WO2012018771A1 - Chronic lymphocytic leukemia (cll) biomarkers - Google Patents
Chronic lymphocytic leukemia (cll) biomarkers Download PDFInfo
- Publication number
- WO2012018771A1 WO2012018771A1 PCT/US2011/046205 US2011046205W WO2012018771A1 WO 2012018771 A1 WO2012018771 A1 WO 2012018771A1 US 2011046205 W US2011046205 W US 2011046205W WO 2012018771 A1 WO2012018771 A1 WO 2012018771A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- cll
- patient
- antibody
- biomarker
- medicament
- Prior art date
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
- A61K39/39533—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals
- A61K39/39558—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals against tumor tissues, cells, antigens
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
- A61P35/02—Antineoplastic agents specific for leukemia
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/57407—Specifically defined cancers
- G01N33/57426—Specifically defined cancers leukemia
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/20—Immunoglobulins specific features characterized by taxonomic origin
- C07K2317/24—Immunoglobulins specific features characterized by taxonomic origin containing regions, domains or residues from different species, e.g. chimeric, humanized or veneered
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/118—Prognosis of disease development
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/90—Enzymes; Proenzymes
- G01N2333/91—Transferases (2.)
- G01N2333/912—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
Definitions
- the present invention concerns chronic lymphocytic leukemia (CLL) biomarkers.
- CLL chronic lymphocytic leukemia
- the invention concerns miRNA151 3p, miRNA409 3p, PTK2, and PI3K, as biomarkers for patient selection in CLL, as well as methods of therapeutic treatment, articles of manufacture and methods for making them, diagnostic kits, and methods of advertising related thereto.
- CLL Chronic lymphocytic leukemia
- follicular NHL Marcus et al, J Clin Oncol. 26:4579-4586 (2008); Hiddemann et al, Blood 106:3725-3732 (2005)
- DLBCL diffuse large B-cell lymphoma
- the mechanisms of action by which rituximab clears B-cells includes antibody dependent cellular cytotoxicity (ADCC) (Golay et al, Blood 95(12):3900-3908 (2000)), complement dependent cytotoxicity (CDC) (Golay et al., Blood 95(12):3900-3908 (2000); Harjunpaa et al, Scand J Immunol. 51(6):634-641(2000)) and direct proapoptotic effects (Hofmeister et al, Blood Cells Mol Dis. 6(2): 133-143 (2000)).
- ADCC antibody dependent cellular cytotoxicity
- CDC complement dependent cytotoxicity
- direct proapoptotic effects Hofmeister et al, Blood Cells Mol Dis. 6(2): 133-143 (2000).
- CD20 antibody based therapy in CLL In addition, Fey receptor polymorphisms that have been linked to the mechanism of action in other NHL entities (Cartron et al., Blood 99(3):754-758 (2002); Weng and Levy, J Clin Oncol. 21(21):3940-7 (2003)) have not been shown to influence the outcome of anti-CD20 based therapy in CLL (Farag et al., Blood 103: 1472-1474 (2004); Dornan et al, Blood (ASH Annual Meeting Abstracts) 114: 2338 (2009)).
- the aim of this study was to discover predictive biomarkers in a large cohort of patients treated within a controlled randomized trial treated with either standard chemotherapy
- FC fludarabine/cyclophosphamide
- R-FC rituximab
- miRNAs are short (17-27 nucleotide) non-coding RNAs involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. MiRNAs can bind to target mRNAs and either inhibit translation or promote degradation thereof, thereby affecting biologic processes. miRNA151 3p is a microRNA found on chromosome 8, which is intronic of PTK2. Publications regarding miRNA151 3p include: Fulci et al. Genes, Chromosomes & Cancer 48 (12): 1069-1082
- the invention herein concerns the identification of biomarkers miRNA151 3p, miRNA409 3p, PTK2, and PI3K as predicting response to therapy in CLL.
- the invention concerns a method for treating a patient with chronic lymphocytic leukemia (CLL) comprising administering a therapeutically effective amount of a CLL medicament to the patient if the patient has been found to have an elevated amount of one or more biomarker selected from miRNA151 3p, miRNA409 3p, and PTK2.
- CLL medicament include:
- CD20 antibodies e.g. humanized, human, or chimeric anti- CD20 antibodies
- Anti-CD20 antibodies such as rituximab, ofatumumab, GA101, SBI-087, veltuzumab, and AME-133.
- the invention provides a method for treating a patient with chronic lymphocytic leukemia (CLL) comprising administering to the patient a therapeutically effective amount of a combination of rituximab, fludarabine and cyclophosphamide, if the patient has been found to have an elevated amount of one or more biomarker selected from miR A151 3p, miRNA409 3p, and PTK2.
- CLL chronic lymphocytic leukemia
- the invention concerns a method for treating a patient with chronic lymphocytic leukemia (CLL) comprising administering to the patient a therapeutically effective amount of CLL medicament other than rituximab, if the patient has been found to have a reduced amount of one or more biomarker selected from miR A151 3p, miRNA409 3p, and PTK2.
- CLL chronic lymphocytic leukemia
- the invention also relates to a method for selecting a therapy for a patient with chronic lymphocytic leukemia (CLL) comprising determining expression of a biomarker selected from miR A151 3p, miRNA409 3p, PTK2, and PI3K, in a sample from the patient, and selecting a CLL medicament based on the level of expression of the biomarker.
- CLL chronic lymphocytic leukemia
- the patient is selected for treatment with a CLL medicament (e.g. one which induces FAK signaling or homotypic adhesion, or which is a B-cell antagonist such as a CD20 antibody) if the cancer sample expresses the biomarker at an elevated level.
- a CLL medicament e.g. one which induces FAK signaling or homotypic adhesion, or which is a B-cell antagonist such as a CD20 antibody
- the patient is selected for treatment with a CLL medicament other than rituximab if the cancer sample expresses the biomarker at a reduced level.
- the invention also provides a diagnostic kit comprising one or more reagents for determining expression of a biomarker selected from miR A151 3p, miRNA409 3p, PTK2, and PI3K, in a sample from a CLL patient.
- the invention also concerns a article of manufacture comprising, packaged together, a CLL medicament in a pharmaceutically acceptable carrier and a package insert indicating that the CLL medicament is for treating a patient with chronic lymphocytic leukemia (CLL) based on expression of one or more biomarker selected from miR A151 3p, miRNA409 3p, PTK2, and PI3K.
- CLL chronic lymphocytic leukemia
- the invention concerns a method for manufacturing an article of manufacture comprising combining in a package a pharmaceutical composition comprising a CLL medicament and a package insert indicating that the pharmaceutical composition is for treating a patient with chronic lymphocytic leukemia (CLL) based on expression of one or more biomarker selected from miRNA151 3p, miRNA409 3p, PTK2, and PI3K.
- CLL chronic lymphocytic leukemia
- the invention concerns a method for advertising a CLL medicament comprising promoting, to a target audience, the use of the CLL medicament for treating a patient with chronic lymphocytic leukemia (CLL) based on expression of one or more biomarker selected from miRNA151 3p, miRNA409 3p, PTK2, and PI3K.
- CLL chronic lymphocytic leukemia
- the invention concerns a method for treating a patient with chronic lymphocytic leukemia (CLL) comprising administering a therapeutically effective amount of a CLL medicament to the patient if the patient has been found to have reduced PI3K biomarker.
- CLL chronic lymphocytic leukemia
- the invention in one aspect provides a method for treating a patient with chronic lymphocytic leukemia (CLL) comprising administering to the patient a therapeutically effective amount of a combination of rituximab, fludarabine and cyclophosphamide, if the patient has been found to have reduced PI3K biomarker.
- CLL chronic lymphocytic leukemia
- a method for treating a patient with chronic lymphocytic leukemia comprising administering to the patient a therapeutically effective amount of CLL medicament other than rituximab, if the patient has been found to have elevated PI3K biomarker.
- CLL chronic lymphocytic leukemia
- Figure 1 A depicts progression free survival (PFS) with respect to miRNA151 3p expression (array based) and therapy.
- Figure IB depicts PFS with respect to miRNA151 3p expression (qRT-PCR based) and therapy.
- Figure 2A depicts PFS with respect to miRNA409 3p expression (array based) and therapy.
- Figure 2B depicts PFS with respect to miRNA409 3p expression (qRT-PCR based) and therapy.
- Figure 3 depicts AFFYMETRIX ® Exon 1.0 ST PFS with respect to treatment and PTK2 expression.
- Figure 4 depicts AFFYMETRIX ® U133+2 PFS with respect to treatment and PTK2 expression.
- Figure 5 depicts qRT-PCR: PFS with respect to treatment and PTK2 expression.
- Figure 6 depicts targeting of 3 'UTRs by miRNAl 51 3p.
- HeLa cells were trans fected with miRNAl 51 3p or NTC as described in methods. Repression of each construct by miRNAl 51 3p was normalized to NTC. Data are derived from three biological replicates. Statistical significance was determined by a 2-sided Student's t-test. **P ⁇ 0.01, *P ⁇ 0.05.
- Figures 8A-8C depict outcome association for PIK3R3 expression: FCR vs. FC treatment effect of PIK3R3 expression subgroups ( Figure 8 A); prognostic effect of PIK3R3 expression in FC arm ( Figure 8B); and effect of PIK3R3 expression in FCR arm ( Figure 8C).
- Marker cutoff refers to PIK3R3 expression at the specified quartile or as a continuous variable.
- CLL Chironic lymphocytic leukemia
- first line or “untreated” CLL (i.e. where the CLL patient has received no prior therapy for treating the CLL), "previously treated CLL” (where the CLL patient has received prior therapy for the CLL), “refractory” CLL (where the patient is refractory to therapy for CLL), “relapsed CLL” (where the patient has relapsed following prior therapy for the CLL).
- a “patient” is a human patient.
- the patient may be a "CLL patient,” i.e. one who is suffering or at risk for suffering from one or more symptoms of CLL.
- the patient may be a previously treated CLL patient.
- a "previously treated" CLL patient has received prior CLL therapy, such therapy including chlorambucil (with or without prednisone/prednisolone), fludarabine (or other nucleoside analog), and/or an alkyaltor-containing combination regimen.
- prior CLL therapy such therapy including chlorambucil (with or without prednisone/prednisolone), fludarabine (or other nucleoside analog), and/or an alkyaltor-containing combination regimen.
- Such previously treated CLL patients are optionally sensitive or reflactory to prior aklylating agents, but are preferably sensitive to fludarabine (e.g. achieving a response that lasted 6 months or more).
- a refractory cancer is one which is refractory to any one or more of: nucleoside analogue (e.g. fludarabine), cyclophosphamide; fludarabine and cyclophosphamide (FC); chlorambucil; prednisone or prednisolone; akylator-containing combination therapy, including cyclophosphamide, vincristine, prednisolone (CHOP), or cyclophosphamide, vincristine, prednisolone (CVP); alemtuzumab (Campath); etc.
- nucleoside analogue e.g. fludarabine
- cyclophosphamide e.g. fludarabine
- fludarabine and cyclophosphamide e.g. fludarabine and cyclophosphamide (FC)
- chlorambucil e.g. fludarabine
- CLL medicament is a drug effective for treating CLL.
- CLL medicaments include the chemotherapeutic agents and chemotherapy regimens noted below; B cell antagonists , such as CD20 antibodies (e.g. rituximab or ofatumumab etc), CD22 antibodies, and CD79b antibodies; intravenous immune globulin; CD52 antibodies (e.g.
- alemtuzumab alemtuzumab
- alkylating agents e.g. chlorambucil, bendamustine, or cyclophosphamide
- nucleoside analogues or antimetabolites e.g. fludarabine, fludarabine and cyclophosphamide (FC)
- prednisone or prednisolone akylator-containing combination therapy, including cyclophosphamide, vincristine, prednisolone (CHOP), or cyclophosphamide, vincristine, prednisolone (CVP); etc.
- the CLL medicament induces FAK signaling and/or homotypic aggregation.
- FAK signaling refers to the upregulation or activation of FAK (e.g. via
- phosphorylation of Tyr 397 of FAK including activation of downstream signalling molecules such as Src kinase, growth factor receptor binding protein 2 adaptor protein (Grb2), and/or Ras/mitogen-activated protein kinase pathway due to FAK activation.
- downstream signalling molecules such as Src kinase, growth factor receptor binding protein 2 adaptor protein (Grb2), and/or Ras/mitogen-activated protein kinase pathway due to FAK activation.
- Homotypic adhesin or “homotypic aggregation” refers to interaction and attachment of the same cells to each other, which may lead to programmed cell death.
- Methods for identifying CLL medicaments or B-cell antagonists (e.g. CD20 antibodies) which induce homotypic aggregation can be evaluated as described in Ivanov et al. J. Clin. Invest. 119(8): 2143-2159 (2009) or Altomonte et al. J. Cell. Physiol 200: 272-274 (2004).
- biomarker refers generally to a molecule, including a gene, mRNA, protein, carbohydrate structure, or glycolipid, the expression of which in or on a tissue or cell or secreted can be detected by known methods (or methods disclosed herein) and is predictive or can be used to predict (or aid prediction) for a cell, tissue, or patient's responsiveness to treatment regimes.
- biomarkers of particular interest herein are PTK2, miRNA151 3p, and miRNA409 3p.
- PTK2 Protein-tyrosine kinase 2
- FADK 1 focal adhesion kinase 1
- PTK2 refers to DNA or mRNA encoding PTK2, as well as PTK2 protein encoded, including fragments or portions of any of these which facilitate detection of PTK2 in a sample.
- PTK2 sequences are publicly available at:
- PTK2 is lso known as: FAK; FADK; FAK1; FRNK; ppl25FAK; PTK2.
- PTK2 gene encodes a cytoplasmic protein tyrosine kinase which is found concentrated in the focal adhesions that form between cells growing in the presence of extracellular matrix constituents.
- the encoded protein is a member of the focal adhesion kinase (FAK) subfamily of protein tyrosine kinases but lacks significant sequence similarity to kinases from other subfamilies.
- FAK focal adhesion kinase
- Activation of this gene may be an important early step in cell growth and intracellular signal transduction pathways triggered in response to certain neural peptides or to cell interactions with the extracellular matrix.
- PTK2 includes each of the isoforms thereof, including isoforms 1, 2, 3, and 4 (Q05397-1, -2, -3, and -4 respectively).
- PTK2 DNA, mRNA, and/or protein can be evaluated according to the present invention.
- Phosphoinositide 3-kinase and “PI3K” refer to human phosphoinositide 3-kinase, including subunits thereof.
- PDKs are lipid kinases capable of phosphyorylating the 3 ⁇ of the inositol ring of phosphoinositides.
- PI3K herein includes Class I (including Class IA and Class IB), Class II, and Class III PDKs.
- the PI3K is a Class I PI3K, and, optionally, the PI3K comprises a regulatory subunit thereof, such as regulatory subunit 3 (PIK3R3).
- PI3K (and synonyms) refer to DNA or mRNA encoding PI3K, or PI3K protein (including a subunit of PI3K), as well as fragments or portions of any of these which facilitate detection of PI3K in a sample.
- the PI3K DNA, mRNA, and/or protein, as well as PI3K activation can be evaluated according to the present invention.
- reduced PI3K biomarker refers to reduced amount and/or activity, of P13K biomarker
- elevated PI3K biomarker refers increased amount and/or activity, of P13K biomarker.
- Phosphoinositide-3 -kinase, regulatory subunit 3 (gamma)," “PIK3R3,” and “p55- gamma” refer to human regulatory subunit 3 of PI3K capable of interacting with PI3K catalytic subunits (110 kDa). See, for example, Dey et al. Gene 209(1-2): 175-83 (1998), Ingham et al. J. Biol. Chem. 276(15): 12257-65 (2001), and UniProtKB/Swiss-Prot: P55G
- PIK3R3 isoforms are expressly included in this definition.
- PIK3R3 (and synonyms) refer to DNA or mRNA encoding PIK3K3, or PIK3R3 protein, as well as fragments or portions of any of these which facilitate detection of PIK3R3 in a sample.
- PIK3R3 DNA, mRNA, and/or protein, and/or PIK3R3 activation (or activation of PI3K comprising PIK3R3) can be evaluated according to the present invention.
- microRNA or “miRNA” is a short (generally about 15-30 nucleotide) non-coding RNA that is involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs.
- miRNA151 3p when used herein refers to a miRNA comprising the sequence: CUAGACUGAAGCUCCUUGAGG (SEQ ID NO: 1). See also:
- miRNA151 3p is intronic to and co-expressed with PTK.
- the term includes DNA or mRNA including fragments or portions thereof which facilitate detection of miRNA151 3p in a sample.
- RNA409 3p used herein refers to RNA comprising the sequence:
- the term includes DNA or mR A including fragments or portions thereof which facilitate detection of miRNA409 3p in a sample.
- tissue sample is meant a collection of similar cells obtained from a CLL patient.
- the source of the tissue or cell sample may be solid tissue as from a fresh, frozen and/or preserved organ or tissue sample or biopsy or aspirate; blood or any blood constituents; bodily fluids such as cerebral spinal fluid, amniotic fluid, peritoneal fluid, or interstitial fluid; cells from any time in gestation or development of the subject.
- the tissue sample may contain compounds which are not naturally intermixed with the tissue in nature such as preservatives, anticoagulants, buffers, fixatives, nutrients, antibiotics, or the like.
- tumor samples herein include, but are not limited to, tumor biopsies, circulating tumor cells, serum or plasma, Peripheral Blood Mononuclear Cells (PBMCs), circulating plasma proteins, ascitic fluid, primary cell cultures or cell lines derived from tumors or exhibiting tumor-like properties, as well as preserved tumor samples, such as formalin-fixed, paraffin-embedded tumor samples or frozen tumor samples.
- PBMCs Peripheral Blood Mononuclear Cells
- ascitic fluid primary cell cultures or cell lines derived from tumors or exhibiting tumor-like properties
- preserved tumor samples such as formalin-fixed, paraffin-embedded tumor samples or frozen tumor samples.
- the sample comprisese Peripheral Blood
- PBMCs Mononuclear Cells
- an "effective response" of a patient or a patient's “responsiveness” to treatment with a medicament and similar wording refers to the clinical or therapeutic benefit imparted to a patient at risk for, or suffering from, CLL upon administration of the CLL medicament.
- Such benefit includes any one or more of: extending survival (including overall survival and progression free survival); resulting in an objective response (including a complete response or a partial response);o improving signs or symptoms of CLL, etc.
- the biomarker is used to identify the patient who is expected to have greater progression free survival (PFS) when treated with a medicament, relative to a patient who does not express the biomarker at the same level.
- PFS progression free survival
- the incidence of biomarker(s) herein effectively predicts, or predicts with high sensitivity, such effective response.
- “Survival” refers to the patient remaining alive, and includes overall survival as well as progression free survival.
- “Overall survival” refers to the patient remaining alive for a defined period of time, such as 1 year, 5 years, etc from the time of diagnosis or treatment.
- progression free survival refers to the patient remaining alive, without the cancer progressing or getting worse.
- extending survival is meant increasing overall or progression free survival in a treated patient relative to an untreated patient (i.e. relative to a patient not treated with the medicament), or relative to a patient who does not express a biomarker at the designated level, and/or relative to a patient treated with an approved anti-tumor agent (such as chemotherapy regimen of fludarabine and cyclophosphamide, FC).
- an approved anti-tumor agent such as chemotherapy regimen of fludarabine and cyclophosphamide, FC.
- An “objective response” refers to a measurable response, including complete response (CR) or partial response (PR).
- Partial response refers to a decrease in the size of one or more tumors or lesions, or in the extent of cancer in the body, in response to treatment.
- the “amount” or “level” of a biomarker associated with an increased clinical benefit to a CLL patient is a detectable level in a biological sample. These can be measured by methods known to the expert skilled in the art and also disclosed by this invention. The expression level or amount of biomarker assessed can be used to determine the response to the treatment.
- an “elevated” or “high” amount or level of a biomarker refers to an amount that is equal to or greater than the median amount of the biomarker in a patient population, e.g. in a population of patients with CLL, or in a subpopulation of CLL patients (e.g. previously treated CLL patients).
- the amount may be in a percentile range from 50% to about 100%, e.g. from about 75-100%.
- a “reduced” or “low” amount or level of a biomarker refers to an an amount that is lower than the median amount of the biomarker in a patient population. For example, the amount may be in a percentile range from 0% to about 49%, e.g. from about 0-25%.
- the phrase "based on expression of when used herein means that information about expression level of the one or more biomarkers herein is used to inform a treatment decision, information provided on a package insert, or marketing/promotional guidance etc.
- patients may be treated with a CLL medicament such as a B-cell antagonist, e.g. CD20 antibody, such as rituximab.
- a CLL medicament other than rituximab or other than an anti-CD20 antibody).
- B-cell surface marker or "B-cell surface antigen” herein is an antigen expressed on the surface of a B cell that can be targeted with an antagonist that binds thereto.
- Exemplary B- cell surface markers include the CD10, CD19, CD20, CD21, CD22, CD23, CD24, CD37,
- B-cell surface markers include RP105, FcRH2, B- cell CR2, CCR6, P2X5, HLA-DOB, CXCR5, FCER2, BR3, BAFF, BLyS, Btig, NAG 14,
- the B-cell surface marker is CD20, CD22, or CD79b.
- CD20 antigen is an about 35-kDa, non-glycosylated phosphoprotein found on the surface of greater than 90% of B cells from peripheral blood or lymphoid organs. CD20 is present on both normal B cells as well as malignant B cells, but is not expressed on stem cells. Other names for CD20 in the literature include "B-lymphocyte-restricted antigen” and "Bp35". The CD20 antigen is described in Clark et al., Proc. Natl. Acad. Sci. (USA), 82: 1766 (1985), for example.
