A1/en not_active Abandoned
- 2004-03-10 WO PCT/JP2004/003112 patent/WO2004080943A1/ja active Application Filing
- 2004-03-10 EP EP04719139A patent/EP1604971A4/en not_active Withdrawn
- 2004-03-10 JP JP2005503546A patent/JPWO2004080943A1/ja not_active Withdrawn
Patent Citations (9)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1995027692A1 (en) * | 1994-04-08 | 1995-10-19 | Smithkline Beecham Corporation | Subtituted biphenyl tnf inhibitors |
US6204293B1 (en) * | 1995-11-06 | 2001-03-20 | University Of Pittsburgh | Inhibitors of protein isoprenyl transferases |
WO1998004508A1 (en) * | 1996-07-31 | 1998-02-05 | Shionogi & Co., Ltd. | NOVEL p-TERPHENYL COMPOUNDS |
WO2000037433A1 (en) * | 1998-12-18 | 2000-06-29 | Abbott Laboratories | Inhibitors of matrix metalloproteinases |
US6288261B1 (en) * | 1998-12-18 | 2001-09-11 | Abbott Laboratories | Inhibitors of matrix metalloproteinases |
WO2001016120A1 (en) * | 1999-08-27 | 2001-03-08 | Eli Lilly And Company | Biaryl-oxa(thia)zole derivatives and their use as ppars modulators |
WO2002098840A1 (fr) * | 2001-06-04 | 2002-12-12 | Eisai Co., Ltd. | Derive de l'acide carboxylique et medicament comprenant un sel ou un ester dudit derive |
WO2004011446A1 (en) * | 2002-07-26 | 2004-02-05 | Bayer Pharmaceuticals Corporation | Indane, dihydrobenzofuran, and tetrahydronaphthalene carboxylic acid derivatives and their use as antidiabetics |
WO2004022551A1 (ja) * | 2002-09-06 | 2004-03-18 | Takeda Pharmaceutical Company Limited | フランまたはチオフェン誘導体およびその医薬用途 |
Non-Patent Citations (1)
Title |
---|
See also references of EP1604971A4 * |
Cited By (28)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US7968723B2 (en) | 2004-05-05 | 2011-06-28 | High Point Pharmaceuticals, Llc | Compounds, their preparation and use |
US8053598B2 (en) | 2004-05-05 | 2011-11-08 | High Point Pharmaceuticals, Llc | Compounds, their preparation and use |
US8426473B2 (en) | 2005-06-30 | 2013-04-23 | High Point Pharnaceuticals, LLC | Phenoxy acetic acids as PPAR delta activators |
US7943669B2 (en) | 2005-06-30 | 2011-05-17 | High Point Pharmaceuticals, Llc | Phenoxy acetic acids as PPAR delta activators |
WO2007003581A1 (en) | 2005-06-30 | 2007-01-11 | Novo Nordisk A/S | Phenoxy acetic acids as ppar delta activators |
EP2298742A1 (en) | 2005-06-30 | 2011-03-23 | High Point Pharmaceuticals, LLC | Phenoxy acetic acids as PPAR delta activators |
US8217086B2 (en) | 2005-06-30 | 2012-07-10 | High Point Pharmaceuticals, Llc | Phenoxy acetic acids as PPAR delta activators |
WO2007039177A2 (en) | 2005-09-29 | 2007-04-12 | Sanofi-Aventis | Phenyl- and pyridinyl- 1, 2 , 4 - oxadiazolone derivatives, processes for their preparation and their use as pharmaceuticals |
US7709481B2 (en) | 2005-09-29 | 2010-05-04 | Sanofi-Aventis | Phenyl-1,2,4-oxadiazolone derivatives, processes for their preparation and methods for their use as pharmaceuticals |
US7851493B2 (en) | 2005-09-29 | 2010-12-14 | Sanofi-Aventis | Phenyl-1,2,4-oxadiazolone derivatives with phenyl group, processes for their preparation and their use as pharmaceuticals |
US10947180B2 (en) | 2005-12-22 | 2021-03-16 | Vtv Therapeutics Llc | Phenoxy acetic acids and phenyl propionic acids as PPAR delta agonists |
EP2386540A1 (en) | 2005-12-22 | 2011-11-16 | High Point Pharmaceuticals, LLC | Novel compounds, their preparation and use |
US8551993B2 (en) | 2005-12-22 | 2013-10-08 | High Point Pharmaceuticals, Llc | Phenoxy acetic acids as PPAR delta activators |
US8362016B2 (en) | 2005-12-22 | 2013-01-29 | High Point Pharmaceuticals, Llc | Phenyl propionic acids as PPAR delta activators |
US11420929B2 (en) | 2005-12-22 | 2022-08-23 | Vtv Therapeutics Llc | Phenoxy acetic acids and phenyl propionic acids as PPAR delta agonists |