- B-cell antagonist is a molecule that, upon binding to a B-cell surface marker or B- cell specific survival or proliferation factor, destroys or depletes B cells in a mammal and/or interferes with B-cell survival and/or one or more B-cell functions, e.g. by reducing or preventing a humoral response elicited by the B cell.
- the antagonist preferably is able to deplete B cells (i.e. reduce circulating B-cell levels) in a mammal treated therewith. Such depletion may be achieved via various mechanisms such as ADCC and/or CDC, inhibition of B-cell proliferation or direct lysis of B-cells and/or induction of B-cell death (e.g. via apoptosis).
- Antagonists can be screened by various methods known in the art for apoptosis and other measurements for the depletion, and retardation or stopping of proliferation and growth of B cells or survival of B cells.
- An "antibody that binds to a B-cell surface marker” or “antibody to a B-cell surface marker” is a molecule that, upon binding to a B-cell surface marker, destroys or depletes B cells in a mammal and/or interferes with one or more B-cell functions, e.g. by reducing or preventing a humoral response elicited by the B cell.
- the antibody preferably is able to deplete B cells (i.e. reduce circulating B-cell levels) in a mammal treated therewith.
- Such depletion may be achieved via various mechanisms such antibody-dependent cell-mediated cytotoxicity (ADCC) and/or complement-dependent cytotoxicity (CDC), inhibition of B-cell proliferation, and/or induction of B-cell death (e.g. via apoptosis).
- ADCC antibody-dependent cell-mediated cytotoxicity
- CDC complement-dependent cytotoxicity
- B-cell proliferation inhibition of B-cell proliferation
- induction of B-cell death e.g. via apoptosis
- the antibody is an antibody which binds human CD20.
- anti-CD20 antibodies examples include: chimeric anti-CD20 antibodies such as rituximab (see below); human anti-CD20 antibodies such as ofatumumab (sold by Genmab, Denmark; see, also, Glennie and van de Winkel, Drug Discovery Today 8: 503-510 (2003); Cragg et al, Blood 101 : 1045-1052 (2003); WO 2004/035607; and WO 2005/103081);
- humanized anti-CD20 antibodies such as humanized 2H7 (see below) or veltuzumab (hA20) (Goldenberg et al. Blood 113(5): 1062-1070 (2009)); glycosylation variant antibodies, including glycosylation variants with bisected, afucosylated Fc region-carbohydrates such as GA101 (see below); Small Modular ImmunoPharmaceutical (SMIP) or single-chain antibodies such as SBI-087; the yttrium- [90] -labelled 2B8 murine antibody designated "Y2B8" or "Ibritumomab Tiuxetan” (ZEVALIN®) commercially available from Biogen pou, Inc. (e.g., U.S. 5,736,137; 2B8 deposited with ATCC under accession no. HB11388 on June 22, 1993);
- SMIP Small Modular ImmunoPharmaceutical
- ZEVALIN® the yttrium- [90] -labelled 2B8 mur
- A20 antibody or variants thereof such as chimeric or humanized A20 antibody (cA20, bA20, respectively) and IMMUN-106 (e.g., US 2003/0219433,
- a “Type I” CD20 antibody mediates cell death via potent complement-dependent cytotoxicity (CDC) and antibody-dependent cellular cytotoxicity (ADCC).
- Type I anti-CD20 antibodies include rituximab, veltuzumab, ocrelizumab, ofatumumab, and AME- 133.
- a "Type ⁇ " CD20 antibody initiates target cell death via caspase-independent apoptosis with concomitant phosphatidylserine exposure and exhibits stronger homotypic adhesion and ADCC than a Type I anti-CD20 antibody.
- Type II antibodies do not localize CD20 into lipid rafts. Examples of Type II anti-CD20 antibodies include tositumomab (Bl), 11B8, AT80 and humanized B-Lyl antibodies.
- "Rituximab” is a chimeric IgGl anti-CD20 antibody that binds to the CD20 antigen on
- RITUXAN® and is commercially available in other countries from Roche where it is sold under the trademark MABTHERA®.
- Nucleic acid encoding rituximab has been deposited on November 10, 1992 with the ATCC under deposit no. 69119.
- Rituximab's biological activity is understood to involve signaling in target cells on CD20 binding leading to growth inhibition and (nonclassic) apoptosis (referred to as "direct cell death"), complement-dependent cytotoxicity (CDC), and antibody-dependent cellular cytotoxicity (ADCC) mediated by cells displaying Fey receptors (FcyRs), such as FcyRIIIa-expressing NK cells and macrophages.
- Fey receptors Fey receptors
- humanized B-Lyl antibody and "GA101" herein refer to humanized IgGl B-Lyl antibody as disclosed in WO2005/044859 and WO2007/031875, which describe humanized variants of murine monoclonal anti-CD20 antibody B-Lyl .
- the humanized B-Lyl antibody is preferably glycoengineered (GE) in the Fc region according to the procedures described in WO2005/044859, WO2004/065540, WO2007/031875, Umana et al. Nature Biotechnol. 17 (1999) 176-180 (1999), and W01999/54342.
- GE glycoengineered
- the afucosylated glyco- engineered humanized B-Lyl (B-HH6-B-KV1 GE) is preferred in one embodiment of the invention.
- Such glycoengineered humanized B-Lyl antibodies have an altered pattern of glycosylation in the Fc region, preferably having a reduced level of fucose residues.
- the amount of fucose is 60% or less of the total amount of oligosaccharides at Asn297 (in one embodiment the amount of fucose is between 40% and 60%, in another embodiment the amount of fucose is 50% or less, and in still another embodiment the amount of fucose is 30% or less).
- the oligosaccharides of the Fc region are preferably bisected.
- 2H7 or “2H7 antibody” refers to a humanized anti-CD20 antibody comprising the variable domain sequences described in US 2006/0034835 and WO 2004/056312 (both Lowman et al); US 2006/0188495 ( Barron et al); and US 2006/0246004 (Adams et al.). Briefly, humanization of the murine anti-human CD20 antibody, 2H7 (also referred to herein as m2H7, m for murine), was carried out in a series of site-directed mutagenesis steps.
- the murine 2H7 antibody variable region sequences and the chimeric 2H7 with the mouse V and human C have been described, e.g., in U.S. Pat. Nos. 5,846,818 and 6,204,023.
- the CDR residues of 2H7 were identified by comparing the amino acid sequence of the murine 2H7 variable domains (disclosed in U.S. 5,846,818) with the sequences of known antibodies (Kabat et al., Sequences of Proteins of Immunological Interest, Ed. 5 (Public Health Service, National Institutes of Health, Bethesda, MD, 1991)).
- the CDR regions for the light and heavy chains were defined based on sequence
- Plasmids for expression of full-length IgG's were constructed by subcloning the V L and V H domains of chimeric 2H7 Fab as well as humanized Fab versions 2 to 6 into previously described pRK vectors for mammalian cell expression (Gorman et al., DNA Prot. Eng. Tech., 2:3-10 (1990)).
- Ocrelizumab is an example of a humanized 2H7 antibody herein.
- PCR polymerase chain reaction
- sequence information from the ends of the region of interest or beyond needs to be available, such that oligonucleotide primers can be designed; these primers will be identical or similar in sequence to opposite strands of the template to be amplified.
- the 5' terminal nucleotides of the two primers may coincide with the ends of the amplified material.
- PCR can be used to amplify specific RNA sequences, specific DNA sequences from total genomic DNA, and cDNA transcribed from total cellular RNA, bacteriophage or plasmid sequences, etc. See generally Mullis et al, Cold Spring Harbor Symp. Quant. Biol., 51 : 263 (1987); Erlich, ed., PCR Technology, (Stockton Press, NY, 1989).
- PCR is considered to be one, but not the only, example of a nucleic acid polymerase reaction method for amplifying a nucleic acid test sample, comprising the use of a known nucleic acid (DNA or RNA) as a primer and utilizes a nucleic acid polymerase to amplify or generate a specific piece of nucleic acid or to amplify or generate a specific piece of nucleic acid which is complementary to a particular nucleic acid.
- DNA or RNA DNA or RNA
- Quantitative real time polymerase chain reaction or "qRT-PCR” refers to a form of PCR wherein the amount of PCR product is measured at each step in a PCR reaction. This technique has been described in various publications including Cronin et al., Am. J. Pathol. 164(l):35-42 (2004); and Ma et al., Cancer Cell 5:607-616 (2004).
- microarray refers to an ordered arrangement of hybridizable array elements, preferably polynucleotide probes, on a substrate.
- polynucleotide when used in singular or plural, generally refers to any polyribonucleotide or polydeoxribonucleotide, which may be unmodified RNA or DNA or modified RNA or DNA.
- polynucleotides as defined herein include, without limitation, single- and double-stranded DNA, DNA including single- and double-stranded regions, single- and double-stranded RNA, and RNA including single- and double-stranded regions, hybrid molecules comprising DNA and RNA that may be single-stranded or, more typically, double-stranded or include single- and double-stranded regions.
- polynucleotide refers to triple- stranded regions comprising RNA or DNA or both RNA and DNA.
- the strands in such regions may be from the same molecule or from different molecules.
- the regions may include all of one or more of the molecules, but more typically involve only a region of some of the molecules.
- One of the molecules of a triple- helical region often is an oligonucleotide.
- polynucleotide specifically includes cDNAs.
- the term includes DNAs (including cDNAs) and RNAs that contain one or more modified bases.
- DNAs or RNAs with backbones modified for stability or for other reasons are “polynucleotides” as that term is intended herein.
- DNAs or RNAs comprising unusual bases, such as inosine, or modified bases, such as tritiated bases are included within the term “polynucleotides” as defined herein.
- polynucleotide embraces all chemically, enzymatically and/or metabolically modified forms of unmodified polynucleotides, as well as the chemical forms of DNA and RNA characteristic of viruses and cells, including simple and complex cells.
- oligonucleotide refers to a relatively short polynucleotide, including, without limitation, single-stranded deoxyribonucleotides, single- or double-stranded ribonucleotides, RNA:DNA hybrids and double- stranded DNAs. Oligonucleotides, such as single- stranded DNA probe oligonucleotides, are often synthesized by chemical methods, for example using automated oligonucleotide synthesizers that are commercially available.
- oligonucleotides can be made by a variety of other methods, including in vitro recombinant DNA-mediated techniques and by expression of DNAs in cells and organisms.
- Hybridization generally depends on the ability of denatured DNA to reanneal when complementary strands are present in an environment below their melting temperature. The higher the degree of desired homology between the probe and hybridizable sequence, the higher the relative temperature which can be used. As a result, it follows that higher relative temperatures would tend to make the reaction conditions more stringent, while lower temperatures less so.
- Stringency conditions typically: (1) employ low ionic strength and high temperature for washing, for example 0.015 M sodium chloride/0.0015 M sodium citrate/0.1% sodium dodecyl sulfate at 50°C; (2) employ during hybridization a denaturing agent, such as formamide, for example, 50% (v/v) formamide with 0.1% bovine serum albumin/ 0.1% Ficoll/ 0.1% polyvinylpyrrolidone/ 50 mM sodium phosphate buffer at pH 6.5 with 750 mM sodium chloride, 75 mM sodium citrate at 42°C; or (3) employ 50% formamide, 5> ⁇ SSC (0.75 M NaCl, 0.075 M sodium citrate), 50 mM sodium phosphate (pH 6.8), 0.1%) sodium pyrophosphate, 5x Denhard
- Modely stringent conditions may be identified as described by Sambrook et al., Molecular Cloning: A Laboratory Manual, New York: Cold Spring Harbor Press, 1989, and include the use of washing solution and hybridization conditions ⁇ e.g., temperature, ionic strength and % SDS) less stringent that those described above.
- washing solution and hybridization conditions e.g., temperature, ionic strength and % SDS
- An example of moderately stringent conditions is overnight incubation at 37°C.
- chemotherapeutic agent is a chemical compound useful in the treatment of cancer.
- examples of chemotherapeutic agents include alkylating agents such as thiotepa and cyclosphosphamide (CYTOXAN®); alkyl sulfonates such as busulfan, improsulfan and piposulfan; aziridines such as benzodopa, carboquone, meturedopa, and uredopa;
- ethylenimines and methylamelamines including altretamine, triethylenemelamine,
- acetogenins especially bullatacin and bullatacinone
- dronabinol, MARINOL® beta-lapachone
- lapachol colchicines
- betulinic acid a camptothecin (including the synthetic analogue topotecan (HYCAMTIN®), CPT-11
- calicheamicin especially calicheamicin gamma II and calicheamicin omegall (see, e.g., Nicolaou et al., Angew. Chem Intl. Ed. Engl., 33: 183-186 (1994));
- CDP323 an oral alpha-4 integrin inhibitor; dynemicin, including dynemicin A; an esperamicin; as well as neocarzinostatin chromophore and related chromoprotein enediyne antiobiotic chromophores), aclacinomysins, actinomycin, authramycin, azaserine, bleomycins,
- doxorubicin including
- ADRIAMYCIN® morpholino-doxorubicin, cyanomorpholino-doxorubicin, 2-pyrrolino- doxorubicin, doxorubicin HC1 liposome injection (DOXIL®), liposomal doxorubicin TLC D- 99 (MYOCET®), peglylated liposomal doxorubicin (CAELYX®), and deoxydoxorubicin
- epirubicin esorubicin, idarubicin, marcellomycin, mitomycins such as mitomycin C, mycophenolic acid, nogalamycin, olivomycins, peplomycin, potfiromycin, puromycin, quelamycin, rodorubicin, streptonigrin, streptozocin, tubercidin, ubenimex, zinostatin, zorubicin; anti-metabolites such as methotrexate, gemcitabine (GEMZAR®), tegafur
- folic acid analogues such as denopterin, methotrexate, pteropterin, trimetrexate
- purine analogs such as fludarabine, 6-mercaptopurine, thiamiprine, thioguanine
- pyrimidine analogs such as ancitabine, azacitidine, 6-azauridine, carmofur, cytarabine, dideoxyuridine, doxifluridine, enocitabine, floxuridine
- anti-adrenals such as aminoglutethimide, mitotane, trilostane
- folic acid replenisher such as frolinic acid; aceglatone; aldophosphamide glycoside; aminolevulinic acid; eniluracil; amsacrine; bestrabucil; bisantrene; edatraxate; defofamine;
- diaziquone diaziquone; elfornithine; elliptinium acetate; etoglucid; gallium nitrate; hydroxyurea; lentinan; lonidainine; maytansinoids such as maytansine and ansamitocins; mitoguazone; mitoxantrone; mopidanmol; nitraerine; pentostatin; phenamet; pirarubicin; losoxantrone; 2-ethylhydrazide; procarbazine; PSK® polysaccharide complex (JHS Natural Products, Eugene, OR); razoxane; rhizoxin; sizofiran; spirogermanium; tenuazonic acid; triaziquone; 2,2',2"- trichlorotriethylamine; trichothecenes (especially T-2 toxin, verracurin A, roridin A and anguidine); ure
- paclitaxel TAXOL®
- albumin- engineered nanoparticle formulation of paclitaxel ABRAXANETM
- docetaxel TAXOL®
- TXOTERE® chloranbucil; 6-thioguanine; mercaptopurine; methotrexate; platinum agents such as cisplatin, oxaliplatin, and carboplatin; vincas, which prevent tubulin polymerization from forming microtubules, including vinblastine (VELBAN®), vincristine (ONCOVIN®), vindesine (ELDISINE®, FILDESIN®), and vinorelbine (NAVELBINE®); etoposide (VP- 16); ifosfamide; mitoxantrone; leucovovin; novantrone; edatrexate; daunomycin; aminopterin; ibandronate; topoisomerase inhibitor RFS 2000; difluorometlhylornithine (DMFO); retinoids such as retinoic acid, including bexarotene (TARGRETIN®); bisphosphonates such as clodronate (for example, BONEFOS
- AREDIA® tiludronate
- SKELID® tiludronate
- ACTONEL® risedronate
- troxacitabine a 1 ,3- dioxolane nucleoside cytosine analog
- antisense oligonucleotides particularly those that inhibit expression of genes in signaling pathways implicated in aberrant cell proliferation, such as, for example, PKC-alpha, Raf, H-Ras, and epidermal growth factor receptor (EGF-R)
- vaccines such as THERATOPE® vaccine and gene therapy vaccines, for example,
- ALLOVECTIN® vaccine, LEUVECTIN® vaccine, and VAXID® vaccine ; topoisomerase 1 inhibitor (e.g., LURTOTECAN®); rmRH (e.g., ABARELLX®); BAY439006 (sorafenib; Bayer); SU-1 1248 (Pfizer); perifosine, COX-2 inhibitor (e.g. celecoxib or etoricoxib), proteosome inhibitor (e.g.
- ELOXATINTM oxaliplatin
- chemotherapeutic agents include “anti-hormonal agents” or “endocrine therapeutics” which act to regulate, reduce, block, or inhibit the effects of hormones that can promote the growth of cancer. They may be hormones themselves, including, but not limited to: anti-estrogens with mixed agonist/antagonist profile, including, tamoxifen
- SERM3 selective estrogen receptor modulators
- SERM3 pure anti-estrogens without agonist properties, such as fulvestrant (FASLODEX®), and EM800 (such agents may block estrogen receptor (ER) dimerization, inhibit DNA binding, increase ER turnover, and/or suppress ER levels); aromatase inhibitors, including steroidal aromatase inhibitors such as formestane and exemestane (AROMASIN®), and nonsteroidal aromatase inhibitors such as anastrazole (ARIMIDEX®), letrozole
- FEMARA® aminoglutethimide
- other aromatase inhibitors include vorozole
- RIVISOR® megestrol acetate
- MEGASE® megestrol acetate
- fadrozole 4(5)-imidazoles
- lutenizing hormone-releaseing hormone agonists including leuprolide (LUPRON® and ELIGARD®), goserelin, buserelin, and tripterelin
- sex steroids including progestines such as megestrol acetate and medroxyprogesterone acetate, estrogens such as diethylstilbestrol and premarin, and androgens/retinoids such as fluoxymesterone, all transretionic acid and fenretinide
- progestines such as megestrol acetate and medroxyprogesterone acetate
- estrogens such as diethylstilbestrol and premarin
- androgens/retinoids such as fluoxymesterone, all transretionic acid and fenretinide
- chemotherapeutic agents or chemotherapy regimens herein include: alkylating agents (e.g. chlorambucil, bendamustine, or cyclophosphamide); nucleoside analogues or antimetabolites (e.g. fludarabine), fludarabine and cyclophosphamide (FC);
- alkylating agents e.g. chlorambucil, bendamustine, or cyclophosphamide
- nucleoside analogues or antimetabolites e.g. fludarabine), fludarabine and cyclophosphamide (FC)
- prednisone or prednisolone akylator-containing combination therapy, including
- cyclophosphamide vincristine, prednisolone (CHOP), or cyclophosphamide, vincristine, prednisolone (CVP), etc.
- a "target audience” is a group of people or an institution to whom or to which a particular medicament is being promoted or intended to be promoted, as by marketing or advertising, especially for particular uses, treatments, or indications, such as individual patients, patient populations, readers of newspapers, medical literature, and magazines, television or internet viewers, radio or internet listeners, physicians, drug companies, etc.
- a "package insert” is used to refer to instructions customarily included in commercial packages of therapeutic products, that contain information about the indications, usage, dosage, administration, contraindications, other therapeutic products to be combined with the packaged product, and/or warnings concerning the use of such therapeutic products, etc.
- antibody herein is used in the broadest sense and encompasses various antibody structures, including but not limited to monoclonal antibodies, polyclonal antibodies, multispecific antibodies (e.g., bispecific antibodies), and antibody fragments so long as they exhibit the desired antigen-binding activity.
- antibody fragment refers to a molecule other than an intact antibody that comprises a portion of an intact antibody that binds the antigen to which the intact antibody binds.
- antibody fragments include but are not limited to Fv, Fab, Fab', Fab'-SH, F(ab') 2 ; diabodies; linear antibodies; single-chain antibody molecules (e.g. scFv); and multispecific antibodies formed from antibody fragments.
- an “affinity matured” antibody refers to an antibody with one or more alterations in one or more hypervariable regions (HVRs), compared to a parent antibody which does not possess such alterations, such alterations resulting in an improvement in the affinity of the antibody for antigen.
- HVRs hypervariable regions
- an "antibody that binds to the same epitope” as a reference antibody refers to an antibody that blocks binding of the reference antibody to its antigen in a competition assay by 50% or more, and conversely, the reference antibody blocks binding of the antibody to its antigen in a competition assay by 50% or more.
- An exemplary competition assay is provided herein.
- the antibody binds to the same epitope as rituximab, ofatumumab, GA101, SBI-087, veltuzumab, or AME-133.
- chimeric antibody refers to an antibody in which a portion of the heavy and/or light chain is derived from a particular source or species, while the remainder of the heavy and/or light chain is derived from a different source or species.
- the "class" of an antibody refers to the type of constant domain or constant region possessed by its heavy chain.
- the heavy chain constant domains that correspond to the different classes of immunoglobulins are called ⁇ , ⁇ , ⁇ , ⁇ , and ⁇ , respectively.
- cytotoxic agent refers to a substance that inhibits or prevents a cellular function and/or causes cell death or destruction.
- Cytotoxic agents include, but are not limited to, radioactive isotopes (e.g., At 211 , 1 131 , 1 125 , Y 90 , Re 186 , Re 188 , Sm 153 , Bi 212 , P 32 , Pb 212 and radioactive isotopes of Lu); chemotherapeutic agents or drugs (e.g., methotrexate, adriamicin, vinca alkaloids (vincristine, vinblastine, etoposide), doxorubicin, melphalan, mitomycin C, chlorambucil, daunorubicin or other intercalating agents); growth inhibitory agents; enzymes and fragments thereof such as nucleolytic enzymes; antibiotics; toxins such as small molecule toxins or enzymatically active toxins of bacterial, fungal
- Antibody effector functions refer to those biological activities attributable to the Fc region of an antibody, which vary with the antibody isotype. Examples of antibody effector functions include: Clq binding and complement dependent cytotoxicity (CDC); Fc receptor binding; antibody-dependent cell-mediated cytotoxicity (ADCC); phagocytosis; down regulation of cell surface receptors (e.g. B cell receptor); and B cell activation.
- Fc region herein is used to define a C-terminal region of an
- immunoglobulin heavy chain that contains at least a portion of the constant region.
- the term includes native sequence Fc regions and variant Fc regions.
- a human IgG heavy chain Fc region extends from Cys226, or from Pro230, to the carboxyl-terminus of the heavy chain.
- the C-terminal lysine (Lys447) of the Fc region may or may not be present.
- numbering of amino acid residues in the Fc region or constant region is according to the EU numbering system, also called the EU index, as described in Kabat et al., Sequences of Proteins of Immunological Interest, 5th Ed. Public Health Service, National Institutes of Health, Bethesda, MD, 1991.
- FR Framework or "FR” refers to variable domain residues other than hypervariable region (HVR) residues.
- the FR of a variable domain generally consists of four FR domains: FR1, FR2, FR3, and FR4. Accordingly, the HVR and FR sequences generally appear in the following sequence in VH (or VL): FR1-H1(L1)-FR2-H2(L2)-FR3-H3(L3)-FR4.
- full length antibody “intact antibody,” and “whole antibody” are used herein interchangeably to refer to an antibody having a structure substantially similar to a native antibody structure or having heavy chains that contain an Fc region as defined herein.
- a "human antibody” is one which possesses an amino acid sequence which corresponds to that of an antibody produced by a human or a human cell or derived from a non-human source that utilizes human antibody repertoires or other human antibody-encoding sequences. This definition of a human antibody specifically excludes a humanized antibody comprising non-human antigen-binding residues.
- a “humanized” antibody refers to a chimeric antibody comprising amino acid residues from non-human HVRs and amino acid residues from human FRs.
- a humanized antibody will comprise substantially all of at least one, and typically two, variable domains, in which all or substantially all of the HVRs (e.g., CDRs) correspond to those of a non-human antibody, and all or substantially all of the FRs correspond to those of a human antibody.
- a humanized antibody optionally may comprise at least a portion of an antibody constant region derived from a human antibody.
- a "humanized form" of an antibody, e.g., a non-human antibody refers to an antibody that has undergone humanization.
- hypervariable region refers to each of the regions of an antibody variable domain which are hypervariable in sequence and/or form structurally defined loops ("hypervariable loops").
- native four-chain antibodies comprise six HVRs; three in the VH (HI, H2, H3), and three in the VL (LI, L2, L3).
- HVRs generally comprise amino acid residues from the hypervariable loops and/or from the "complementarity determining regions" (CDRs), the latter being of highest sequence variability and/or involved in antigen recognition.
- Exemplary hypervariable loops occur at amino acid residues 26-32
- CDR-L1, CDR-L2, CDR-L3, CDR-H1, CDR-H2, and CDR-H3 occur at amino acid residues 24-34 of LI, 50-56 of L2, 89-97 of L3, 31-35B of HI, 50-65 of H2, and 95-102 of H3.
- CDRs generally comprise the amino acid residues that form the hypervariable loops.
- CDRs also comprise "specificity determining residues,” or "SDRs,” which are residues that contact antigen. SDRs are contained within regions of the CDRs called abbreviated-CDRs, or a-CDRs.
- Exemplary a-CDRs (a-CDR-Ll, a- CDR-L2, a-CDR-L3, a-CDR-Hl, a-CDR-H2, and a-CDR-H3) occur at amino acid residues 31- 34 of LI, 50-55 of L2, 89-96 of L3, 31-35B of HI, 50-58 of H2, and 95-102 of H3. (See Almagro and Fransson, Front. Biosci. 13: 1619-1633 (2008)). Unless otherwise indicated, HVR residues and other residues in the variable domain (e.g., FR residues) are numbered herein according to Kabat et al., supra.
- the CD20 antibody herein comprises the HVRs of rituximab, ofatumumab, GA101, SBI-087, veltuzumab, or AME-133.
- an “immunoconjugate” is an antibody conjugated to one or more heterologous molecule(s), including but not limited to a cytotoxic agent.
- monoclonal antibody refers to an antibody obtained from a population of substantially homogeneous antibodies, i.e., the individual antibodies comprising the population are identical and/or bind the same epitope, except for possible variant antibodies, e.g., containing naturally occurring mutations or arising during production of a monoclonal antibody preparation, such variants generally being present in minor amounts.
- polyclonal antibody preparations typically include different antibodies directed against different determinants (epitopes)
- each monoclonal antibody of a monoclonal antibody preparation is directed against a single determinant on an antigen.
- the modifier "monoclonal” indicates the character of the antibody as being obtained from a substantially homogeneous population of antibodies, and is not to be construed as requiring production of the antibody by any particular method.
- the monoclonal antibodies to be used in accordance with the present invention may be made by a variety of techniques, including but not limited to the hybridoma method, recombinant DNA methods, phage-display methods, and methods utilizing transgenic animals containing all or part of the human immunoglobulin loci, such methods and other exemplary methods for making monoclonal antibodies being described herein.
- naked antibody refers to an antibody that is not conjugated to a heterologous moiety (e.g., a cytotoxic moiety) or radiolabel.
- the naked antibody may be present in a pharmaceutical formulation.
- Native antibodies refer to naturally occurring immunoglobulin molecules with varying structures.
- native IgG antibodies are heterotetrameric glycoproteins of about 150,000 daltons, composed of two identical light chains and two identical heavy chains that are disulfide-bonded. From N- to C-terminus, each heavy chain has a variable region (VH), also called a variable heavy domain or a heavy chain variable domain, followed by three constant domains (CHI, CH2, and CH3).
- VH variable region
- VL variable region
- the light chain of an antibody may be assigned to one of two types, called kappa ( ⁇ ) and lambda ( ⁇ ), based on the amino acid sequence of its constant domain.
- package insert is used to refer to instructions customarily included in commercial packages of therapeutic products, that contain information about the indications, usage, dosage, administration, combination therapy, contraindications and/or warnings concerning the use of such therapeutic products.
- pharmaceutical formulation refers to a sterile preparation that is in such form as to permit the biological activity of the medicament to be effective, and which contains no additional components that are unacceptably toxic to a subject to which the formulation would be administered.
- a “sterile” formulation is aseptic or free from all living microorganisms and their spores.
- a “kit” is any manufacture (e.g a package or container) comprising at least one reagent, e.g., a medicament for treatment of CLL, or a probe for specifically detecting a biomarker gene or protein of the invention. The manufacture is preferably promoted, distributed, or sold as a unit for performing the methods of the present invention.
- a “pharmaceutically acceptable carrier” refers to an ingredient in a pharmaceutical formulation, other than an active ingredient, which is nontoxic to a subject.
- pharmaceutically acceptable carrier includes, but is not limited to, a buffer, excipient, stabilizer, or preservative.
- the invention concerns selecting patients who can be treated with CLL medicaments based on expression of one or more of the biomarkers disclosed herein.
- CLL medicaments include, but are not limited to:
- alkylating agents e.g. chlorambucil, bendamustine, or cyclophosphamide
- nucleoside analogues or antimetabolites e.g. fludarabine, fludarabine and cyclophosphamide (FC); prednisone or prednisolone; akylator-containing combination therapy, including cyclophosphamide, vincristine, prednisolone (CHOP), or cyclophosphamide, vincristine, prednisolone (CVP); etc.
- CD20 antibodies e.g. rituximab, ofatumumab, GA101, SBI-087, veltuzumab, and AME-133 etc
- CD22 antibodies e.g. CD22 antibodies or CD79b antibodies
- CD52 antibodies e.g. alemtuzumab
- the CLL medicament is one which induces FAK signaling and/or homotypic aggregation.
- the CLL medicament is optionally selected from: a B-cell antagonist, a B-cell antibody, a CD20 antibody, a Type I CD20 antibody, a Type II CD20 antibody, a CD22 antibody, a CD79b antibody, etc.
- the CLL medicament is one other than rituximab.
- the medicament is an antibody, e.g. directed against or which binds to CD20.
- the antibody herein includes: monoclonal antibodies, including a chimeric, humanized or human antibodies.
- the antibody is an antibody fragment, e.g., a Fv, Fab, Fab', scFv, diabody, or F(ab') 2 fragment.
- the antibody is a full length antibody, e.g., an intact IgGl antibody or other antibody class or isotype as defined herein.
- the antibody e.g. the antibody used in the methods herein may incorporate any of the features, singly or in combination, as described in Sections 1-6 below:
- an antibody provided herein is an antibody fragment.
- Antibody fragments include, but are not limited to, Fab, Fab', Fab'-SH, F(ab') 2 , Fv, and scFv fragments, and other fragments described below.
- Fab fragment antigen binding fragment
- Fab' fragment antigen binding fragment
- Fab'-SH fragment antigen binding fragment
- Fv fragment antigen binding fragment
- scFv fragments fragment antigen binding fragments
- U.S. Patent Nos. 5,571,894 and 5,587,458 For discussion of Fab and F(ab') 2 fragments comprising salvage receptor binding epitope residues and having increased in vivo half- life, see U.S.
- Diabodies are antibody fragments with two antigen-binding sites that may be bivalent or bispecific. See, for example, EP 404,097; WO 1993/01161; Hudson et al., Nat. Med. 9: 129- 134 (2003); and Hollinger et al, Proc. Natl. Acad. Sci. USA 90: 6444-6448 (1993). Triabodies and tetrabodies are also described in Hudson et al, Nat. Med. 9: 129-134 (2003).
- Single-domain antibodies are antibody fragments comprising all or a portion of the heavy chain variable domain or all or a portion of the light chain variable domain of an antibody.
- a single-domain antibody is a human single-domain antibody (Domantis, Inc., Waltham, MA; see, e.g., U.S. Patent No. 6,248,516 Bl).
- Antibody fragments can be made by various techniques, including but not limited to proteolytic digestion of an intact antibody as well as production by recombinant host cells (e.g. E. coli or phage), as described herein.
- recombinant host cells e.g. E. coli or phage
- an antibody provided herein is a chimeric antibody.
- Certain chimeric antibodies are described, e.g., in U.S. Patent No. 4,816,567; and Morrison et al, Proc. Natl. Acad. Sci. USA, 81 :6851-6855 (1984)).
- a chimeric antibody comprises a non-human variable region (e.g., a variable region derived from a mouse, rat, hamster, rabbit, or non-human primate, such as a monkey) and a human constant region.
- a chimeric antibody is a "class switched" antibody in which the class or subclass has been changed from that of the parent antibody. Chimeric antibodies include antigen-binding fragments thereof.
- a chimeric antibody is a humanized antibody.
- a non-human antibody is humanized to reduce immunogenicity to humans, while retaining the specificity and affinity of the parental non-human antibody.
- a humanized antibody comprises one or more variable domains in which HVRs, e.g., CDRs, (or portions thereof) are derived from a non-human antibody, and FRs (or portions thereof) are derived from human antibody sequences.
- HVRs e.g., CDRs, (or portions thereof) are derived from a non-human antibody
- FRs or portions thereof
- a humanized antibody optionally will also comprise at least a portion of a human constant region.
- some FR residues in a humanized antibody are substituted with corresponding residues from a non-human antibody (e.g., the antibody from which the HVR residues are derived), e.g., to restore or improve antibody specificity or affinity.
- a non-human antibody e.g., the antibody from which the HVR residues are derived
- Human framework regions that may be used for humanization include but are not limited to: framework regions selected using the "best-fit" method (see, e.g., Sims et al. J. Immunol. 151 :2296 (1993)); framework regions derived from the consensus sequence of human antibodies of a particular subgroup of light or heavy chain variable regions (see, e.g., Carter et al. Proc. Natl. Acad. Sci. USA, 89:4285 (1992); and Presta et al. J. Immunol, 151 :2623 (1993)); human mature (somatically mutated) framework regions or human germline framework regions (see, e.g., Almagro and Fransson, Front. Biosci.
- Rituximab is an example of a chimeric antibody that binds CD20.
- Examples of humanized antibodies that bind CD20 include: GA101, SBI-087, AME-133 and veltuzumab. 3. Human Antibodies
- an antibody provided herein is a human antibody.
- Human antibodies can be produced using various techniques known in the art. Human antibodies are described generally in van Dijk and van de Winkel, Curr. Opin. Pharmacol. 5: 368-74 (2001) and Lonberg, Curr. Opin. Immunol. 20:450-459 (2008).
- Human antibodies may be prepared by administering an immunogen to a transgenic animal that has been modified to produce intact human antibodies or intact antibodies with human variable regions in response to antigenic challenge. Such animals typically contain all or a portion of the human immunoglobulin loci, which replace the endogenous
- immunoglobulin loci or which are present extrachromosomally or integrated randomly into the animal's chromosomes. In such transgenic mice, the endogenous immunoglobulin loci have generally been inactivated.
- endogenous immunoglobulin loci have generally been inactivated.
- Human antibodies can also be made by hybridoma-based methods. Human myeloma and mouse-human heteromyeloma cell lines for the production of human monoclonal antibodies have been described. (See, e.g., Kozbor J. Immunol, 133: 3001 (1984); Brodeur et al., Monoclonal Antibody Production Techniques and Applications, pp. 51-63 (Marcel Dekker, Inc., New York, 1987); and Boerner et al, J. Immunol., 147: 86 (1991).) Human antibodies generated via human B-cell hybridoma technology are also described in Li et al., Proc. Natl. Acad. Sci. USA, 103:3557-3562 (2006).
- Additional methods include those described, for example, in U.S. Patent No. 7,189,826 (describing production of monoclonal human IgM antibodies from hybridoma cell lines) and Ni, Xiandai Mianyixue, 26(4):265-268 (2006) (describing human-human hybridomas).
- Human hybridoma technology Trioma technology
- Human antibodies may also be generated by isolating Fv clone variable domain sequences selected from human-derived phage display libraries. Such variable domain sequences may then be combined with a desired human constant domain. Techniques for selecting human antibodies from antibody libraries are described below.
- Ofatumumab is an example of a human antibody that binds CD20.
- Antibodies of the invention may be isolated by screening combinatorial libraries for antibodies with the desired activity or activities. For example, a variety of methods are known in the art for generating phage display libraries and screening such libraries for antibodies possessing the desired binding characteristics. Such methods are reviewed, e.g., in
- repertoires of VH and VL genes are separately cloned by polymerase chain reaction (PCR) and recombined randomly in phage libraries, which can then be screened for antigen-binding phage as described in Winter et al., Ann. Rev. Immunol., 12: 433-455 (1994).
- Phage typically display antibody fragments, either as single-chain Fv (scFv) fragments or as Fab fragments.
- scFv single-chain Fv
- Libraries from immunized sources provide high-affinity antibodies to the immunogen without the requirement of constructing hybridomas.
- naive repertoire can be cloned (e.g., from human) to provide a single source of antibodies to a wide range of non-self and also self antigens without any immunization as described by Griffiths et al., EMBO J, 12: 725-734 (1993).
- naive libraries can also be made synthetically by cloning unrearranged V-gene segments from stem cells, and using PCR primers containing random sequence to encode the highly variable CDR3 regions and to accomplish rearrangement in vitro, as described by Hoogenboom and Winter, J. Mol. Biol, 227: 381-388 (1992).
- Patent publications describing human antibody phage libraries include, for example: US Patent No. 5,750,373, and US Patent Publication Nos. 2005/0079574, 2005/0119455, 2005/0266000, 2007/0117126, 2007/0160598, 2007/0237764, 2007/0292936, and 2009/0002360.
- Antibodies or antibody fragments isolated from human antibody libraries are considered human antibodies or human antibody fragments herein. 5. Multispecific Antibodies
- an antibody provided herein is a multispecific antibody, e.g. a bispecific antibody.
- Multispecific antibodies are monoclonal antibodies that have binding specificities for at least two different sites.
- one of the binding specificities is for CD20 and the other is for any other antigen.
- bispecific antibodies may bind to two different epitopes of CD20.
- Bispecific antibodies may also be used to localize cytotoxic agents to cells which express CD20.
- Bispecific antibodies can be prepared as full length antibodies or antibody fragments.
- Multispecific antibodies include, but are not limited to, recombinant co-expression of two immunoglobulin heavy chain-light chain pairs having different specificities (see Milstein and Cuello, Nature 305: 537 (1983), WO 93/08829, and Traunecker et al, EMBO J. 10: 3655 (1991)), and "knob-in-hole” engineering (see, e.g., U.S. Patent No. 5,731,168).
- Multi-specific antibodies may also be made by engineering electrostatic steering effects for making antibody Fc-heterodimeric molecules (WO 2009/089004A1); cross- linking two or more antibodies or fragments (see, e.g., US Patent No.
- the antibody or fragment herein also includes a "Dual Acting FAb” or “DAF” comprising an antigen binding site that binds to CD20 as well as another, different antigen (see, US 2008/0069820, for example). 6. Antibody Variants
- amino acid sequence variants of the antibodies provided herein are contemplated. For example, it may be desirable to improve the binding affinity and/or other biological properties of the antibody.
- Amino acid sequence variants of an antibody may be prepared by introducing appropriate modifications into the nucleotide sequence encoding the antibody, or by peptide synthesis. Such modifications include, for example, deletions from, and/or insertions into and/or substitutions of residues within the amino acid sequences of the antibody. Any combination of deletion, insertion, and substitution can be made to arrive at the final construct, provided that the final construct possesses the desired characteristics, e.g., antigen-binding .
- antibody variants having one or more amino acid substitutions are provided.
- Sites of interest for substitutional mutagenesis include the HVRs and FRs.
- Amino acid substitutions may be introduced into an antibody of interest and the products screened for a desired activity, e.g., retained/improved antigen binding, decreased
- substitutional variant involves substituting one or more hypervariable region residues of a parent antibody (e.g. a humanized or human antibody).
- a parent antibody e.g. a humanized or human antibody
- the resulting variant(s) selected for further study will have modifications (e.g., improvements) in certain biological properties (e.g., increased affinity, reduced immunogenicity) relative to the parent antibody and/or will have substantially retained certain biological properties of the parent antibody.
- An exemplary substitutional variant is an affinity matured antibody, which may be conveniently generated, e.g., using phage display-based affinity maturation techniques such as those described herein. Briefly, one or more HVR residues are mutated and the variant antibodies displayed on phage and screened for a particular biological activity (e.g. binding affinity).
- Amino acid sequence insertions include amino- and/or carboxyl-terminal fusions ranging in length from one residue to polypeptides containing a hundred or more residues, as well as intrasequence insertions of single or multiple amino acid residues.
- terminal insertions include an antibody with an N-terminal methionyl residue.
- Other insertional variants of the antibody molecule include the fusion to the N- or C-terminus of the antibody to an enzyme (e.g. for ADEPT) or a polypeptide which increases the serum half-life of the antibody.
- an antibody provided herein is altered to increase or decrease the extent to which the antibody is glycosylated. Addition or deletion of glycosylation sites to an antibody may be conveniently accomplished by altering the amino acid sequence such that one or more glycosylation sites is created or removed.
- the carbohydrate attached thereto may be altered.
- Native antibodies produced by mammalian cells typically comprise a branched, biantennary oligosaccharide that is generally attached by an N-linkage to Asn297 of the CH2 domain of the Fc region. See, e.g., Wright et al. TIBTECH 15:26-32 (1997).
- oligosaccharide may include various carbohydrates, e.g., mannose, N-acetyl glucosamine (GlcNAc), galactose, and sialic acid, as well as a fucose attached to a GlcNAc in the "stem" of the biantennary oligosaccharide structure.
- modifications of the oligosaccharide in an antibody of the invention may be made in order to create antibody variants with certain improved properties.
- antibody variants having a carbohydrate structure that lacks fucose attached (directly or indirectly) to an Fc region.
- the amount of fucose in such antibody may be from 1% to 80%, from 1% to 65%, from 5% to 65%> or from 20% to 40%.
- the amount of fucose is determined by calculating the average amount of fucose within the sugar chain at Asn297, relative to the sum of all glycostructures attached to Asn 297 (e. g. complex, hybrid and high mannose structures) as measured by MALDI-TOF mass spectrometry, as described in WO 2008/077546, for example.
- Asn297 refers to the asparagine residue located at about position 297 in the Fc region (Eu numbering of Fc region residues); however, Asn297 may also be located about ⁇ 3 amino acids upstream or downstream of position 297, i.e., between positions 294 and 300, due to minor sequence variations in antibodies.