US9663481B2 (en) | 2005-12-22 | 2017-05-30 | Vtv Therapeutics Llc | Phenoxy acetic acids and phenyl propionic acids as PPARδ agonists |
US7943613B2 (en) | 2005-12-22 | 2011-05-17 | High Point Pharmaceuticals, Llc | Compounds, their preparation and use |
US9855274B2 (en) | 2005-12-22 | 2018-01-02 | Vtv Therapeutics Llc | Phenoxy acetic acids and phenyl propionic acids as PPAR delta agonists |
US10471066B2 (en) | 2005-12-22 | 2019-11-12 | Vtv Therapeutics Llc | Phenoxy acetic acids and phenyl propionic acids as PPAR delta agonists |
US7943612B2 (en) | 2006-03-09 | 2011-05-17 | High Point Pharmaceuticals, Llc | Compounds that modulate PPAR activity, their preparation and use |
KR101104773B1 (ko) * | 2009-06-24 | 2012-01-12 | 동국대학교 경주캠퍼스 산학협력단 | 신남알코올을 함유하는 고혈압 예방 및 치료용 조성물 |
US10456406B2 (en) | 2013-09-09 | 2019-10-29 | Vtv Therapeutics Llc | Use of a PPAR-δ agonist for reducing loss of muscle strength, muscle mass, or type I muscle fibers in an immobilized limb |
EP3756661A1 (en) | 2013-09-09 | 2020-12-30 | vTv Therapeutics LLC | Use of a ppar-delta agonist for treating muscle atrophy |
US11096946B2 (en) | 2013-09-09 | 2021-08-24 | Vtv Therapeutics Llc | Use of a PPAR-δ agonist for reducing loss of muscle strength, muscle mass, or type I muscle fibers in an immobilized limb |
US10457679B2 (en) | 2015-09-17 | 2019-10-29 | Astrazeneca Ab | Imidazo[4,5-c]quinolin-2-one compounds and their use in treating cancer |
US10882858B2 (en) | 2015-09-17 | 2021-01-05 | Astrazeneca Ab | Imidazo[4,5-c]quinolin-2-one compounds and their use in treating cancer |
US11613539B2 (en) | 2015-09-17 | 2023-03-28 | Astrazeneca Ab | Imidazo[4,5-c]quinolin-2-one compounds and their use in treating cancer |
US11931365B2 (en) | 2022-01-25 | 2024-03-19 | Reneo Pharmaceuticals, Inc. | Use of PPAR-delta agonists in the treatment of disease |
Also Published As
Publication number | Publication date |
---|---|
US20070105959A1 (en) | 2007-05-10 |
EP1604971A1 (en) | 2005-12-14 |
JPWO2004080943A1 (ja) | 2006-06-08 |
EP1604971A4 (en) | 2006-08-16 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
WO2004080943A1 (ja) | シンナミルアルコール誘導体化合物およびその化合物を有効成分として含有する薬剤 | |
WO2005012221A1 (ja) | ジフェニルエーテル化合物、その製造方法および用途 | |
TWI664166B (zh) | Kcnq2至5通道活化劑 | |
WO2002102780A1 (fr) | Compose derive de tetrahydroquinoline et medicament contenant ledit compose comme principe actif | |
JP3491635B2 (ja) | ジヒドロナフタレン誘導体化合物およびその化合物を有効成分とする薬剤 | |
WO2004080947A1 (ja) | イミノエーテル誘導体化合物およびその化合物を有効成分として含有する薬剤 | |
JP4661595B2 (ja) | フェニル酢酸誘導体、その製造方法および用途 | |
US7323456B2 (en) | Carboxylic acid derivatives compounds and agents comprising the compounds as active ingredient | |
JP6197971B1 (ja) | Kcnq2〜5チャネル関連疾患の予防および/または治療剤 | |
JP2005119998A (ja) | 縮合ベンゼン環化合物、およびその用途 | |
ES2360763T3 (es) | Derivados de piridina para el tratamiento de desórdenes metabólicos relacionados con la resistencia a la insulina o hiperglucemia. | |
JP2004026679A (ja) | ジヒドロナフタレン誘導体 |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): BW GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
WWE | Wipo information: entry into national phase |
Ref document number: 2005503546 Country of ref document: JP |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2007105959 Country of ref document: US Ref document number: 10548474 Country of ref document: US |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2004719139 Country of ref document: EP |
|
WWP | Wipo information: published in national office |
Ref document number: 2004719139 Country of ref document: EP |
|
WWP | Wipo information: published in national office |
Ref document number: 10548474 Country of ref document: US |