- Such fucosylation variants may have improved ADCC function. See, e.g., US Patent Publication Nos. US 2003/0157108 (Presta, L.); US 2004/0093621 (Kyowa Hakko Kogyo Co., Ltd). Examples of publications related to "defucosylated” or "fucose-deficient" antibody variants include: US 2003/0157108; WO 2000/61739; WO 2001/29246; US
- Examples of cell lines capable of producing defucosylated antibodies include Lecl3 CHO cells deficient in protein fucosylation (Ripka et al. Arch. Biochem. Biophys. 249:533-545 (1986); US Pat Appl No US 2003/0157108 Al, Presta, L; and WO 2004/056312 Al, Adams et al, especially at Example 11), and knockout cell lines, such as alpha- 1,6-fucosyltransferase gene, FUT8, knockout CHO cells (see, e.g., Yamane-Ohnuki et al. Biotech. Bioeng. 87: 614 (2004); Kanda, Y. et al, Biotechnol. Bioeng., 94(4):680-688 (2006); and WO2003/085107).
- Antibodies variants are further provided with bisected oligosaccharides, e.g., in which a biantennary oligosaccharide attached to the Fc region of the antibody is bisected by GlcNAc. Such antibody variants may have reduced fucosylation and/or improved ADCC function.
- antibody variants examples include WO 2003/011878 (Jean-Mairet et al); US Patent No. 6,602,684 (Umana et al); and US 2005/0123546 (Umana et al).
- Antibody variants with at least one galactose residue in the oligosaccharide attached to the Fc region are also provided. Such antibody variants may have improved CDC function.
- Such antibody variants are described, e.g., in WO 1997/30087 (Patel et al); WO 1998/58964 (Raju, S.); and WO 1999/22764 (Raju, S.).
- GA101 is an example of an antibody glycosylation variant that binds CD20.
- one or more amino acid modifications may be introduced into the Fc region of an antibody provided herein, thereby generating an Fc region variant.
- the Fc region variant may comprise a human Fc region sequence ⁇ e.g., a human IgGl, IgG2, IgG3 or IgG4 Fc region) comprising an amino acid modification ⁇ e.g. a substitution) at one or more amino acid positions.
- the invention contemplates an antibody variant that possesses some but not all effector functions, which make it a desirable candidate for applications in which the half life of the antibody in vivo is important yet certain effector functions (such as complement and ADCC) are unnecessary or deleterious.
- Antibodies with reduced effector function include those with substitution of one or more of Fc region residues 238, 265, 269, 270, 297, 327 and 329 (U.S. Patent No. 6,737,056).
- Fc mutants include Fc mutants with substitutions at two or more of amino acid positions 265, 269, 270, 297 and 327, including the so-called "DANA" Fc mutant with substitution of residues 265 and 297 to alanine (US Patent No. 7,332,581).
- an antibody variant comprises an Fc region with one or more amino acid substitutions which improve ADCC, e.g., substitutions at positions 298, 333, and/or 334 of the Fc region (EU numbering of residues).
- alterations are made in the Fc region that result in altered (i.e., either improved or diminished) Clq binding and/or Complement Dependent Cytotoxicity (CDC), e.g., as described in US Patent No. 6,194,551, WO 99/51642, and Idusogie et al. J. Immunol. 164: 4178-4184 (2000).
- CDC Complement Dependent Cytotoxicity
- FcRn neonatal Fc receptor
- Those antibodies comprise an Fc region with one or more substitutions therein which improve binding of the Fc region to FcRn.
- Fc variants include those with substitutions at one or more of Fc region residues: 238, 256, 265, 272, 286, 303, 305, 307, 311, 312, 317, 340, 356, 360, 362, 376, 378, 380, 382, 413, 424 or 434, e.g., substitution of Fc region residue 434 (US Patent No. 7,371,826).
- cysteine engineered antibodies e.g., "thioMAbs”
- one or more residues of an antibody are substituted with cysteine residues.
- the substituted residues occur at accessible sites of the antibody.
- reactive thiol groups are thereby positioned at accessible sites of the antibody and may be used to conjugate the antibody to other moieties, such as drug moieties or linker-drug moieties, to create an immunoconjugate, as described further herein.
- any one or more of the following residues may be substituted with cysteine: V205 (Kabat numbering) of the light chain; Al 18 (EU numbering) of the heavy chain; and S400 (EU numbering) of the heavy chain Fc region.
- Cysteine engineered antibodies may be generated as described, e.g., in U.S. Patent No.
- an antibody provided herein may be further modified to contain additional nonproteinaceous moieties that are known in the art and readily available.
- the moieties suitable for derivatization of the antibody include but are not limited to water soluble polymers.
- water soluble polymers include, but are not limited to, polyethylene glycol (PEG), copolymers of ethylene glycol/propylene glycol, carboxymethylcellulose, dextran, polyvinyl alcohol, polyvinyl pyrrolidone, poly-1, 3- dioxolane, poly-1, 3, 6-trioxane, ethylene/maleic anhydride copolymer, polyaminoacids (either homopolymers or random copolymers), and dextran or poly(n-vinyl pyrrolidone)polyethylene glycol, propropylene glycol homopolymers, prolypropylene oxide/ethylene oxide co-polymers, polyoxyethylated polyols (e.g., glycerol
- Polyethylene glycol propionaldehyde may have advantages in manufacturing due to its stability in water.
- the polymer may be of any molecular weight, and may be branched or unbranched.
- the number of polymers attached to the antibody may vary, and if more than one polymer are attached, they can be the same or different molecules. In general, the number and/or type of polymers used for derivatization can be determined based on considerations including, but not limited to, the particular properties or functions of the antibody to be improved, whether the antibody derivative will be used in a therapy under defined conditions, etc.
- conjugates of an antibody and nonproteinaceous moiety that may be selectively heated by exposure to radiation are provided.
- the nonproteinaceous moiety is a carbon nanotube (Kam et al., Proc. Natl. Acad. Sci. USA 102:
- the radiation may be of any wavelength, and includes, but is not limited to, wavelengths that do not harm ordinary cells, but which heat the nonproteinaceous moiety to a temperature at which cells proximal to the antibody-nonproteinaceous moiety are killed.
- the medicament is an mmunoconjugate comprising an antibody (such as a CD20 antibody) conjugated to one or more cytotoxic agents, such as
- chemotherapeutic agents or drugs growth inhibitory agents, toxins (e.g., protein toxins, enzymatically active toxins of bacterial, fungal, plant, or animal origin, or fragments thereof), or radioactive isotopes.
- toxins e.g., protein toxins, enzymatically active toxins of bacterial, fungal, plant, or animal origin, or fragments thereof
- radioactive isotopes e.g., radioactive isotopes.
- an immunoconjugate is an antibody-drug conjugate (ADC) in which an antibody is conjugated to one or more drugs, including but not limited to a maytansinoid (see U.S. Patent Nos. 5,208,020, 5,416,064 and European Patent EP 0 425 235 Bl); an auristatin such as monomethylauristatin drug moieties DE and DF (MMAE and MMAF) (see U.S. Patent Nos. 5,635,483 and 5,780,588, and 7,498,298); a dolastatin; a calicheamicin or derivative thereof (see U.S. Patent Nos. 5,712,374, 5,714,586, 5,739,116, 5,767,285, 5,770,701, 5,770,710, 5,773,001, and 5,877,296; Hinman et al, Cancer Res.
- ADC antibody-drug conjugate
- an immunoconjugate comprises an antibody as described herein conjugated to an enzymatically active toxin or fragment thereof, including but not limited to diphtheria A chain, nonbinding active fragments of diphtheria toxin, exotoxin A chain (from Pseudomonas aeruginosa), ricin A chain, abrin A chain, modeccin A chain, alpha- sarcin, Aleurites fordii proteins, dianthin proteins, Phytolaca americana proteins (PAPI, PAPII, and PAP-S), momordica charantia inhibitor, curcin, crotin, sapaonaria officinalis inhibitor, gelonin, mitogellin, restrictocin, phenomycin, enomycin, and the tricothecenes.
- an enzymatically active toxin or fragment thereof including but not limited to diphtheria A chain, nonbinding active fragments of diphtheria toxin, exotoxin A chain
- an immunoconjugate comprises an antibody as described herein conjugated to a radioactive atom to form a radioconjugate.
- a radioactive atom to form a radioconjugate.
- isotopes are available for the production of radioconjugates. Examples include At , 1 , 1 , Y 90 , Re 186 , Re 188 , Sm 153 , Bi 212 , P 32 , Pb 212 and radioactive isotopes of Lu.
- radioconjugate is used for detection, it may comprise a radioactive atom for scintigraphic studies, for example tc99m or 1123, or a spin label for nuclear magnetic resonance (NMR) imaging (also known as magnetic resonance imaging, mri), such as iodine- 123 again, iodine- 131, indium- 111, fluorine- 19, carbon- 13 , nitrogen- 15 , oxygen- 17, gadolinium, manganese or iron.
- NMR nuclear magnetic resonance
- Conjugates of an antibody and cytotoxic agent may be made using a variety of bifunctional protein coupling agents such as N-succinimidyl-3-(2-pyridyldithio) propionate (SPDP), succinimidyl-4-(N-maleimidomethyl) cyclohexane-l-carboxylate (SMCC), iminothiolane (IT), bifunctional derivatives of imidoesters (such as dimethyl adipimidate HC1), active esters (such as disuccinimidyl suberate), aldehydes (such as glutaraldehyde), bis-azido compounds (such as bis (p-azidobenzoyl) hexanediamine), bis-diazonium derivatives (such as bis-(p-diazoniumbenzoyl)-ethylenediamine), diisocyanates (such as toluene 2,6-diisocyanate), and bis-active fluorine compounds (such
- Carbon- 14-labeled l-isothiocyanatobenzyl-3-methyldiethylene triaminepentaacetic acid is an exemplary chelating agent for conjugation of radionucleotide to the antibody. See W094/11026.
- the linker may be a "cleavable linker" facilitating release of a cytotoxic drug in the cell.
- an acid-labile linker, peptidase-sensitive linker, photolabile linker, dimethyl linker or disulfide-containing linker (Chari et al., Cancer Res. 52: 127-131 (1992); U.S. Patent No. 5,208,020) may be used.
- immunuoconjugates or ADCs herein expressly contemplate, but are not limited to such conjugates prepared with cross-linker reagents including, but not limited to, BMPS,
- EMCS GMBS, HBVS, LC-SMCC, MBS, MPBH, SBAP, SIA, SIAB, SMCC, SMPB, SMPH, sulfo-EMCS, sulfo-GMBS, sulfo-KMUS, sulfo-MBS, sulfo-SIAB, sulfo-SMCC, and sulfo- SMPB, and SVSB (succinimidyl-(4-vinylsulfone)benzoate) which are commercially available (e.g., from Pierce Biotechnology, Inc., Rockford, IL., U.S.A).
- SVSB succinimidyl-(4-vinylsulfone)benzoate
- the invention herein concerns a method for selecting a therapy for a patient with chronic lymphocytic leukemia (CLL) comprising determining expression (or activation) of a biomarker selected from miRNA151 3p, miRNA409 3p, PTK2, and PI3K, in a sample from the patient, and selecting a CLL medicament based on the level of expression of the biomarker.
- CLL chronic lymphocytic leukemia
- an elevated level of the biomarker(s) will result in selection of a CLL medicament which induces FAK signaling and/or homotypic adhesion, and/or a B- cell antagonist, and/or a CD20 antibody for use in treating the patient.
- the biomarker(s) are present a reduced level or a level below the median, the patient will be selected for a treatment with a CLL medicament other than rituximab or other than a CD20 antibody.
- the median expression level for the biomarker can be determined essentially contemporaneously with measuring biomarker expression, or may have been determined previously.
- the skilled artisan is able to determine the median expression level of a biomarker in a population of patients for various diagnostic assays. This is exemplified in the table below which provides median expression levels for the various biomarkers and bioassays in the example below.
- tissue sample is tested for expression of one or more of the biomarkers herein.
- the source of the tissue or cell sample may be solid tissue as from a fresh, frozen and/or preserved organ or tissue sample or biopsy or aspirate; blood or any blood constituents; bodily fluids such as cerebral spinal fluid, amniotic fluid, peritoneal fluid, or interstitial fluid; cells from any time in gestation or development of the subject.
- the tissue sample may contain compounds which are not naturally intermixed with the tissue in nature such as preservatives, anticoagulants, buffers, fixatives, nutrients, antibiotics, or the like.
- tumor samples herein include, but are not limited to, tumor biopsies, tumor cells, serum or plasma, Peripheral Blood Mononuclear Cells (PBMCs), circulating plasma proteins, ascitic fluid, primary cell cultures or cell lines derived from tumors or exhibiting tumor- like properties, as well as preserved tumor samples, such as formalin-fixed, paraffin-embedded tumor samples or frozen tumor samples.
- PBMCs Peripheral Blood Mononuclear Cells
- the sample comprisese Peripheral Blood Mononuclear Cells (PBMCs), including CD19-enriched PBMCs.
- RNA-Seq quantitative real time PCR
- SAGE serial analysis of gene expression
- MassARRAY proteomics
- IHC immunohistochemistry
- methods of gene expression profiling can be divided into two large groups: methods based on hybridization analysis of polynucleotides, and methods based on sequencing of polynucleotides.
- the most commonly used methods known in the art for the quantification of mRNA expression in a sample include northern blotting and in situ hybridization (Parker &Barnes, Methods in Molecular Biology 106:247-283 (1999)); RNAse protection assays (Hod, Biotechniques 13:852- 854 (1992)); and polymerase chain reaction (PCR) (Weis et al, Trends in Genetics 8:263-264 (1992)).
- antibodies may be employed that can recognize specific duplexes, including DNA duplexes, RNA duplexes, and DNA-RNA hybrid duplexes or DNA- protein duplexes.
- Representative methods for sequencing-based gene expression analysis include Serial Analysis of Gene Expression (SAGE), and gene expression analysis by massively parallel signature sequencing (MPSS). 2. Polymerase Chain Reaction (PCR)
- PCR a sensitive and flexible quantitative method is PCR, which can be used to compare mRNA levels in different sample populations, in normal and tumor tissues, with or without drug treatment, to characterize patterns of gene expression, to discriminate between closely related mRNAs, and to analyze RNA structure.
- the first step is the isolation of mRNA from a target sample.
- the starting material is typically total RNA isolated from human tumors or tumor cell lines, and corresponding normal tissues or cell lines, respectively.
- RNA can be isolated from a variety of primary tumors, including breast, lung, colon, prostate, brain, liver, kidney, pancreas, spleen, thymus, testis, ovary, uterus, etc., tumor, or tumor cell lines, with pooled DNA from healthy donors.
- mRNA can be extracted, for example, from frozen or archived paraffin-embedded and fixed (e.g. formalin-fixed) tissue samples.
- RNA isolation can be performed using purification kit, buffer set and protease from commercial manufacturers, such as Qiagen, according to the manufacturer's instructions. For example, total RNA from cells in culture can be isolated using Qiagen RNeasy mini- columns.
- RNA isolation kits include MASTERPURE® Complete DNA and RNA Purification Kit (EPICENTRE®, Madison, Wis.), and Paraffin Block RNA Isolation Kit (Ambion, Inc.).
- Total RNA from tissue samples can be isolated using RNA Stat-60 (Tel-Test).
- RNA prepared from tumor can be isolated, for example, by cesium chloride density gradient centrifugation.
- RNA cannot serve as a template for PCR
- the first step in gene expression profiling by PCR is the reverse transcription of the RNA template into cDNA, followed by its exponential amplification in a PCR reaction.
- the two most commonly used reverse transcriptases are avilo myeloblastosis virus reverse transcriptase (AMV-RT) and Moloney murine leukemia virus reverse transcriptase (MMLV-RT).
- AMV-RT avilo myeloblastosis virus reverse transcriptase
- MMLV-RT Moloney murine leukemia virus reverse transcriptase
- the reverse transcription step is typically primed using specific primers, random hexamers, or oligo-dT primers, depending on the circumstances and the goal of expression profiling.
- extracted RNA can be reverse- transcribed using a GENEAMPTM RNA PCR kit (Perkin Elmer, Calif, USA), following the manufacturer's instructions.
- the derived cDNA can then be used as a template in the subsequent PCR reaction.
- the PCR step can use a variety of thermostable DNA-dependent DNA polymerases, it typically employs the Taq DNA polymerase, which has a 5'- 3' nuclease activity but lacks a 3 '-5' proofreading endonuclease activity.
- TAQMAN® PCR typically utilizes the 5 '-nuclease activity of Taq or Tth polymerase to hydro lyze a hybridization probe bound to its target amplicon, but any enzyme with equivalent 5' nuclease activity can be used.
- Two oligonucleotide primers are used to generate an amplicon typical of a PCR reaction.
- a third oligonucleotide, or probe is designed to detect nucleotide sequence located between the two PCR primers.
- the probe is non-extendible by Taq DNA polymerase enzyme, and is labeled with a reporter fluorescent dye and a quencher fluorescent dye. Any laser-induced emission from the reporter dye is quenched by the quenching dye when the two dyes are located close together as they are on the probe.
- the Taq DNA polymerase enzyme cleaves the probe in a template-dependent manner.
- the resultant probe fragments disassociate in solution, and signal from the released reporter dye is free from the quenching effect of the second fiuorophore.
- One molecule of reporter dye is liberated for each new molecule synthesized, and detection of the unquenched reporter dye provides the basis for quantitative interpretation of the data.
- TAQMAN® PCR can be performed using commercially available equipment, such as, for example, ABI PRISM 7700® Sequence Detection System® (Perkin- Elmer-Applied Biosystems, Foster City, Calif, USA), or Lightcycler (Roche Molecular Biochemicals, Mannheim, Germany).
- the 5' nuclease procedure is run on a real- time quantitative PCR device such as the ABI PRISM 7700® Sequence Detection System.
- the system consists of a thermocycler, laser, charge- coupled device (CCD), camera and computer.
- the system amplifies samples in a 96-well format on a thermocycler.
- laser- induced fluorescent signal is collected in real-time through fiber optics cables for all 96 wells, and detected at the CCD.
- the system includes software for running the instrument and for analyzing the data.
- 5'-Nuclease assay data are initially expressed as Ct, or the threshold cycle.
- Ct the threshold cycle.
- fluorescence values are recorded during every cycle and represent the amount of product amplified to that point in the amplification reaction.
- the point when the fluorescent signal is first recorded as statistically significant is the threshold cycle (Ct).
- PCR is usually performed using an internal standard.
- the ideal internal standard is expressed at a constant level among different tissues, and is unaffected by the experimental treatment.
- RNAs most frequently used to normalize patterns of gene expression are mRNAs for the housekeeping genes glyceraldehyde-3-phosphate-dehydrogenase (GAPDH) and P-actin.
- GPDH glyceraldehyde-3-phosphate-dehydrogenase
- P-actin P-actin.
- a more recent variation of the PCR technique is quantitative real time PCR (qRT- PCR), which measures PCR product accumulation through a dual-labeled fluorigenic probe (i.e., TAQMAN® probe).
- Real time PCR is compatible both with quantitative competitive PCR, where internal competitor for each target sequence is used for normalization, and with quantitative comparative PCR using a normalization gene contained within the sample, or a housekeeping gene for PCR.
- quantitative competitive PCR where internal competitor for each target sequence is used for normalization
- quantitative comparative PCR using a normalization gene contained within the sample, or a housekeeping gene for PCR.
- RNA repair and/or amplification steps may be included, if necessary, and RNA is reverse transcribed using gene specific promoters followed by PCR.
- PCR primers and probes are designed based upon intron sequences present in the gene to be amplified.
- the first step in the primer/probe design is the delineation of intron sequences within the genes. This can be done by publicly available software, such as the DNA BLAT software developed by Kent, W., Genome Res. 12(4):656-64 (2002), or by the BLAST software including its variations. Subsequent steps follow well established methods of PCR primer and probe design.
- PCR primer design Factors considered in PCR primer design include primer length, melting temperature (Tm), and G/C content, specificity, complementary primer sequences, and 3'-end sequence.
- Tm melting temperature
- G/C content specificity, complementary primer sequences, and 3'-end sequence.
- optimal PCR primers are generally 17-30 bases in length, and contain about 20-80%, such as, for example, about 50-60% G+C bases. Tm's between 50 and 80° C, e.g. about 50 to 70° C. are typically preferred.
- RNA-Seq also called Whole Transcriptome Shotgun Sequencing (WTSS) refers to the use of high-throughput sequencing technologies to sequence cDNA in order to get information about a sample's RNA content.
- WTSS Whole Transcriptome Shotgun Sequencing
- Differential gene expression can also be identified, or confirmed using the microarray technique.
- the expression profile of breast cancer- associated genes can be measured in either fresh or paraffin-embedded tumor tissue, using microarray technology.
- polynucleotide sequences of interest including cDNAs and oligonucleotides
- the arrayed sequences are then hybridized with specific
- DNA probes from cells or tissues of interest typically is total RNA isolated from human tumors or tumor cell lines, and corresponding normal tissues or cell lines.
- RNA can be isolated from a variety of primary tumors or tumor cell lines. If the source of mRNA is a primary tumor, mRNA can be extracted, for example, from frozen or archived paraffin- embedded and fixed ⁇ e.g. formalin-fixed) tissue samples, which are routinely prepared and preserved in everyday clinical practice.
- PCR amplified inserts of cDNA clones are applied to a substrate in a dense array.
- the microarrayed genes, immobilized on the microchip at 10,000 elements each, are suitable for hybridization under stringent conditions.
- Fluorescently labeled cDNA probes may be generated through incorporation of fluorescent nucleotides by reverse transcription of R A extracted from tissues of interest. Labeled cDNA probes applied to the chip hybridize with specificity to each spot of DNA on the array. After stringent washing to remove non-specifically bound probes, the chip is scanned by confocal laser microscopy or by another detection method, such as a CCD camera.
- Quantitation of hybridization of each arrayed element allows for assessment of corresponding mRNA abundance.
- dual color fluorescence separately labeled cDNA probes generated from two sources of RNA are hybridized pairwise to the array. The relative abundance of the transcripts from the two sources corresponding to each specified gene is thus determined simultaneously.
- the miniaturized scale of the hybridization affords a convenient and rapid evaluation of the expression pattern for large numbers of genes. Such methods have been shown to have the sensitivity required to detect rare transcripts, which are expressed at a few copies per cell, and to reproducibly detect at least approximately two-fold differences in the expression levels (Schena et ah, Proc. Natl. Acad. Sci. USA 93(2): 106-149 (1996)).
- Microarray analysis can be performed by commercially available equipment, following manufacturer's protocols, such as by using the AFFYMETRLX GENCHIPTM technology, or Incyte's microarray technology.
- microarray methods for large-scale analysis of gene expression makes it possible to search systematically for molecular markers of cancer classification and outcome prediction in a variety of tumor types.
- Serial analysis of gene expression is a method that allows the simultaneous and quantitative analysis of a large number of gene transcripts, without the need of providing an individual hybridization probe for each transcript.
- a short sequence tag (about 10-14 bp) is generated that contains sufficient information to uniquely identify a transcript, provided that the tag is obtained from a unique position within each transcript.
- many transcripts are linked together to form long serial molecules, that can be sequenced, revealing the identity of the multiple tags simultaneously.
- the expression pattern of any population of transcripts can be quantitatively evaluated by determining the abundance of individual tags, and identifying the gene corresponding to each tag. For more details see, e.g. Velculescu et ah, Science 270:484- 487 (1995); and Velculescu et al, Cell 88:243-51 (1997).
- the MassARRAY (Sequenom, San Diego, Calif.) technology is an automated, high- throughput method of gene expression analysis using mass spectrometry (MS) for detection.
- MS mass spectrometry
- the cDNAs are subjected to primer extension.
- the cDNA-derived primer extension products are purified, and dipensed on a chip array that is pre- loaded with the components needed for MALTI-TOF MS sample preparation.
- the various cDNAs present in the reaction are quantitated by analyzing the peak areas in the mass spectrum obtained.
- Immunohistochemistry methods are also suitable for detecting the expression levels of the prognostic markers of the present invention.
- antibodies or antisera preferably polyclonal antisera, and most preferably monoclonal antibodies specific for each marker are used to detect expression.
- the antibodies can be detected by direct labeling of the antibodies themselves, for example, with radioactive labels, fluorescent labels, hapten labels such as, biotin, or an enzyme such as horse radish peroxidase or alkaline phosphatase.
- unlabeled primary antibody is used in conjunction with a labeled secondary antibody, comprising antisera, polyclonal antisera or a monoclonal antibody specific for the primary antibody. Immunohistochemistry protocols and kits are well known in the art and are commercially available.
- proteome is defined as the totality of the proteins present in a sample (e.g. tissue, organism, or cell culture) at a certain point of time.
- Proteomics includes, among other things, study of the global changes of protein expression in a sample (also referred to as "expression proteomics").
- Proteomics typically includes the following steps: (1) separation of individual proteins in a sample by 2-D gel electrophoresis (2-D PAGE); (2) identification of the individual proteins recovered from the gel, e.g. my mass spectrometry or N-terminal sequencing, and (3) analysis of the data using bioinformatics.
- Proteomics methods are valuable supplements to other methods of gene expression profiling, and can be used, alone or in combination with other methods, to detect the products of the prognostic markers of the present invention.
- Biomarker expression may also be evaluated using an in vivo diagnostic assay, e.g. by administering a molecule (such as an antibody) which binds the molecule to be detected and is tagged with a detectable label (e.g. a radioactive isotope) and externally scanning the patient for localization of the label.
- a detectable label e.g. a radioactive isotope
- the invention provides a method for treating a patient with chronic lymphocytic leukemia (CLL), comprising administering a therapeutically effective amount of a CLL medicament to the patient if the patient has been found to have an elevated amount of one or more biomarker selected from miRNA151 3p, miRNA409 3p, and PTK2; or reduced PI3K biomarker.
- CLL chronic lymphocytic leukemia
- CLL medicaments herein include: a CLL medicament which induces FAK signaling and/or induce homotypic adhesion; B-cell antagonists or B-cell antibodies; CD20 antibodies (including humanized, human, chimeric, Type I or Type II anti-CD20 antibodies, such as rituximab, ofatumumab, GA101, SBI-087, veltuzumab, and AME-133).
- the invention also concerns a method for treating a patient with chronic lymphocytic leukemia (CLL) comprising administering to the patient a therapeutically effective amount of an anti-CD20 antibody (e.g. rituximab), if the patient has been found to have an elevated amount of one or more biomarker selected from miRNA151 3p, miRNA409 3p, and PTK2; or reduced PI3K biomarker.
- CLL chronic lymphocytic leukemia
- the invention provides a method for treating a patient with chronic lymphocytic leukemia (CLL) comprising administering to the patient a therapeutically effective amount of a combination of rituximab, fludarabine and cyclophosphamide, if the patient has been found to have an elevated amount of one or more biomarker selected from miRNAl 51 3p, miRNA409 3p, and PTK2; or reduced PI3K biomarker.
- CLL chronic lymphocytic leukemia
- the invention additionally concerns a method for treating a patient with chronic lymphocytic leukemia (CLL) comprising administering to the patient a therapeutically effective amount of CLL medicament other than rituximab, if the patient has been found to have a reduced amount of one or more biomarker selected from miRNAl 51 3p, miRNA409 3p, and PTK2; or elevated PI3K biomarker.
- CLL chronic lymphocytic leukemia
- the patient treated herein desirably will benefit from greater progression free survival (PFS) relative to a patient who does not have an elevated amount of the biomarker.
- PFS progression free survival
- CLL medicaments of the invention can be used either alone or in combination with other CLL mediaments.
- a CD20 antibody may be co-administered with at least one additional therapeutic agent, e.g. with a chemotherapy regimen including, in particular, alkylating agents (e.g. chlorambucil, bendamustine, or cyclophosphamide), nucleoside analogues or antimetabolites (e.g. fludarabine), fludarabine and cyclophosphamide (FC), prednisone or prednisolone, akylator-containing combination therapy, including
- cyclophosphamide vincristine, prednisolone (CHOP), or cyclophosphamide, vincristine, prednisolone (CVP), etc, with other B cell antagonists, such as CD20 antibodies (e.g.
- combination therapies noted above encompass combined administration (where two or more therapeutic agents are included in the same or separate formulations), and separate administration, in which case, administration of a first medicament can occur prior to, simultaneously, and/or following, administration of a second medicament.
- CLL medicaments of the invention can also be used in combination with radiation therapy.
- the medicament(s) herein can be administered by any suitable means, including parenteral, intrapulmonary, and intranasal, and, if desired for local treatment, intralesional administration.
- Parenteral infusions include intramuscular, intravenous, intraarterial, intraperitoneal, or subcutaneous administration.
- Dosing can be by any suitable route, e.g. by injections, such as intravenous or subcutaneous injections, depending in part on whether the administration is brief or chronic.
- Various dosing schedules including but not limited to single or multiple administrations over various time-points, bolus administration, and pulse infusion are contemplated herein.
- an antibody of the invention when used alone or in combination with one or more other additional therapeutic agents, will depend on the type of disease to be treated, the type of antibody, the severity and course of the disease, whether the antibody is administered for preventive or therapeutic purposes, previous therapy, the patient's clinical history and response to the antibody, and the discretion of the attending physician.
- the antibody is suitably administered to the patient at one time or over a series of treatments.
- about 1 ⁇ g/kg to 15 mg/kg (e.g. O.lmg/kg-lOmg/kg) of antibody can be an initial candidate dosage for administration to the patient, whether, for example, by one or more separate administrations, or by continuous infusion.
- One typical daily dosage might range from about 1 ⁇ g/kg to 100 mg/kg or more, depending on the factors mentioned above. For repeated administrations over several days or longer, depending on the condition, the treatment would generally be sustained until a desired suppression of disease symptoms occurs.
- An exemplary dosage regimen for a CD20 antibody includes weekly, biweekly, or monthly administrations of the antibody in the range from about 500mg/m 2 to about 1500mg/m 2.
- An exemplary dosage regimen for rituximab is 375mg/m 2 (day 1) then 500mg/m 2 (cycles 2-6) once every 28 days.
- Exemplary dosage regiments for ofatumumab 300mg initial dose followed by 2000mg dose (every month); repeated doses of 500mg or lOOOmg; 300mg with lOOOmg 1 week later, followed by up to 11 monthly infusions of lOOOmg, etc.
- the article of manufacture comprises a container and a label or package insert on or associated with the container.
- Suitable containers include, for example, bottles, vials, syringes, etc.
- the containers may be formed from a variety of materials such as glass or plastic.
- the container holds or contains a composition comprising the CLL medicament as the active agent and may have a sterile access port (for example the container may be an intravenous solution bag or a vial having a stopper pierceable by a hypodermic injection needle).
- the article of manufacture may further comprise a second container comprising a pharmaceutically-acceptable diluent buffer, such as bacteriostatic water for injection (BWFI), phosphate -buffered saline, Ringer's solution and dextrose solution.
- a pharmaceutically-acceptable diluent buffer such as bacteriostatic water for injection (BWFI), phosphate -buffered saline, Ringer's solution and dextrose solution.
- BWFI bacteriostatic water for injection
- phosphate -buffered saline such as bacteriostatic water for injection (BWFI), phosphate -buffered saline, Ringer's solution and dextrose solution.
- BWFI bacteriostatic water for injection
- phosphate -buffered saline such as bacteriostatic water for injection (BWFI), phosphate -buffered saline, Ringer's solution and dextrose solution.
- the article of manufacture of the present invention also includes information, for example in the form of a package insert, indicating that the composition is used for treating CLL based on expression level of the biomarker(s) herein.
- the insert or label may take any form, such as paper or on electronic media such as a magnetically recorded medium (e.g., floppy disk) or a CD-ROM.
- the label or insert may also include other information concerning the pharmaceutical compositions and dosage forms in the kit or article of manufacture.
- an article of manufacture comprising, packaged together, a CLL medicament (e.g. B-cell antagonist, or anti-CD20 antibody) in a pharmaceutically acceptable carrier and a package insert indicating that the CLL medicament is for treating a patient with chronic lymphocytic leukemia (CLL) based on expression of one or more biomarker selected from miRNA151 3p, miRNA409 3p, PTK2, and PI3K.
- CLL chronic lymphocytic leukemia
- the invention also concerns a method for manufacturing an article of manufacture comprising combining in a package a pharmaceutical composition comprising a CLL medicament (e.g. B-cell antagonist, or anti-CD20 antibody) and a package insert indicating that the pharmaceutical composition is for treating a patient with chronic lymphocytic leukemia (CLL) based on expression of one or more biomarker selected from miRNA151 3p, miRNA409 3p, PTK2, and PI3K.
- CLL chronic lymphocytic leukemia
- the article of manufacture may further comprise an additional container comprising a pharmaceutically acceptable diluent buffer, such as bacteriostatic water for injection (BWFI), phosphate -buffered saline, Ringer's solution, and/or dextrose solution.
- BWFI bacteriostatic water for injection
- phosphate -buffered saline such as bacteriostatic water for injection (BWFI), phosphate -buffered saline, Ringer's solution
- kits useful for detecting any one or more of the biomarker(s) identified herein comprising one or more reagents for determining expression of a biomarker selected from miRNA151 3p, miRNA409 3p, PTK2, and PI3K in a sample from a CLL patient.
- the kit further comprises instructions to use the kit to select a CLL medicament (e.g. B-cell antagonist, or anti-CD20 antibody) for treating the CLL patient if the patient expresses the biomarker at an elevated level.
- a CLL medicament e.g. B-cell antagonist, or anti-CD20 antibody
- the instructions are to use the kit to select a CLL medicament other than rituximab (or other than an anti-CD20 antibody) if the patient expresses the biomarker at a reduced level.
- the one or more reagents comprise a pair of DNA primers and probe for detecting the miRNA151 3p, miRNA409 3p, PTK2, or PI3K biomarker.
- the invention hererin also concerns a method for advertising a CLL medicament comprising promoting, to a target audience, the use of the CLL medicament (e.g. B-cell antagonist, or anti-CD20 antibody) for treating a patient with chronic lymphocytic leukemia (CLL) based on expression of one or more biomarker selected from miRNA151 3p, miRNA409 3p, PTK2, and PI3K.
- CLL chronic lymphocytic leukemia
- Advertising is generally paid communication through a non-personal medium in which the sponsor is identified and the message is controlled. Advertising for purposes herein includes publicity, public relations, product placement, sponsorship, underwriting, and sales promotion. This term also includes sponsored informational public notices appearing in any of the print communications media designed to appeal to a mass audience to persuade, inform, promote, motivate, or otherwise modify behavior toward a favorable pattern of purchasing, supporting, or approving the invention herein.
- the advertising and promotion of the diagnostic method herein may be accomplished by any means.
- Examples of advertising media used to deliver these messages include television, radio, movies, magazines, newspapers, the internet, and billboards, including commercials, which are messages appearing in the broadcast media. Advertisements also include those on the seats of grocery carts, on the walls of an airport walkway, and on the sides of buses, or heard in telephone hold messages or in-store PA systems, or anywhere a visual or audible communication can be placed.
- promotion or advertising means include television, radio, movies, the internet such as webcasts and webinars, interactive computer networks intended to reach simultaneous users, fixed or electronic billboards and other public signs, posters, traditional or electronic literature such as magazines and newspapers, other media outlets, presentations or individual contacts by, e.g., e-mail, phone, instant message, postal, courier, mass, or carrier mail, in-person visits, etc.
- the type of advertising used will depend on many factors, for example, on the nature of the target audience to be reached, e.g., hospitals, insurance companies, clinics, doctors, nurses, and patients, as well as cost considerations and the relevant jurisdictional laws and regulations governing advertising of medicaments and diagnostics.
- the advertising may be individualized or customized based on user characterizations defined by service interaction and/or other data such as user demographics and geographical location.
- Pretreatment patient samples were analyzed from an international, multicenter, open- label, phase III trial, randomizing CLL patients to receive R-FC (rituximab plus
- CD 19 separation was performed by magnetic bead separation according to the manufacturer's protocol (Miltenyi, Germany).
- DISCOV ARRAY ® miRNA Profiling Service Platform DISCOV ARRAY ® miRNA Profiling Service Platform.
- a custom-manufactured AFFYMETRIX GENECHIP ® from Ambion was designed to miRNA probes derived from the Sanger miRBase (Marcus et al., J Clin Oncol. 26:4579-4586 (2008); Hiddemann et al, Blood 106:3725-3732 (2005);
- AFFYMETRIX® human exon array for estimating background signal, as described below.
- Non-miRNA control probes on the array were designed to lack sequence homology to the human genome and can be used for spike-in external reference controls.
- RNA molecules in total RNA samples 400ng total RNA per sample
- biotin 400ng total RNA per sample
- Hybridization, washing, staining, imaging, and signal extraction were performed according to AFFYMETRIX ® -recommended procedures, except that the 20X GENECHIP ® Eukaryotic Hybridization Controls were omitted from the hybridization.
- the signal processing implemented for the Ambion miRChip is a multi-step process involving probe specific signal detection calls, background estimate and correction, constant variance stabilization and either array scaling or global normalization (Hallek et al., Blood, ASH Annual Meeting Abstract, 112: 325 (2008)). For each probe, an estimated background value is subtracted that is derived from the median signal of a set of G-C-matched anti-genomic controls. Arrays within a specific analysis experiment are normalized together according to the variance stabilization method described by Hallek et al., Blood, ASH Annual Meeting
- Detection calls are based on a Wilcoxon rank-sum test of the miRNA probe signal compared to the distribution of signals from GC-content matched anti-genomic probes.
- RNA sample labeling was performed using the
- AFFYMETRIX ® GENECHIP ® Array Station (GCAS) according manufacture automated protocol.
- biotinylated cRNA was generated starting with 0.5 ⁇ g of total RNA from each sample.
- 2 ⁇ 1 of 22.5 ⁇ mixture of 5 Gene Logic's globin reduction oligos comprised of 2- alpha, 2-beta, and 1 -gamma hemoglobin gene were added to the total RNA reaction.
- the globin oligomers are gene-specific blockers that greatly reduce the amount of globin cDNAs generated from globin mRNA during the first-strand cDNA synthesis.
- Roche purchased the oligomer sequences from GeneLogic (Gainthersburg MD, USA).
- GCAS GENECHIP ® Array System
- the target labeling method was carried out with the GENECHIP® HT One-Cycle Target Labeling kit P/N 900686. Samples were then stained, washed and hybridized to AFFYMETRIX ® arrays according to manufacture protocol. Samples were hybridized in batches of 24 samples. Arrays were scanned using GENECHIP ® Scanner 3000. AFFYMETRIX ® GENECHIP ® Operation Software (GCOS) was used to capture raw signal intensities. Microarray Suite 5.0 (MAS5.0) and Expression Console were used for basic computational analysis.
- MAS5.0 Microarray Suite 5.0
- Expression Console were used for basic computational analysis.
- Probe set signal intensities were normalized using a quantile-quantile method (Bolstad et al., Bioinformatics 19: 185-193 (2003)). All normalized data were log2 -transformed prior to analysis to down- weight the influence of high expression values.
- Biotin-labeled sense strand cDNA was prepared from ⁇ g total RNA per sample using a modified AFFYMETRIX GENECHIP® Whole Transcript (WT) Sense Target Labeling Assay (AFFYMETRIX ® , Inc.). Intermediate cRNA and resulting cDNA yields were quantified by spectrophotometry. Fragmentation and labeling of cDNA was performed using 5 ⁇ g for Exon Arrays. Hybridization to arrays was carried out at 45°C for 16 hours in an AFFYMETRIX ® Model 640 hybridization oven.
- Arrays were washed and stained on an AFFYMETRIX ® FS450 Fluidics station. The arrays were scanned on an AFFYMETRIX ® GENECHIP ® Scanner 3000 7G. For every array scanned, .DAT, .CEL, .jpg, and .xml flat files are provided. In addition, RMA normalized data is provided for the core dataset and the corresponding QC information which captures metrics including Area Under the Curve (AUC) and polyA spikes.
- AUC Area Under the Curve
- Results for PTK2 were confirmed by qRT-PCR technology using ABI kits according to the manufacturer ' s protocol using UBC as control gene.
- results for miRNA 151 3p and miRNA 409 3p were confirmed by qRT-PCR technology using ABI kits according to the manufacturer ' s protocol. Expression levels of miRNA151 3p and miRNA409 3p were analyzed relative to the control genes miRNA 150 and miRNA 26 a that showed universally high expression levels.
- Pretreatment clinical features i.e demographics, prognostic markers (cytogenetic aberrations like del(17p), del(l lq), ZAP70 and CD38 expression, IgVH status), progression free survival (PFS) were compared using the Fisher's exact, Mann- Whitney, or log-rank tests.
- prognostic markers cytogenetic aberrations like del(17p), del(l lq), ZAP70 and CD38 expression, IgVH status
- PFS progression free survival
- a p-value of ⁇ 0.05 was considered statistically significant.
- Model A hi (t) exp( 3 ⁇ 473 ⁇ 4 + P 2 RNA)h 0 (t)
- ⁇ ⁇ 's are the coefficients of the following explanatory variables: o Age, Binet, IgVH, Dell7p, dell lq and Tx which respectively code for age,
- the second approach used the two models below (C and D), comparing them with a log-Likelihood ratio test (LRT test). Being interested in the possible ability of the probe set signal at baseline to predict for a better survival in one treatment group compared to the other, we included both terms in the model B: probe set signal intensity and the interaction term of the probe set signal intensity with the treatment factor.
- LRT test log-Likelihood ratio test
- Predicted targets were downloaded from TARGETSCAN 5.1TM (http://www.targetscan.org/) and expression was extracted from the mRNA expression profiling data, irrespective of predicted site conservation. Anti-correlations with miRNAs were determined by comparing miRNA array and mRNA array data and computing Pearson correlation coefficients. Significantly anti-correlated targets were determined with a q-value ⁇ 0.01.
- 3'UTRs that met this threshold were cloned upstream into 3'UTR luciferase reporter constructs (Switchgear Genomics) and 100 ng of each construct was transfected into HeLa cells (ATCC) with 25 ng pRL-CMV, 10 nM miRNA151 3p mimic (Dharmacon) or scrambled mimic in 96- well plates. Luciferase activity was determined 24 hours post-transfection and all data were normalized to renilla luciferase transfection control and scrambled control mimic. Three biological replicates were performed. Statistical significance for a difference between scrambled control and miRNA151 3p mimic was determined by a 2-sided Student's t-test.
- Table 2A Predictive significance of miRNAlSl 3p for PFS in anti-CD20 based therapy in
- Table 2B Predictive significance of miRNA409 3p for PFS in anti-CD20 based therapy in
- FIG. 2B shows that patients with higher than median expression level of miRNA409
- No differences in PFS were observed in lower than median miRNA409 3p expressers regardless of therapy (p 0.35)
- Table 3 Median PFS (months) with respect to treatment and PTK2 expression in CD 19+ cells according to AFFYMETRIX® array platforms.
- Table 4 Predictive significance of PTK2 expression in CD 19+ cells with respect to treatment (FC vs FCR) according to AFFYMETRIX® array platforms.
- miRNA151 3p To assess the potential biological consequence of altered expression levels of miRNA151 3p the expression of these miRNAs was correlated with the mRNA expression of their predicted target genes, conserved and non-conserved within the 3'UTR, since miRNAs are primarily thought to exert their effects at the level of mRNA degradation. Guo et al. N ' ature 466(7308):835-40 (2010). Target correlation coefficients were determined and only 23 predicted targets out of 1214 were negatively correlated with miRNA151 3p (PCC ⁇ -0.2 with q-value ⁇ 0.01).
- the aim of this study was to discover biomarkers that predict the outcome of CLL patients treated with anti-CD20 antibody based therapy.
- the data herein reveals, for the first time, that elevated expression levels (above median) of miRNA151 3p and miRNA409 3p as well as elevated gene expression levels of PTK2 (above median) are associated with prolonged PFS in CLL patients treated with anti-CD20 based therapy.
- the findings from microarray platforms were validated by qRT-PCR.
- the predictive significance remained in multivariate analysis using factors known to influence the prognosis of the disease.
- the data herein demonstrate the feasibility of predicting the outcome and benefit of CLL patients to anti-CD20 antibody based therapy prior to treatment.
- Diagnostic assessment of miRNAs 151 3p and 409 3p and mRNA expression of PTK2 serve as useful tools to select the most appropriate therapy for CLL patients.
Abstract
Description
Claims
Priority Applications (9)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
EP11741731.1A EP2600895A1 (en) | 2010-08-03 | 2011-08-02 | Chronic lymphocytic leukemia (cll) biomarkers |
JP2013523261A JP2013541501A (en) | 2010-08-03 | 2011-08-02 | Biomarkers for chronic lymphocytic leukemia (CLL) |
KR1020137004910A KR20130045914A (en) | 2010-08-03 | 2011-08-02 | Chronic lymphocytic leukemia (cll) biomarkers |
MX2013001302A MX2013001302A (en) | 2010-08-03 | 2011-08-02 | Chronic lymphocytic leukemia (cll) biomarkers. |
BR112013002535A BR112013002535A2 (en) | 2010-08-03 | 2011-08-02 | biomarkers of chronic lymphocytic leukemia (cll) |
CA2806855A CA2806855A1 (en) | 2010-08-03 | 2011-08-02 | Chronic lymphocytic leukemia (cll) biomarkers |
RU2013106216/15A RU2013106216A (en) | 2010-08-03 | 2011-08-02 | BIOMARKERS OF CHRONIC Lymphocytic Leukemia |
CN201180048232.9A CN103153341B (en) | 2010-08-03 | 2011-08-02 | Chronic lymphocytic leukemia (Cll) biomarkers |
US13/757,600 US20140017230A1 (en) | 2011-08-02 | 2013-02-01 | Chronic lymphocytic leukemia (cll) biomarkers |
Applications Claiming Priority (4)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US37040310P | 2010-08-03 | 2010-08-03 | |
US61/370,403 | 2010-08-03 | ||
US201161440162P | 2011-02-07 | 2011-02-07 | |
US61/440,162 | 2011-02-07 |
Related Child Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US13/757,600 Continuation US20140017230A1 (en) | 2011-08-02 | 2013-02-01 | Chronic lymphocytic leukemia (cll) biomarkers |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2012018771A1 true WO2012018771A1 (en) | 2012-02-09 |
Family
ID=45559784
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/US2011/046205 WO2012018771A1 (en) | 2010-08-03 | 2011-08-02 | Chronic lymphocytic leukemia (cll) biomarkers |
Country Status (9)
Country | Link |
---|---|
EP (1) | EP2600895A1 (en) |
JP (1) | JP2013541501A (en) |
KR (1) | KR20130045914A (en) |
CN (1) | CN103153341B (en) |
BR (1) | BR112013002535A2 (en) |
CA (1) | CA2806855A1 (en) |
MX (1) | MX2013001302A (en) |
RU (1) | RU2013106216A (en) |
WO (1) | WO2012018771A1 (en) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US8883980B2 (en) | 2003-11-05 | 2014-11-11 | Roche Glycart Ag | Antigen binding molecules with increased Fc receptor binding affinity and effector function |
Families Citing this family (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP3062105A1 (en) * | 2015-02-26 | 2016-08-31 | Université de Bretagne Occidentale (U.B.O.) | Processes for the diagnosis, prognosis and monitoring of the progression of Chronic Lymphoid Leukaemia (CLL) and/or of Systemic Lupus Erythematosus (SLE) using membrane STIM 1 |
Citations (104)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US4676980A (en) | 1985-09-23 | 1987-06-30 | The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services | Target specific cross-linked heteroantibodies |
US4683195A (en) | 1986-01-30 | 1987-07-28 | Cetus Corporation | Process for amplifying, detecting, and/or-cloning nucleic acid sequences |
US4816567A (en) | 1983-04-08 | 1989-03-28 | Genentech, Inc. | Recombinant immunoglobin preparations |
EP0404097A2 (en) | 1989-06-22 | 1990-12-27 | BEHRINGWERKE Aktiengesellschaft | Bispecific and oligospecific, mono- and oligovalent receptors, production and applications thereof |
EP0425235A2 (en) | 1989-10-25 | 1991-05-02 | Immunogen Inc | Cytotoxic agents comprising maytansinoids and their therapeutic use |
WO1993001161A1 (en) | 1991-07-11 | 1993-01-21 | Pfizer Limited | Process for preparing sertraline intermediates |
US5208020A (en) | 1989-10-25 | 1993-05-04 | Immunogen Inc. | Cytotoxic agents comprising maytansinoids and their therapeutic use |
WO1993008829A1 (en) | 1991-11-04 | 1993-05-13 | The Regents Of The University Of California | Compositions that mediate killing of hiv-infected cells |
WO1993016185A2 (en) | 1992-02-06 | 1993-08-19 | Creative Biomolecules, Inc. | Biosynthetic binding protein for cancer marker |
WO1994011026A2 (en) | 1992-11-13 | 1994-05-26 | Idec Pharmaceuticals Corporation | Therapeutic application of chimeric and radiolabeled antibodies to human b lymphocyte restricted differentiation antigen for treatment of b cell lymphoma |
WO1994029351A2 (en) | 1993-06-16 | 1994-12-22 | Celltech Limited | Antibodies |
US5571894A (en) | 1991-02-05 | 1996-11-05 | Ciba-Geigy Corporation | Recombinant antibodies specific for a growth factor receptor |
US5587458A (en) | 1991-10-07 | 1996-12-24 | Aronex Pharmaceuticals, Inc. | Anti-erbB-2 antibodies, combinations thereof, and therapeutic and diagnostic uses thereof |
US5595721A (en) | 1993-09-16 | 1997-01-21 | Coulter Pharmaceutical, Inc. | Radioimmunotherapy of lymphoma using anti-CD20 |
US5624821A (en) | 1987-03-18 | 1997-04-29 | Scotgen Biopharmaceuticals Incorporated | Antibodies with altered effector functions |
US5635483A (en) | 1992-12-03 | 1997-06-03 | Arizona Board Of Regents Acting On Behalf Of Arizona State University | Tumor inhibiting tetrapeptide bearing modified phenethyl amides |
WO1997030087A1 (en) | 1996-02-16 | 1997-08-21 | Glaxo Group Limited | Preparation of glycosylated antibodies |
US5712374A (en) | 1995-06-07 | 1998-01-27 | American Cyanamid Company | Method for the preparation of substantiallly monomeric calicheamicin derivative/carrier conjugates |
US5714586A (en) | 1995-06-07 | 1998-02-03 | American Cyanamid Company | Methods for the preparation of monomeric calicheamicin derivative/carrier conjugates |
US5731168A (en) | 1995-03-01 | 1998-03-24 | Genentech, Inc. | Method for making heteromultimeric polypeptides |
US5736137A (en) | 1992-11-13 | 1998-04-07 | Idec Pharmaceuticals Corporation | Therapeutic application of chimeric and radiolabeled antibodies to human B lymphocyte restricted differentiation antigen for treatment of B cell lymphoma |
US5739116A (en) | 1994-06-03 | 1998-04-14 | American Cyanamid Company | Enediyne derivatives useful for the synthesis of conjugates of methyltrithio antitumor agents |
US5750373A (en) | 1990-12-03 | 1998-05-12 | Genentech, Inc. | Enrichment method for variant proteins having altered binding properties, M13 phagemids, and growth hormone variants |
US5770710A (en) | 1987-10-30 | 1998-06-23 | American Cyanamid Company | Antitumor and antibacterial substituted disulfide derivatives prepared from compounds possessing a methlytrithio group |
US5770429A (en) | 1990-08-29 | 1998-06-23 | Genpharm International, Inc. | Transgenic non-human animals capable of producing heterologous antibodies |
US5770701A (en) | 1987-10-30 | 1998-06-23 | American Cyanamid Company | Process for preparing targeted forms of methyltrithio antitumor agents |
US5780588A (en) | 1993-01-26 | 1998-07-14 | Arizona Board Of Regents | Elucidation and synthesis of selected pentapeptides |
US5821337A (en) | 1991-06-14 | 1998-10-13 | Genentech, Inc. | Immunoglobulin variants |
US5846818A (en) | 1985-11-01 | 1998-12-08 | Xoma Corporation | Pectate lyase signal sequence |
WO1998058964A1 (en) | 1997-06-24 | 1998-12-30 | Genentech, Inc. | Methods and compositions for galactosylated glycoproteins |
US5869046A (en) | 1995-04-14 | 1999-02-09 | Genentech, Inc. | Altered polypeptides with increased half-life |
WO1999022764A1 (en) | 1997-10-31 | 1999-05-14 | Genentech, Inc. | Methods and compositions comprising glycoprotein glycoforms |
WO1999051642A1 (en) | 1998-04-02 | 1999-10-14 | Genentech, Inc. | Antibody variants and fragments thereof |
WO1999054342A1 (en) | 1998-04-20 | 1999-10-28 | Pablo Umana | Glycosylation engineering of antibodies for improving antibody-dependent cellular cytotoxicity |
WO2000009160A1 (en) * | 1998-08-11 | 2000-02-24 | Idec Pharmaceuticals Corporation | Combination therapies for b-cell lymphomas comprising administration of anti-cd20 antibody |
WO2000027428A1 (en) * | 1998-11-09 | 2000-05-18 | Idec Pharmaceuticals Corporation | Treatment of hematologic malignancies associated with circulating tumor cells using chimeric anti-cd20 antibody |
US6075181A (en) | 1990-01-12 | 2000-06-13 | Abgenix, Inc. | Human antibodies derived from immunized xenomice |
WO2000061739A1 (en) | 1999-04-09 | 2000-10-19 | Kyowa Hakko Kogyo Co., Ltd. | Method for controlling the activity of immunologically functional molecule |
US6150584A (en) | 1990-01-12 | 2000-11-21 | Abgenix, Inc. | Human antibodies derived from immunized xenomice |
US6194551B1 (en) | 1998-04-02 | 2001-02-27 | Genentech, Inc. | Polypeptide variants |
US6204023B1 (en) | 1985-11-01 | 2001-03-20 | Xoma Ltd. | Modular assembly of antibody genes, antibodies prepared thereby and use |
WO2001029246A1 (en) | 1999-10-19 | 2001-04-26 | Kyowa Hakko Kogyo Co., Ltd. | Process for producing polypeptide |
US6248516B1 (en) | 1988-11-11 | 2001-06-19 | Medical Research Council | Single domain ligands, receptors comprising said ligands methods for their production, and use of said ligands and receptors |
WO2002031140A1 (en) | 2000-10-06 | 2002-04-18 | Kyowa Hakko Kogyo Co., Ltd. | Cells producing antibody compositions |
US20020164328A1 (en) | 2000-10-06 | 2002-11-07 | Toyohide Shinkawa | Process for purifying antibody |
WO2003002607A1 (en) | 2001-06-27 | 2003-01-09 | Shawn Shui-On Leung | Reducing immunogenicities of immunoglobulins by framework-patching |
WO2003011878A2 (en) | 2001-08-03 | 2003-02-13 | Glycart Biotechnology Ag | Antibody glycosylation variants having increased antibody-dependent cellular cytotoxicity |
US20030115614A1 (en) | 2000-10-06 | 2003-06-19 | Yutaka Kanda | Antibody composition-producing cell |
US20030157108A1 (en) | 2001-10-25 | 2003-08-21 | Genentech, Inc. | Glycoprotein compositions |
US6630579B2 (en) | 1999-12-29 | 2003-10-07 | Immunogen Inc. | Cytotoxic agents comprising modified doxorubicins and daunorubicins and their therapeutic use |
WO2003084570A1 (en) | 2002-04-09 | 2003-10-16 | Kyowa Hakko Kogyo Co., Ltd. | DRUG CONTAINING ANTIBODY COMPOSITION APPROPRIATE FOR PATIENT SUFFERING FROM FcϜRIIIa POLYMORPHISM |
WO2003085119A1 (en) | 2002-04-09 | 2003-10-16 | Kyowa Hakko Kogyo Co., Ltd. | METHOD OF ENHANCING ACTIVITY OF ANTIBODY COMPOSITION OF BINDING TO FcϜ RECEPTOR IIIa |
WO2003085107A1 (en) | 2002-04-09 | 2003-10-16 | Kyowa Hakko Kogyo Co., Ltd. | Cells with modified genome |
US20030219433A1 (en) | 2002-02-14 | 2003-11-27 | Immunomedics, Inc. | Anti-CD20 antibodies and fusion proteins thereof and methods of use |
WO2004035607A2 (en) | 2002-10-17 | 2004-04-29 | Genmab A/S | Human monoclonal antibodies against cd20 |
US20040093621A1 (en) | 2001-12-25 | 2004-05-13 | Kyowa Hakko Kogyo Co., Ltd | Antibody composition which specifically binds to CD20 |
US6737056B1 (en) | 1999-01-15 | 2004-05-18 | Genentech, Inc. | Polypeptide variants with altered effector function |
US20040110282A1 (en) | 2002-04-09 | 2004-06-10 | Kyowa Hakko Kogyo Co., Ltd. | Cells in which activity of the protein involved in transportation of GDP-fucose is reduced or lost |
US20040109865A1 (en) | 2002-04-09 | 2004-06-10 | Kyowa Hakko Kogyo Co., Ltd. | Antibody composition-containing medicament |
WO2004056312A2 (en) | 2002-12-16 | 2004-07-08 | Genentech, Inc. | Immunoglobulin variants and uses thereof |
US20040132140A1 (en) | 2002-04-09 | 2004-07-08 | Kyowa Hakko Kogyo Co., Ltd. | Production process for antibody composition |
WO2004065540A2 (en) | 2003-01-22 | 2004-08-05 | Glycart Biotechnology Ag | Fusion constructs and use of same to produce antibodies with increased fc receptor binding affinity and effector function |
WO2004103404A1 (en) | 2003-05-20 | 2004-12-02 | Applied Molecular Evolution, Inc. | Cd20 binding molecules |
WO2005000901A2 (en) | 2003-05-09 | 2005-01-06 | Duke University | Cd20-specific antibodies and methods of employing same |
US20050014934A1 (en) | 2002-10-15 | 2005-01-20 | Hinton Paul R. | Alteration of FcRn binding affinities or serum half-lives of antibodies by mutagenesis |
WO2005014618A2 (en) | 2003-08-08 | 2005-02-17 | Immunomedics, Inc. | Bispecific antibodies for inducing apoptosis of tumor and diseased cells |
WO2005016969A2 (en) | 2003-08-14 | 2005-02-24 | Merck Patent Gmbh | Cd20-binding polypeptide compositions |
US20050079574A1 (en) | 2003-01-16 | 2005-04-14 | Genentech, Inc. | Synthetic antibody phage libraries |
WO2005035586A1 (en) | 2003-10-08 | 2005-04-21 | Kyowa Hakko Kogyo Co., Ltd. | Fused protein composition |
WO2005035778A1 (en) | 2003-10-09 | 2005-04-21 | Kyowa Hakko Kogyo Co., Ltd. | PROCESS FOR PRODUCING ANTIBODY COMPOSITION BY USING RNA INHIBITING THE FUNCTION OF α1,6-FUCOSYLTRANSFERASE |
WO2005044859A2 (en) | 2003-11-05 | 2005-05-19 | Glycart Biotechnology Ag | Cd20 antibodies with increased fc receptor binding affinity and effector function |
US20050119455A1 (en) | 2002-06-03 | 2005-06-02 | Genentech, Inc. | Synthetic antibody phage libraries |
WO2005053742A1 (en) | 2003-12-04 | 2005-06-16 | Kyowa Hakko Kogyo Co., Ltd. | Medicine containing antibody composition |
US20050136049A1 (en) | 2001-01-17 | 2005-06-23 | Ledbetter Jeffrey A. | Binding constructs and methods for use thereof |
WO2005070963A1 (en) | 2004-01-12 | 2005-08-04 | Applied Molecular Evolution, Inc | Fc region variants |
US20050186216A1 (en) | 2001-01-17 | 2005-08-25 | Trubion Pharmaceuticals, Inc. | Binding domain-immunoglobulin fusion proteins |
WO2005103081A2 (en) | 2004-04-20 | 2005-11-03 | Genmab A/S | Human monoclonal antibodies against cd20 |
US20050266000A1 (en) | 2004-04-09 | 2005-12-01 | Genentech, Inc. | Variable domain library and uses |
US6982321B2 (en) | 1986-03-27 | 2006-01-03 | Medical Research Council | Altered antibodies |
US20060025576A1 (en) | 2000-04-11 | 2006-02-02 | Genentech, Inc. | Multivalent antibodies and uses therefor |
US7041870B2 (en) | 2000-11-30 | 2006-05-09 | Medarex, Inc. | Transgenic transchromosomal rodents for making human antibodies |
US7087409B2 (en) | 1997-12-05 | 2006-08-08 | The Scripps Research Institute | Humanization of murine antibody |
US20060188495A1 (en) | 2005-01-13 | 2006-08-24 | Genentech, Inc. | Treatment method |
WO2006106959A1 (en) | 2005-03-31 | 2006-10-12 | Biomedics Inc. | Anti-cd-20 monoclonal antibody |
US20060246004A1 (en) | 2005-02-07 | 2006-11-02 | Genentech, Inc. | Antibody variants and uses thereof |
WO2006126069A2 (en) | 2005-05-24 | 2006-11-30 | Avestha Gengraine Technologies Pvt Ltd. | A method for the production of a monoclonal antibody to cd20 for the treatment of b-cell lymphoma |
WO2006130458A2 (en) | 2005-06-02 | 2006-12-07 | Astrazeneca Ab | Antibodies directed to cd20 and uses thereof |
US7189826B2 (en) | 1997-11-24 | 2007-03-13 | Institute For Human Genetics And Biochemistry | Monoclonal human natural antibodies |
US20070061900A1 (en) | 2000-10-31 | 2007-03-15 | Murphy Andrew J | Methods of modifying eukaryotic cells |
WO2007033023A2 (en) * | 2005-09-12 | 2007-03-22 | The Ohio State University Research Foundation | Compositions and methods for the diagnosis and therapy of bcl2-associated cancers |
WO2007031875A2 (en) | 2005-08-26 | 2007-03-22 | Glycart Biotechnology Ag | Modified antigen binding molecules with altered cell signaling activity |
US20070117126A1 (en) | 1999-12-15 | 2007-05-24 | Genentech, Inc. | Shotgun scanning |
US20070160598A1 (en) | 2005-11-07 | 2007-07-12 | Dennis Mark S | Binding polypeptides with diversified and consensus vh/vl hypervariable sequences |
US20070237764A1 (en) | 2005-12-02 | 2007-10-11 | Genentech, Inc. | Binding polypeptides with restricted diversity sequences |
US20070292936A1 (en) | 2006-05-09 | 2007-12-20 | Genentech, Inc. | Binding polypeptides with optimized scaffolds |
US20080069820A1 (en) | 2006-08-30 | 2008-03-20 | Genentech, Inc. | Multispecific antibodies |
US7371826B2 (en) | 1999-01-15 | 2008-05-13 | Genentech, Inc. | Polypeptide variants with altered effector function |
WO2008077546A1 (en) | 2006-12-22 | 2008-07-03 | F. Hoffmann-La Roche Ag | Antibodies against insulin-like growth factor i receptor and uses thereof |
US20090002360A1 (en) | 2007-05-25 | 2009-01-01 | Innolux Display Corp. | Liquid crystal display device and method for driving same |
US7498298B2 (en) | 2003-11-06 | 2009-03-03 | Seattle Genetics, Inc. | Monomethylvaline compounds capable of conjugation to ligands |
US7521541B2 (en) | 2004-09-23 | 2009-04-21 | Genetech Inc. | Cysteine engineered antibodies and conjugates |
US7527791B2 (en) | 2004-03-31 | 2009-05-05 | Genentech, Inc. | Humanized anti-TGF-beta antibodies |
WO2009062054A1 (en) * | 2007-11-09 | 2009-05-14 | Novartis Ag | Uses of anti-cd40 antibodies |
WO2009089004A1 (en) | 2008-01-07 | 2009-07-16 | Amgen Inc. | Method for making antibody fc-heterodimeric molecules using electrostatic steering effects |
Family Cites Families (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
NZ592241A (en) * | 2008-09-15 | 2012-11-30 | Herlev Hospital | Ykl-40 as a marker for gastrointestinal cancers |
-
2011
- 2011-08-02 KR KR1020137004910A patent/KR20130045914A/en not_active Application Discontinuation
- 2011-08-02 EP EP11741731.1A patent/EP2600895A1/en not_active Withdrawn
- 2011-08-02 JP JP2013523261A patent/JP2013541501A/en active Pending
- 2011-08-02 CA CA2806855A patent/CA2806855A1/en not_active Abandoned
- 2011-08-02 WO PCT/US2011/046205 patent/WO2012018771A1/en active Application Filing
- 2011-08-02 CN CN201180048232.9A patent/CN103153341B/en not_active Expired - Fee Related
- 2011-08-02 BR BR112013002535A patent/BR112013002535A2/en not_active IP Right Cessation
- 2011-08-02 RU RU2013106216/15A patent/RU2013106216A/en not_active Application Discontinuation
- 2011-08-02 MX MX2013001302A patent/MX2013001302A/en not_active Application Discontinuation
Patent Citations (122)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US4816567A (en) | 1983-04-08 | 1989-03-28 | Genentech, Inc. | Recombinant immunoglobin preparations |
US4676980A (en) | 1985-09-23 | 1987-06-30 | The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services | Target specific cross-linked heteroantibodies |
US6204023B1 (en) | 1985-11-01 | 2001-03-20 | Xoma Ltd. | Modular assembly of antibody genes, antibodies prepared thereby and use |
US5846818A (en) | 1985-11-01 | 1998-12-08 | Xoma Corporation | Pectate lyase signal sequence |
US4683195A (en) | 1986-01-30 | 1987-07-28 | Cetus Corporation | Process for amplifying, detecting, and/or-cloning nucleic acid sequences |
US4683195B1 (en) | 1986-01-30 | 1990-11-27 | Cetus Corp | |
US6982321B2 (en) | 1986-03-27 | 2006-01-03 | Medical Research Council | Altered antibodies |
US5624821A (en) | 1987-03-18 | 1997-04-29 | Scotgen Biopharmaceuticals Incorporated | Antibodies with altered effector functions |
US5648260A (en) | 1987-03-18 | 1997-07-15 | Scotgen Biopharmaceuticals Incorporated | DNA encoding antibodies with altered effector functions |
US5770710A (en) | 1987-10-30 | 1998-06-23 | American Cyanamid Company | Antitumor and antibacterial substituted disulfide derivatives prepared from compounds possessing a methlytrithio group |
US5770701A (en) | 1987-10-30 | 1998-06-23 | American Cyanamid Company | Process for preparing targeted forms of methyltrithio antitumor agents |
US6248516B1 (en) | 1988-11-11 | 2001-06-19 | Medical Research Council | Single domain ligands, receptors comprising said ligands methods for their production, and use of said ligands and receptors |
EP0404097A2 (en) | 1989-06-22 | 1990-12-27 | BEHRINGWERKE Aktiengesellschaft | Bispecific and oligospecific, mono- and oligovalent receptors, production and applications thereof |
US5208020A (en) | 1989-10-25 | 1993-05-04 | Immunogen Inc. | Cytotoxic agents comprising maytansinoids and their therapeutic use |
US5416064A (en) | 1989-10-25 | 1995-05-16 | Immunogen, Inc. | Cytotoxic agents comprising maytansinoids and their therapeutic use |
EP0425235A2 (en) | 1989-10-25 | 1991-05-02 | Immunogen Inc | Cytotoxic agents comprising maytansinoids and their therapeutic use |
US6150584A (en) | 1990-01-12 | 2000-11-21 | Abgenix, Inc. | Human antibodies derived from immunized xenomice |
US6075181A (en) | 1990-01-12 | 2000-06-13 | Abgenix, Inc. | Human antibodies derived from immunized xenomice |
US5770429A (en) | 1990-08-29 | 1998-06-23 | Genpharm International, Inc. | Transgenic non-human animals capable of producing heterologous antibodies |
US5750373A (en) | 1990-12-03 | 1998-05-12 | Genentech, Inc. | Enrichment method for variant proteins having altered binding properties, M13 phagemids, and growth hormone variants |
US5571894A (en) | 1991-02-05 | 1996-11-05 | Ciba-Geigy Corporation | Recombinant antibodies specific for a growth factor receptor |
US5821337A (en) | 1991-06-14 | 1998-10-13 | Genentech, Inc. | Immunoglobulin variants |
WO1993001161A1 (en) | 1991-07-11 | 1993-01-21 | Pfizer Limited | Process for preparing sertraline intermediates |
US5587458A (en) | 1991-10-07 | 1996-12-24 | Aronex Pharmaceuticals, Inc. | Anti-erbB-2 antibodies, combinations thereof, and therapeutic and diagnostic uses thereof |
WO1993008829A1 (en) | 1991-11-04 | 1993-05-13 | The Regents Of The University Of California | Compositions that mediate killing of hiv-infected cells |
WO1993016185A2 (en) | 1992-02-06 | 1993-08-19 | Creative Biomolecules, Inc. | Biosynthetic binding protein for cancer marker |
US7381560B2 (en) | 1992-11-13 | 2008-06-03 | Biogen Idec Inc. | Expression and use of anti-CD20 antibodies |
US5736137A (en) | 1992-11-13 | 1998-04-07 | Idec Pharmaceuticals Corporation | Therapeutic application of chimeric and radiolabeled antibodies to human B lymphocyte restricted differentiation antigen for treatment of B cell lymphoma |
WO1994011026A2 (en) | 1992-11-13 | 1994-05-26 | Idec Pharmaceuticals Corporation | Therapeutic application of chimeric and radiolabeled antibodies to human b lymphocyte restricted differentiation antigen for treatment of b cell lymphoma |
US5635483A (en) | 1992-12-03 | 1997-06-03 | Arizona Board Of Regents Acting On Behalf Of Arizona State University | Tumor inhibiting tetrapeptide bearing modified phenethyl amides |
US5780588A (en) | 1993-01-26 | 1998-07-14 | Arizona Board Of Regents | Elucidation and synthesis of selected pentapeptides |
WO1994029351A2 (en) | 1993-06-16 | 1994-12-22 | Celltech Limited | Antibodies |
US5595721A (en) | 1993-09-16 | 1997-01-21 | Coulter Pharmaceutical, Inc. | Radioimmunotherapy of lymphoma using anti-CD20 |
US5773001A (en) | 1994-06-03 | 1998-06-30 | American Cyanamid Company | Conjugates of methyltrithio antitumor agents and intermediates for their synthesis |
US5767285A (en) | 1994-06-03 | 1998-06-16 | American Cyanamid Company | Linkers useful for the synthesis of conjugates of methyltrithio antitumor agents |
US5739116A (en) | 1994-06-03 | 1998-04-14 | American Cyanamid Company | Enediyne derivatives useful for the synthesis of conjugates of methyltrithio antitumor agents |
US5877296A (en) | 1994-06-03 | 1999-03-02 | American Cyanamid Company | Process for preparing conjugates of methyltrithio antitumor agents |
US5731168A (en) | 1995-03-01 | 1998-03-24 | Genentech, Inc. | Method for making heteromultimeric polypeptides |
US5869046A (en) | 1995-04-14 | 1999-02-09 | Genentech, Inc. | Altered polypeptides with increased half-life |
US5714586A (en) | 1995-06-07 | 1998-02-03 | American Cyanamid Company | Methods for the preparation of monomeric calicheamicin derivative/carrier conjugates |
US5712374A (en) | 1995-06-07 | 1998-01-27 | American Cyanamid Company | Method for the preparation of substantiallly monomeric calicheamicin derivative/carrier conjugates |
WO1997030087A1 (en) | 1996-02-16 | 1997-08-21 | Glaxo Group Limited | Preparation of glycosylated antibodies |
WO1998058964A1 (en) | 1997-06-24 | 1998-12-30 | Genentech, Inc. | Methods and compositions for galactosylated glycoproteins |
WO1999022764A1 (en) | 1997-10-31 | 1999-05-14 | Genentech, Inc. | Methods and compositions comprising glycoprotein glycoforms |
US7189826B2 (en) | 1997-11-24 | 2007-03-13 | Institute For Human Genetics And Biochemistry | Monoclonal human natural antibodies |
US7087409B2 (en) | 1997-12-05 | 2006-08-08 | The Scripps Research Institute | Humanization of murine antibody |
US6194551B1 (en) | 1998-04-02 | 2001-02-27 | Genentech, Inc. | Polypeptide variants |
WO1999051642A1 (en) | 1998-04-02 | 1999-10-14 | Genentech, Inc. | Antibody variants and fragments thereof |
WO1999054342A1 (en) | 1998-04-20 | 1999-10-28 | Pablo Umana | Glycosylation engineering of antibodies for improving antibody-dependent cellular cytotoxicity |
US6602684B1 (en) | 1998-04-20 | 2003-08-05 | Glycart Biotechnology Ag | Glycosylation engineering of antibodies for improving antibody-dependent cellular cytotoxicity |
WO2000009160A1 (en) * | 1998-08-11 | 2000-02-24 | Idec Pharmaceuticals Corporation | Combination therapies for b-cell lymphomas comprising administration of anti-cd20 antibody |
WO2000027428A1 (en) * | 1998-11-09 | 2000-05-18 | Idec Pharmaceuticals Corporation | Treatment of hematologic malignancies associated with circulating tumor cells using chimeric anti-cd20 antibody |
US6737056B1 (en) | 1999-01-15 | 2004-05-18 | Genentech, Inc. | Polypeptide variants with altered effector function |
US7332581B2 (en) | 1999-01-15 | 2008-02-19 | Genentech, Inc. | Polypeptide variants with altered effector function |
US7371826B2 (en) | 1999-01-15 | 2008-05-13 | Genentech, Inc. | Polypeptide variants with altered effector function |
WO2000061739A1 (en) | 1999-04-09 | 2000-10-19 | Kyowa Hakko Kogyo Co., Ltd. | Method for controlling the activity of immunologically functional molecule |
WO2001029246A1 (en) | 1999-10-19 | 2001-04-26 | Kyowa Hakko Kogyo Co., Ltd. | Process for producing polypeptide |
US20070117126A1 (en) | 1999-12-15 | 2007-05-24 | Genentech, Inc. | Shotgun scanning |
US6630579B2 (en) | 1999-12-29 | 2003-10-07 | Immunogen Inc. | Cytotoxic agents comprising modified doxorubicins and daunorubicins and their therapeutic use |
US20060025576A1 (en) | 2000-04-11 | 2006-02-02 | Genentech, Inc. | Multivalent antibodies and uses therefor |
WO2002031140A1 (en) | 2000-10-06 | 2002-04-18 | Kyowa Hakko Kogyo Co., Ltd. | Cells producing antibody compositions |
US20020164328A1 (en) | 2000-10-06 | 2002-11-07 | Toyohide Shinkawa | Process for purifying antibody |
US20030115614A1 (en) | 2000-10-06 | 2003-06-19 | Yutaka Kanda | Antibody composition-producing cell |
US20070061900A1 (en) | 2000-10-31 | 2007-03-15 | Murphy Andrew J | Methods of modifying eukaryotic cells |
US7041870B2 (en) | 2000-11-30 | 2006-05-09 | Medarex, Inc. | Transgenic transchromosomal rodents for making human antibodies |
US20050136049A1 (en) | 2001-01-17 | 2005-06-23 | Ledbetter Jeffrey A. | Binding constructs and methods for use thereof |
US20050202028A1 (en) | 2001-01-17 | 2005-09-15 | Trubion Pharmaceuticals, Inc. | Binding domain-immunoglobulin fusion proteins |
US20050202534A1 (en) | 2001-01-17 | 2005-09-15 | Trubion Pharmaceuticals, Inc. | Binding domain-immunoglobulin fusion proteins |
US20050202023A1 (en) | 2001-01-17 | 2005-09-15 | Trubion Pharmaceuticals, Inc. | Binding domain-immunoglobulin fusion proteins |
US20050186216A1 (en) | 2001-01-17 | 2005-08-25 | Trubion Pharmaceuticals, Inc. | Binding domain-immunoglobulin fusion proteins |
WO2003002607A1 (en) | 2001-06-27 | 2003-01-09 | Shawn Shui-On Leung | Reducing immunogenicities of immunoglobulins by framework-patching |
WO2003011878A2 (en) | 2001-08-03 | 2003-02-13 | Glycart Biotechnology Ag | Antibody glycosylation variants having increased antibody-dependent cellular cytotoxicity |
US20030157108A1 (en) | 2001-10-25 | 2003-08-21 | Genentech, Inc. | Glycoprotein compositions |
US20040093621A1 (en) | 2001-12-25 | 2004-05-13 | Kyowa Hakko Kogyo Co., Ltd | Antibody composition which specifically binds to CD20 |
US20030219433A1 (en) | 2002-02-14 | 2003-11-27 | Immunomedics, Inc. | Anti-CD20 antibodies and fusion proteins thereof and methods of use |
WO2003085107A1 (en) | 2002-04-09 | 2003-10-16 | Kyowa Hakko Kogyo Co., Ltd. | Cells with modified genome |
US20040110704A1 (en) | 2002-04-09 | 2004-06-10 | Kyowa Hakko Kogyo Co., Ltd. | Cells of which genome is modified |
US20040132140A1 (en) | 2002-04-09 | 2004-07-08 | Kyowa Hakko Kogyo Co., Ltd. | Production process for antibody composition |
WO2003085119A1 (en) | 2002-04-09 | 2003-10-16 | Kyowa Hakko Kogyo Co., Ltd. | METHOD OF ENHANCING ACTIVITY OF ANTIBODY COMPOSITION OF BINDING TO FcϜ RECEPTOR IIIa |
US20040110282A1 (en) | 2002-04-09 | 2004-06-10 | Kyowa Hakko Kogyo Co., Ltd. | Cells in which activity of the protein involved in transportation of GDP-fucose is reduced or lost |
WO2003084570A1 (en) | 2002-04-09 | 2003-10-16 | Kyowa Hakko Kogyo Co., Ltd. | DRUG CONTAINING ANTIBODY COMPOSITION APPROPRIATE FOR PATIENT SUFFERING FROM FcϜRIIIa POLYMORPHISM |
US20040109865A1 (en) | 2002-04-09 | 2004-06-10 | Kyowa Hakko Kogyo Co., Ltd. | Antibody composition-containing medicament |
US20050119455A1 (en) | 2002-06-03 | 2005-06-02 | Genentech, Inc. | Synthetic antibody phage libraries |
US20050014934A1 (en) | 2002-10-15 | 2005-01-20 | Hinton Paul R. | Alteration of FcRn binding affinities or serum half-lives of antibodies by mutagenesis |
WO2004035607A2 (en) | 2002-10-17 | 2004-04-29 | Genmab A/S | Human monoclonal antibodies against cd20 |
WO2004056312A2 (en) | 2002-12-16 | 2004-07-08 | Genentech, Inc. | Immunoglobulin variants and uses thereof |
US20060034835A1 (en) | 2002-12-16 | 2006-02-16 | Genentech, Inc. | Immunoglobulin variants and uses thereof |
US20050079574A1 (en) | 2003-01-16 | 2005-04-14 | Genentech, Inc. | Synthetic antibody phage libraries |
WO2004065540A2 (en) | 2003-01-22 | 2004-08-05 | Glycart Biotechnology Ag | Fusion constructs and use of same to produce antibodies with increased fc receptor binding affinity and effector function |
WO2005000901A2 (en) | 2003-05-09 | 2005-01-06 | Duke University | Cd20-specific antibodies and methods of employing same |
US20060251652A1 (en) | 2003-05-20 | 2006-11-09 | Applied Molecular Evolution, Inc., | Cd20 binding molecules |
WO2004103404A1 (en) | 2003-05-20 | 2004-12-02 | Applied Molecular Evolution, Inc. | Cd20 binding molecules |
US20050025764A1 (en) | 2003-05-20 | 2005-02-03 | Watkins Jeffry D. | CD20 binding molecules |
WO2005014618A2 (en) | 2003-08-08 | 2005-02-17 | Immunomedics, Inc. | Bispecific antibodies for inducing apoptosis of tumor and diseased cells |
US20050069545A1 (en) | 2003-08-14 | 2005-03-31 | Carr Francis Joseph | CD20-Binding polypeptide compositions and methods |
WO2005016969A2 (en) | 2003-08-14 | 2005-02-24 | Merck Patent Gmbh | Cd20-binding polypeptide compositions |
WO2005035586A1 (en) | 2003-10-08 | 2005-04-21 | Kyowa Hakko Kogyo Co., Ltd. | Fused protein composition |
WO2005035778A1 (en) | 2003-10-09 | 2005-04-21 | Kyowa Hakko Kogyo Co., Ltd. | PROCESS FOR PRODUCING ANTIBODY COMPOSITION BY USING RNA INHIBITING THE FUNCTION OF α1,6-FUCOSYLTRANSFERASE |
US20050123546A1 (en) | 2003-11-05 | 2005-06-09 | Glycart Biotechnology Ag | Antigen binding molecules with increased Fc receptor binding affinity and effector function |
WO2005044859A2 (en) | 2003-11-05 | 2005-05-19 | Glycart Biotechnology Ag | Cd20 antibodies with increased fc receptor binding affinity and effector function |
US7498298B2 (en) | 2003-11-06 | 2009-03-03 | Seattle Genetics, Inc. | Monomethylvaline compounds capable of conjugation to ligands |
WO2005053742A1 (en) | 2003-12-04 | 2005-06-16 | Kyowa Hakko Kogyo Co., Ltd. | Medicine containing antibody composition |
WO2005070963A1 (en) | 2004-01-12 | 2005-08-04 | Applied Molecular Evolution, Inc | Fc region variants |
US7527791B2 (en) | 2004-03-31 | 2009-05-05 | Genentech, Inc. | Humanized anti-TGF-beta antibodies |
US20050266000A1 (en) | 2004-04-09 | 2005-12-01 | Genentech, Inc. | Variable domain library and uses |
WO2005103081A2 (en) | 2004-04-20 | 2005-11-03 | Genmab A/S | Human monoclonal antibodies against cd20 |
US7521541B2 (en) | 2004-09-23 | 2009-04-21 | Genetech Inc. | Cysteine engineered antibodies and conjugates |
US20060188495A1 (en) | 2005-01-13 | 2006-08-24 | Genentech, Inc. | Treatment method |
US20060246004A1 (en) | 2005-02-07 | 2006-11-02 | Genentech, Inc. | Antibody variants and uses thereof |
WO2006106959A1 (en) | 2005-03-31 | 2006-10-12 | Biomedics Inc. | Anti-cd-20 monoclonal antibody |
WO2006126069A2 (en) | 2005-05-24 | 2006-11-30 | Avestha Gengraine Technologies Pvt Ltd. | A method for the production of a monoclonal antibody to cd20 for the treatment of b-cell lymphoma |
WO2006130458A2 (en) | 2005-06-02 | 2006-12-07 | Astrazeneca Ab | Antibodies directed to cd20 and uses thereof |
WO2007031875A2 (en) | 2005-08-26 | 2007-03-22 | Glycart Biotechnology Ag | Modified antigen binding molecules with altered cell signaling activity |
WO2007033023A2 (en) * | 2005-09-12 | 2007-03-22 | The Ohio State University Research Foundation | Compositions and methods for the diagnosis and therapy of bcl2-associated cancers |
US20070160598A1 (en) | 2005-11-07 | 2007-07-12 | Dennis Mark S | Binding polypeptides with diversified and consensus vh/vl hypervariable sequences |
US20070237764A1 (en) | 2005-12-02 | 2007-10-11 | Genentech, Inc. | Binding polypeptides with restricted diversity sequences |
US20070292936A1 (en) | 2006-05-09 | 2007-12-20 | Genentech, Inc. | Binding polypeptides with optimized scaffolds |
US20080069820A1 (en) | 2006-08-30 | 2008-03-20 | Genentech, Inc. | Multispecific antibodies |
WO2008077546A1 (en) | 2006-12-22 | 2008-07-03 | F. Hoffmann-La Roche Ag | Antibodies against insulin-like growth factor i receptor and uses thereof |
US20090002360A1 (en) | 2007-05-25 | 2009-01-01 | Innolux Display Corp. | Liquid crystal display device and method for driving same |
WO2009062054A1 (en) * | 2007-11-09 | 2009-05-14 | Novartis Ag | Uses of anti-cd40 antibodies |
WO2009089004A1 (en) | 2008-01-07 | 2009-07-16 | Amgen Inc. | Method for making antibody fc-heterodimeric molecules using electrostatic steering effects |
Non-Patent Citations (149)
Title |
---|
"The Leukocyte Antigen Facts Book", 1997, ACADEMIC PRESS |
AGIRRE ET AL., MOL. CANCER RES., vol. 6, no. 12, 2008, pages 1830 - 1840 |
AHMADI TAHAMTAN ET AL: "Chronic lymphocytic leukemia: new concepts and emerging therapies.", CURRENT TREATMENT OPTIONS IN ONCOLOGY APR 2009 LNKD- PUBMED:19169831, vol. 10, no. 1-2, April 2009 (2009-04-01), pages 16 - 32, XP002665079, ISSN: 1534-6277 * |
ALMAGRO, FRANSSON, FRONT. BIOSCI., vol. 13, 2008, pages 1619 - 1633 |
ALTOMONTE ET AL., J. CELL. PHYSIOL, vol. 200, 2004, pages 272 - 274 |
AUSUBEL ET AL.: "Current Protocols in Molecular Biology", 1995, WILEY TNTERSCIENCE PUBLISHERS |
AUSUBEL ET AL.: "Current Protocols ofmolecular Biology", 1997, JOHN WILEY AND SONS |
BACA, J. BIOL. CHEM., vol. 272, 1997, pages 10678 - 10684 |
BARTELS CLAUDINE L ET AL: "MicroRNAs: novel biomarkers for human cancer", CLINICAL CHEMISTRY, AMERICAN ASSOCIATION FOR CLINICAL CHEMISTRY, WASHINGTON, DC, vol. 55, no. 4, 1 April 2009 (2009-04-01), pages 623 - 631, XP009131114, ISSN: 0009-9147 * |
BOERNER ET AL., J. IMMUNOL., vol. 147, 1991, pages 86 |
BOLSTAD ET AL., BIOINFORMATICS, vol. 19, 2003, pages 185 - 193 |
BRENNAN, SCIENCE, vol. 229, 1985, pages 81 |
BRODEUR ET AL.: "Monoclonal Antibody Production Techniques and Applications", 1987, MARCEL DEKKER, INC., pages: 51 - 63 |
CALIN G A ET AL: "A MICRORNA SIGNATURE ASSOCIATED WITH PROGNOSIS AND PROGRESSION IN CHRONIC LYMPHOCYTIC LEUKEMIA", NEW ENGLAND JOURNAL OF MEDICINE, MASSACHUSETTS MEDICAL SOCIETY, BOSTON, MA, US, vol. 353, no. 17, 27 October 2005 (2005-10-27), pages 1793 - 1801, XP009058593, ISSN: 1533-4406, DOI: 10.1056/NEJMOA050995 * |
CARTER ET AL., PROC. NATL. ACAD. SCI. USA, vol. 89, 1992, pages 4285 |
CARTRON ET AL., BLOOD, vol. 99, no. 3, 2002, pages 754 - 758 |
CHARI ET AL., CANCER RES., vol. 52, 1992, pages 127 - 131 |
CLACKSON ET AL., NATURE, vol. 352, 1991, pages 624 - 628 |
CLARK ET AL., PROC. NATL. ACAD. SCI. (USA, vol. 82, 1985, pages 1766 |
COIFFIER ET AL., N. ENGL J. MED., vol. 346, 2002, pages 235 - 242 |
CRAGG ET AL., BLOOD, vol. 101, 2003, pages 1045 - 1052 |
CRONIN ET AL., AM. J. PATHOL., vol. 164, no. 1, 2004, pages 35 - 42 |
DALL'ACQUA ET AL., METHODS, vol. 36, 2005, pages 43 - 60 |
DCY ET AL., GENE, vol. 209, no. 1-2, 1998, pages 175 - 83 |
DE ANDRÉS ET AL., BIOTECHNIQUES, vol. 18, 1995, pages 42044 |
DELGADO JULIO ET AL: "Emerging therapies for patients with advanced chronic lymphocytic leukaemia.", BLOOD REVIEWS SEP 2009 LNKD- PUBMED:19643519, vol. 23, no. 5, September 2009 (2009-09-01), pages 217 - 224, XP002665077, ISSN: 1532-1681 * |
DIEFFENBACH ET AL.: "PCR Primer, A Laboratory Manual", 1995, COLD SPRING HARBOR LABORATORY PRESS, article "General Concepts for PCR Primer Design", pages: 133 - 155 |
DING ET AL., NAT. CELL BIOL., vol. 12, no. 4, 2010, pages 390 - 399 |
DOMAN ET AL., BLOOD, vol. 114, 2009, pages 2338 |
DUBOWCHIK ET AL., BIOORG. & MED. CHEM. LETTERS, vol. 12, 2002, pages 1529 - 1532 |
DUNCAN, WINTER, NATURE, vol. 322, 1988, pages 738 - 40 |
FARAG ET AL., BLOOD, vol. 103, 2004, pages 1472 - 1474 |
FCUGICR ET AL., J CLIN ONCOL., vol. 23, no. 18, 2005, pages 4117 - 4126 |
FERRACIN MANUELA ET AL: "MicroRNAs involvement in fludarabine refractory chronic lymphocytic leukemia", MOLECULAR CANCER, BIOMED CENTRAL, LONDON, GB, vol. 9, no. 1, 26 May 2010 (2010-05-26), pages 123, XP021077871, ISSN: 1476-4598, DOI: 10.1186/1476-4598-9-123 * |
FEUGIER ET AL., J CLIN ONCOL., vol. 23, no. 18, 2005, pages 4117 - 4126 |
FULCI ET AL., GENES, CHROMOSOMES & CANCER, vol. 48, no. 12, 2009, pages 1069 - 1082 |
GENTILE M ET AL: "Rituximab for the treatment of patients with chronic lymphocytic leukemia.", CANCER MANAGEMENT AND RESEARCH 2010 LNKD- PUBMED:21188098, vol. 2, 11 March 2010 (2010-03-11), pages 71 - 81, XP002665076, ISSN: 1179-1322 * |
GLENNIE, VAN DE WINKE, DRUG DISCOVERY TODAY, vol. 8, 2003, pages 503 - 510 |
GODFREY ET AL., J. MOLEC. DIAGNOSTICS, vol. 2, 2000, pages 84 - 91 |
GOLAY ET AL., BLOOD, vol. 95, no. 12, 2000, pages 3900 - 3908 |
GOLAY, BLOOD, vol. 95, no. 12, 2000, pages 3900 - 3908 |
GOLDENBERG ET AL., BLOOD, vol. 113, no. 5, 2009, pages 1062 - 1070 |
GORMAN ET AL., DNA PROT. ENG. TECH., vol. 2, 1990, pages 3 - 10 |
GRIFFITHS ET AL., EMBOJ, vol. 12, 1993, pages 725 - 734 |
GRUBER ET AL., IMMUNOL., vol. 152, 1994, pages 5368 |
GUO ET AL., NATURE, vol. 466, no. 7308, 2010, pages 835 - 40 |
GUYER ET AL., J. IMMUNOL., vol. 117, 1976, pages 587 |
HALLEK ET AL., BLOOD, vol. 112, 2008, pages 325 |
HALLEK ET AL., BLOOD, vol. 114, 2009 |
HALLEK,M.: "State-of-the-art treatment of chronic lymphocytic leukemia", HEMATOLOGY, vol. 2009, no. 1, 2009, pages 440 - 449, XP002665073, DOI: 10.1183/asheducation-2009.1.440 * |
HARJUNPAA ET AL., SCAND IMMUNOL., vol. 51, no. 6, 2000, pages 634 - 641 |
HELD ET AL., GENOME RESEARCH, vol. 6, 1996, pages 986 - 994 |
HIDDEMANN ET AL., BLOOD, vol. 106, 2005, pages 3725 - 3732 |
HIDDEMANN ET AL., BLOOD, vol. 106, 2005, pages 3725 - 3732, Retrieved from the Internet <URL:http://microrna.sanger.ac.uk/secquences/index.shtml> |
HINMAN, CANCER RES., vol. 53, 1993, pages 3336 - 3342 |
HOD, BIOTECHNIQUES, vol. 13, 1992, pages 852 - 854 |
HOFMEISTER ET AL., BLOOD CELLS MOL DIS., vol. 6, no. 2, 2000, pages 133 - 143 |
HOLLINGER ET AL., PROC. NATL. ACAD. SCI. USA, vol. 90, 1993, pages 6444 - 6448 |
HOOGENBOOM ET AL.: "Methods in Molecular Biology", vol. 178, 2001, HUMAN PRCSS, pages: 1 - 37 |
HOOGENBOOM, WINTER, J. MOL. BIOL., vol. 227, 1992, pages 381 - 388 |
HUDSON ET AL., NAT. MED., vol. 9, 2003, pages 129 - 134 |
HUDSON, NAT. MED., vol. 9, 2003, pages 129 - 134 |
IDUSOGIC, J. IMMUNOL., vol. 164, 2000, pages 4178 - 4184 |
INGHAM ET AL., J. BIOL. CHEM., vol. 276, no. 15, 2001, pages 12257 - 65 |
INNIS, GELFAND: "PCR Protocols, A Guide to Methods and Applications", 1994, CRC PRESS, article "Optimization of PCRs", pages: 5 - 11 |
IRIZARRY ET AL., BIOSTATISTICS, vol. 4, no. 2, 2003, pages 249 - 264 |
IVANOV, J. CLIN. INVEST., vol. 119, no. 8, 2009, pages 2143 - 2159 |
JEFFREY ET AL., BIOORGANIC & MED. CHEM. LETTERS, vol. 16, 2006, pages 358 - 362 |
KABAT ET AL.: "Sequences of Proteins of Immunological Interest", 1991, NATIONAL INSTITUTES OF HEALTH |
KABAT ET AL.: "Sequences ofProteins oflmmunological Interest", 1991, NATIONAL INSTITUTES OF HEALTH |
KAM ET AL., PROC. NATL. ACAD. SCI. USA, vol. 102, 2005, pages 11600 - 11605 |
KANDA, Y. ET AL., BIOTECHNOL. BIOENG., vol. 94, no. 4, 2006, pages 680 - 688 |
KASHMIRI ET AL., METHODS, vol. 36, 2005, pages 25 - 34 |
KAWAHARA ET AL., EMBO, vol. 8, no. 8, 2007, pages 763 - 769 |
KENT, W., GENOME RES., vol. 12, no. 4, 2002, pages 656 - 64 |
KIM ET AL., J. IMMUNOL., vol. 24, 1994, pages 249 |
KING, J. MED. CHEM., vol. 45, 2002, pages 4336 - 4343 |
KLIMKA ET AL., BR. J. CANCER, vol. 83, 2000, pages 252 - 260 |
KOSTELNY ET AL., J. IMMUNOL., vol. 148, no. 5, 1992, pages 1547 - 1553 |
KOZBORJ., IMMUNOL., vol. 133, 1984, pages 3001 |
KRATZ ET AL., CURRENT MED. CHEM., vol. 13, 2006, pages 477 - 523 |
KUNKEL, PROC. NATL. ACAD. SCI. (USA, vol. 82, 1985, pages 488 - 492 |
LEE ET AL., J. IMMUNOL. METHODS, vol. 284, no. 1-2, 2004, pages 119 - 132 |
LEE ET AL., MOL. BIOL., vol. 340, no. 5, 2004, pages 1073 - 1093 |
LI ET AL., PROC. NATL. ACAD. SCI. USA, vol. 103, 2006, pages 3557 - 3562 |
LODE ET AL., CANCER RES., vol. 58, 1998, pages 2925 - 2928 |
LONBERG, CURR. OPIN. IMMUNOL., vol. 20, 2008, pages 450 - 459 |
LONBERG, NAT. BIOTECH., vol. 23, 2005, pages 1117 - 1125 |
MA ET AL., CANCER CELL, vol. 5, 2004, pages 607 - 616 |
MAHER ET AL.: "Transcriptome sequencing to detect gene fusions in cancer", NATURE, vol. 458, no. 7234, January 2009 (2009-01-01), pages 97 - 101 |
MARCUS ET AL., J CLIN ONCOL., vol. 26, 2008, pages 4579 - 4586 |
MARKS ET AL., J. MOL. BIOL., vol. 222, 1992, pages 581 - 597 |
MARKS, BRADBURY: "Methods in Molecular Biology", vol. 248, 2003, HUMAN PRESS, pages: 161 - 175 |
MARTON S ET AL: "Small RNAs analysis in CLL reveals a deregulation of miRNA expression and novel miRNA candidates of putative relevance in CLL pathogenesis", LEUKEMIA (BASINGSTOKE), vol. 22, no. 2, February 2008 (2008-02-01), pages 330 - 338, XP002665081, ISSN: 0887-6924 * |
MCCAFFERTY, NATURE, vol. 348, pages 552 - 554 |
MILSTEIN, CUELLO, NATURE, vol. 305, 1983, pages 537 |
MORENO, MONSERRAT, BLOOD REVIEWS, vol. 22, 2008, pages 211 - 219 |
MORRISON ET AL., PROC. NATL. ACAD. SCI. USA, vol. 81, 1984, pages 6851 - 6855 |
NAGY ET AL., PROC. NATL. ACAD. SCI. USA, vol. 97, 2000, pages 829 - 834 |
NI, XIANDAI MIANYIXUE, vol. 26, no. 4, 2006, pages 265 - 268 |
NICOLAOU ET AL., ANGEW. CHEM INTL. ED. ENGL., vol. 33, 1994, pages 183 - 186 |
OKAZAKI, J. MOL. BIOL., vol. 336, 2004, pages 1239 - 1249 |
OSBOURN ET AL., METHODS, vol. 36, 2005, pages 61 - 68 |
PADLAN, MOL. IMMUNOL., vol. 28, 1991, pages 489 - 498 |
PARKER, BARNES, METHODS IN MOLECULAR BIOLOGY, vol. 106, 1999, pages 247 - 283 |
PLASTERER, T. N.: "Primerselect: Primer and probe design", METHODS MOL. BIOL., vol. 70, 1997, pages 520 - 527 |
PLUCKTHIIN: "The Pharmacology of Monoclonal Antibodies", vol. 113, 1994, SPRINGER-VERLAG, pages: 269 - 315 |
PRESS ET AL., BLOOD, vol. 69, no. 2, 1987, pages 584 - 591 |
PRESTA ET AL., J IMMUNOL., vol. 151, 1993, pages 2623 |
PROC. NATL. ACAD. SCI. USA, vol. 101, no. 34, 2004, pages 12467 - 12472 |
QUEEN ET AL., PROC. NAT'L ACAD. SCI. USA, vol. 86, 1989, pages 10029 - 10033 |
RIECHMANN ET AL., NATURE, vol. 332, 1988, pages 323 - 329 |
RIPKA ET AL., ARCH. BIOCHEM. BIOPHYS, vol. 249, 1986, pages 533 - 545 |
ROBAK ET AL., BLOOD, vol. 112, 2008, pages 1BA - 1 |
ROBAK TADEUSZ ET AL: "Rituximab plus fludarabine and cyclophosphamide prolongs progression-free survival compared with fludarabine and cyclophosphamide alone in previously treated chronic lymphocytic leukemia.", JOURNAL OF CLINICAL ONCOLOGY : OFFICIAL JOURNAL OF THE AMERICAN SOCIETY OF CLINICAL ONCOLOGY 1 APR 2010 LNKD- PUBMED:20194844, vol. 28, no. 10, 1 April 2010 (2010-04-01), pages 1756 - 1765, XP002665074, ISSN: 1527-7755 * |
ROBAK TADEUSZ: "Improving FCR immunochemotherapy in CLL.", BLOOD 21 JAN 2010 LNKD- PUBMED:20093407, vol. 115, no. 3, 21 January 2010 (2010-01-21), pages 437 - 438, XP002665075, ISSN: 1528-0020 * |
ROBAK, BLOOD, vol. 112, 2008, pages LBA-1 |
ROBAK, J. CLIN. ONCOL., vol. 28, no. 10, 2010, pages 1756 - 1765 |
ROSOK ET AL., J. BIOL. CHEM., vol. 271, 1996, pages 22611 - 22618 |
ROZEN, SKALETSKY: "Bioinfonnatics Methods and Protocols: Methods in Molecular Biology", 2000, HUMANA PRESS, article "Primer3 on the WWW for general users and for biologist programmers", pages: 365 - 386 |
RUPP, LOCKER, LAB INVEST., vol. 56, 1987, pages A67 |
RYAN ET AL., BIOTECHNIQUES, vol. 45, no. 1, 2008, pages 81 - 94 |
SAMBROOK ET AL.: "Molecular Cloning: A Laboratory Manual", 1989, COLD SPRING HARBOR PRESS |
SCHENA ET AL., PROC. NATL. ACAD. SCI. USA, vol. 93, no. 2, 1996, pages 106 - 149 |
SCHWEIGHOFER CARMEN DIANA ET AL: "First-line treatment of chronic lymphocytic leukemia: role of alemtuzumab.", ONCOTARGETS AND THERAPY 2010 LNKD- PUBMED:20616957, vol. 3, 24 June 2010 (2010-06-24), pages 53 - 67, XP002665078, ISSN: 1178-6930 * |
SHIELDS, J BIOL. CHEM., vol. 9, no. 2, 2001, pages 6591 - 6604 |
SIDHU ET AL., J. MOL. BIOL., vol. 338, no. 2, 2004, pages 299 - 310 |
SIMS ET AL., J. IMMUNOL., vol. 151, 1993, pages 2296 |
SPECHT ET AL., AIN. J. PATHOL., vol. 158, 2001, pages 419 - 29 |
STORCY, PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES, vol. 100, 2003, pages 9440 - 9445 |
TORGOV, BIOCONJ. CHEM., vol. 16, 2005, pages 717 - 721 |
TRAUNECKER ET AL., EMBO J., vol. 10, 1991, pages 3655 |
TUTT ET AL., J. IMMUNOL., vol. 147, 1991, pages 60 |
UMANA ET AL., NATURE BIOTECHNOL., vol. 17, 1999, pages 176 - 180 |
VALENTINE ET AL.: "Leukocyte Typing", vol. III, 1987, OXFORD UNIVERSITY PRESS, pages: 440 |
VAN DIJK, VAN DE WINKEL, CURR. OPIN. PHARMACOL., vol. 5, 2001, pages 368 - 74 |
VELCULESCU ET AL., CELL, vol. 88, 1997, pages 243 - 51 |
VELCULESCU ET AL., SCIENCE, vol. 270, 1995, pages 484 - 487 |
VISONE ET AL., BLOOD, vol. 114, no. 18, 2009, pages 3872 - 3879 |
VISONE ROSA ET AL: "Karyotype-specific microRNA signature in chronic lymphocytic leukemia.", BLOOD 29 OCT 2009 LNKD- PUBMED:19717645, vol. 114, no. 18, 29 October 2009 (2009-10-29), pages 3872 - 3879, XP002665080, ISSN: 1528-0020 * |
VITCTTA, SCIENCE, vol. 238, 1987, pages 1098 |
VOLLMERS, BRANDLEIN, HISTOLOGY AND HISTOPATHOLOGY, vol. 20, no. 3, 2005, pages 927 - 937 |
VOLLMERS, BRANDLEIN, METHODS AND FINDINGS IN EXPERIMENTAL AND CLINICAL PHARMACOLOGY, vol. 27, no. 3, 2005, pages 185 - 91 |
WANG ET AL.: "RNA-Seq: a revolutionary tool for transcriptomics", NATURE REVIEWS GENETICS, vol. 10, no. 1, January 2009 (2009-01-01), pages 57 - 63, XP055152757, DOI: doi:10.1038/nrg2484 |
WEIS ET AL., TRENDS IN GENETICS, vol. 8, 1992, pages 263 - 264 |
WENG, LEVY, J CLIN ONCOL., vol. 21, no. 21, 2003, pages 3940 - 7 |
WINTER, ANN. REV. IMMUNOL., vol. 12, 1994, pages 433 - 455 |
WRIGHT ET AL., TIBTECH, vol. 15, 1997, pages 26 - 32 |
YAMANE-OHNUKI ET AL., BIOTECH. BIOENG., vol. 87, 2004, pages 614 |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US8883980B2 (en) | 2003-11-05 | 2014-11-11 | Roche Glycart Ag | Antigen binding molecules with increased Fc receptor binding affinity and effector function |
US9296820B2 (en) | 2003-11-05 | 2016-03-29 | Roche Glycart Ag | Polynucleotides encoding anti-CD20 antigen binding molecules with increased Fc receptor binding affinity and effector function |
Also Published As
Publication number | Publication date |
---|---|
JP2013541501A (en) | 2013-11-14 |
MX2013001302A (en) | 2013-03-08 |
RU2013106216A (en) | 2014-09-10 |
CA2806855A1 (en) | 2012-02-09 |
KR20130045914A (en) | 2013-05-06 |
CN103153341B (en) | 2015-05-27 |
EP2600895A1 (en) | 2013-06-12 |
BR112013002535A2 (en) | 2019-09-24 |
CN103153341A (en) | 2013-06-12 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
AU2019271922B2 (en) | Biomarkers and methods of treating PD-1 and PD-L1 related conditions | |
US20200333348A1 (en) | Biomarkers and methods of treating pd-1 and pd-l1 related conditions | |
DK2612151T3 (en) | BIOMARKETS AND METHODS OF TREATMENT | |
MX2014009512A (en) | R-spondin translocations and methods using the same. | |
TW202039580A (en) | Diagnostic methods and compositions for cancer immunotherapy | |
EP2600895A1 (en) | Chronic lymphocytic leukemia (cll) biomarkers | |
US20140017230A1 (en) | Chronic lymphocytic leukemia (cll) biomarkers | |
US20230392210A1 (en) | Methods and compositions for cancer immunotherapy | |
AU2016200630A1 (en) | Biomarkers and methods of treatment |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
WWE | Wipo information: entry into national phase |
Ref document number: 201180048232.9 Country of ref document: CN |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 11741731 Country of ref document: EP Kind code of ref document: A1 |
|
REEP | Request for entry into the european phase |
Ref document number: 2011741731 Country of ref document: EP |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2011741731 Country of ref document: EP |
|
ENP | Entry into the national phase |
Ref document number: 2806855 Country of ref document: CA |
|
WWE | Wipo information: entry into national phase |
Ref document number: MX/A/2013/001302 Country of ref document: MX |
|
ENP | Entry into the national phase |
Ref document number: 2013523261 Country of ref document: JP Kind code of ref document: A |
|
NENP | Non-entry into the national phase |
Ref country code: DE |
|
ENP | Entry into the national phase |
Ref document number: 20137004910 Country of ref document: KR Kind code of ref document: A |
|
ENP | Entry into the national phase |
Ref document number: 2013106216 Country of ref document: RU Kind code of ref document: A |
|
REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: 112013002535 Country of ref document: BR |
|
ENP | Entry into the national phase |
Ref document number: 112013002535 Country of ref document: BR Kind code of ref document: A2 Effective date: 20130201 |